ID: 1167577574

View in Genome Browser
Species Human (GRCh38)
Location 19:50325193-50325215
Sequence ATAAAGCCCATGACATCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 180}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167577574_1167577583 7 Left 1167577574 19:50325193-50325215 CCTAGAGATGTCATGGGCTTTAT 0: 1
1: 0
2: 1
3: 10
4: 180
Right 1167577583 19:50325223-50325245 GCAGAGGGGTGