ID: 1167577230

View in Genome Browser
Species Human (GRCh38)
Location 19:50323564-50323586
Sequence GGCGAAGATGAGCACCCCCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 3, 3: 5, 4: 94}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167577225_1167577230 29 Left 1167577225 19:50323512-50323534 CCAGGATGTCATCGGGGTCGGCG 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1167577230 19:50323564-50323586 GGCGAAGATGAGCACCCCCAGGG 0: 1
1: 0
2: 3
3: 5
4: 94
1167577224_1167577230 30 Left 1167577224 19:50323511-50323533 CCCAGGATGTCATCGGGGTCGGC 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1167577230 19:50323564-50323586 GGCGAAGATGAGCACCCCCAGGG 0: 1
1: 0
2: 3
3: 5
4: 94
1167577226_1167577230 6 Left 1167577226 19:50323535-50323557 CCAATGCGCTCAGCGTAGTAAAT 0: 1
1: 1
2: 0
3: 2
4: 63
Right 1167577230 19:50323564-50323586 GGCGAAGATGAGCACCCCCAGGG 0: 1
1: 0
2: 3
3: 5
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167577230 Original CRISPR GGCGAAGATGAGCACCCCCA GGG Exonic
906380914 1:45331770-45331792 GGGGAAGTTGACCACTCCCAGGG + Exonic
907284443 1:53370945-53370967 TGCGAAGTAGAGGACCCCCACGG - Intergenic
907460406 1:54602176-54602198 GGCCAGGATCAGCACCCCAATGG - Intronic
910110583 1:83678461-83678483 GGAGAAGGTGACCACCCACATGG - Intergenic
912517117 1:110223451-110223473 GGCAAAGATGAGCACACCCAGGG - Exonic
914811929 1:151035280-151035302 AGTGAACCTGAGCACCCCCAGGG - Exonic
915162510 1:153930341-153930363 GGCGCAGATGCCCACTCCCAAGG - Exonic
923800575 1:237205086-237205108 GGCTGACATGAGCTCCCCCAAGG + Intronic
1067682717 10:48450764-48450786 GGAGATGATGGGCACCTCCAGGG + Exonic
1069654563 10:70078294-70078316 GGAGAGGATGAGCACCTGCAAGG + Intronic
1070342506 10:75510784-75510806 GGAGGAGATGAGCAAGCCCAGGG + Intronic
1071375968 10:85003650-85003672 GGGGAAGATGATCACACCCTAGG + Intergenic
1072248951 10:93566854-93566876 TGCAAAGATGAGCACCAGCACGG - Exonic
1073094610 10:100971994-100972016 GGCAGAGATGTGCACCCCCTTGG + Intronic
1076272673 10:129168450-129168472 GGTGAAGCTGACCAGCCCCAAGG + Intergenic
1076765736 10:132632023-132632045 GGTGGAGATGTGCACCCCCATGG + Intronic
1079135130 11:17772152-17772174 GGCGAAGATCAGCACGCCCAAGG - Exonic
1084266691 11:68008720-68008742 GGCCATGATGAGCACCTCCCAGG + Intronic
1084657695 11:70528747-70528769 GGCGTAGGTGATCTCCCCCACGG - Intronic
1087169078 11:95032081-95032103 GGGAAAGATGAGCAGCCCTAGGG + Intergenic
1090334484 11:125953563-125953585 GGCGCAGCTGGGCACCCTCAGGG - Intergenic
1104429546 12:128705471-128705493 GGCCAAGATGGGCACCTCTATGG + Exonic
1106043480 13:26116235-26116257 AGTGAACCTGAGCACCCCCAGGG + Intergenic
1114483357 14:23048457-23048479 GGCCACGAAGAGCACCACCAGGG + Exonic
1116422020 14:44744320-44744342 GGAGAAGTTGAGCACAGCCATGG + Intergenic
1121792763 14:96711540-96711562 TGCAAAGATGAACACCCCCGAGG + Intergenic
1125733035 15:41904790-41904812 GGACAAGATGAGCACCCGAAGGG - Intronic
1127465878 15:59244240-59244262 GGCCAAGATGAGCATTGCCATGG - Intronic
1128103969 15:65029452-65029474 GCCGAAGAAGAGCACCCGCCAGG + Exonic
1132997613 16:2831332-2831354 GGTGAAGATGAGCCCCGTCAGGG + Intronic
1136146657 16:28320359-28320381 GCAGAAGATGAGCACGCCGAAGG - Exonic
1136222948 16:28840239-28840261 GGCTAAGATGAGCTCCCAGAAGG - Intergenic
1141501922 16:84450425-84450447 GGGGAAGATGAAAAACCCCACGG + Intronic
1142476951 17:194272-194294 AGTGAGGATGAGCCCCCCCATGG - Intergenic
1143056837 17:4169044-4169066 GGATGAGATGAGCACACCCAAGG - Intronic
1143059322 17:4186772-4186794 GGAGTAGATCAGCACACCCAAGG - Intronic
1148124769 17:45231033-45231055 GGTGAAGATGTCCAACCCCAGGG - Intronic
1148127103 17:45242535-45242557 GGAGAAAATGACTACCCCCAGGG - Intronic
1152455876 17:80415790-80415812 AGGGAAGCTGAGCACCACCAGGG - Exonic
1161611204 19:5243956-5243978 GGTGAAGGCGAGCACCCGCACGG + Exonic
1162735663 19:12745668-12745690 GGGGAAGTTGAGCAGCCTCAGGG - Exonic
1162745673 19:12796719-12796741 GGCGAAGATGAGCAACCACAGGG + Intronic
1164783424 19:30911577-30911599 AGGGAAGATGAGGTCCCCCAAGG - Intergenic
1165068702 19:33242986-33243008 GGGGGAGGGGAGCACCCCCAGGG + Intergenic
1165838183 19:38771847-38771869 CGCGATGATGAGCACCTCGAAGG + Exonic
1165841382 19:38790850-38790872 CGCGATGATGAGCACCTCGAAGG - Exonic
1167577230 19:50323564-50323586 GGCGAAGATGAGCACCCCCAGGG + Exonic
1167744758 19:51344103-51344125 TGCGAGGATCAGCAGCCCCATGG + Intergenic
926174913 2:10582282-10582304 GAAGAAGATGAGCTCCCCAAAGG + Intronic
933970241 2:87464162-87464184 TGCGGAGATGAGCAGACCCAGGG + Intergenic
934847249 2:97669782-97669804 GGCAAAGATGAGCAGAGCCATGG + Intergenic
936323540 2:111486334-111486356 TGCGGAGATGAGCAGACCCAGGG - Intergenic
942150894 2:173075626-173075648 GGCGAGGGGGAACACCCCCACGG + Intronic
943547357 2:189297080-189297102 TTCAAAGATGAGCACCACCATGG - Intergenic
946692361 2:222319313-222319335 GGTGAAGAGCAGCACCACCATGG + Intergenic
1170118987 20:12892144-12892166 AGCAAAGATGGGCACCCTCAAGG + Intergenic
1178943268 21:36925363-36925385 GGCCACGATGAACACCCACAAGG + Intronic
1179370803 21:40804546-40804568 GGAGAAGATGAGAGCCCCCACGG + Intronic
1181094865 22:20497915-20497937 GGGGAAGATGAGGCCCCCCTTGG + Intronic
1184819510 22:46898958-46898980 GGAGAGGATCAGCACCCCCAGGG - Intronic
952904498 3:38130900-38130922 GGGGGAGGTGAGCAGCCCCAGGG - Intronic
953826930 3:46261623-46261645 TGCTAAGATGGGGACCCCCAAGG + Intronic
954408469 3:50358758-50358780 GAAGAAGATGAGCAGCTCCAAGG + Exonic
959573029 3:107906116-107906138 GGCCAAGGAGAGCACTCCCAGGG + Intergenic
962479622 3:135787210-135787232 GGGGCAGATGATTACCCCCAAGG + Intergenic
964783701 3:160370596-160370618 GGGGAAGTTGAGACCCCCCAAGG - Intronic
965977296 3:174641005-174641027 GGCGAGGATGGGCGCCCCAAAGG + Intronic
968813032 4:2808735-2808757 GGGGAAGGCGGGCACCCCCAGGG - Intronic
970510517 4:16777268-16777290 GGAGAGGATGGGCACCCTCATGG + Intronic
975058055 4:69960975-69960997 GGCGAGGATGAGGACCTTCATGG + Exonic
978737717 4:112103072-112103094 GGGGCAGAGGAGCAACCCCAAGG + Intergenic
981401960 4:144323389-144323411 GTAGAAGATGACCATCCCCAAGG + Intergenic
983710270 4:170706612-170706634 AGTGAAGATGAGCTCACCCAAGG + Intergenic
985847723 5:2364732-2364754 GGGGAAGCTGAGCACCCACCTGG + Intergenic
989368605 5:40681826-40681848 GGAGCAGATGAGCACCACCAGGG - Exonic
998327397 5:141293711-141293733 GGAGAATATGAGCAGGCCCATGG + Intergenic
999517707 5:152317610-152317632 GGTGAAGATGAATAACCCCAAGG - Intergenic
1001366976 5:171151934-171151956 GGAGCAGATGAACTCCCCCAAGG + Intronic
1005882341 6:30071168-30071190 CGGGAAGATGCGCTCCCCCAGGG + Exonic
1005987496 6:30884024-30884046 GGCAAAGGGGAGCAGCCCCAGGG - Intronic
1006146755 6:31963968-31963990 GGAGAAGGTGAACACCACCACGG - Exonic
1017907594 6:158767640-158767662 TTCGAAGAGGAGCACCCTCAGGG + Intronic
1018843824 6:167540310-167540332 GGCGAGAATGAGCACCCCAGAGG + Intergenic
1021486186 7:21170611-21170633 GGAGCAGAGGAGCATCCCCAGGG + Intergenic
1026450573 7:70525756-70525778 GGAGAAGATGAACACTCGCATGG + Intronic
1026847461 7:73705959-73705981 GGGCAAGCTGGGCACCCCCATGG - Intronic
1032165480 7:129541543-129541565 AGTGAAGATGAGCACGCCAACGG + Intergenic
1034899286 7:154897542-154897564 GGTGAGGACGAGCACCCCAAGGG - Intergenic
1045247694 8:100458116-100458138 AGGGCAGATGAGCAGCCCCAAGG - Intergenic
1045487243 8:102641004-102641026 GGAGAAGATGGCCACCCACAAGG + Intergenic
1049245054 8:141557915-141557937 GGCAGAGCTGGGCACCCCCATGG - Intergenic
1049369657 8:142257730-142257752 GAGGAAGAGTAGCACCCCCAGGG - Intronic
1053203897 9:36170720-36170742 AGGAAAGATGAGCATCCCCATGG + Exonic
1056225777 9:84493744-84493766 GATGCAGATGAGCAGCCCCATGG - Intergenic
1057208864 9:93188769-93188791 GACCCAGATCAGCACCCCCAGGG - Intronic
1057283566 9:93729602-93729624 GGAGAAGCTGATCACACCCAGGG - Intergenic
1058246356 9:102630912-102630934 GTAAAAGATGAGCAACCCCAAGG - Intergenic
1203794198 EBV:167730-167752 GGAGATGATGACGACCCCCACGG - Intergenic
1190691052 X:52913476-52913498 GCCGGAGCTGAGCACCCCAATGG + Intergenic
1190694931 X:52942316-52942338 GCCGGAGCTGAGCACCCCAATGG - Intronic
1191899037 X:66022443-66022465 TGCGAAGATGGCCACCCTCATGG + Exonic
1195772804 X:108370256-108370278 TGTGAAGATGATCACCCCCAAGG - Intronic
1200072552 X:153536340-153536362 GGCGGAGCTGCGCACCCTCATGG + Exonic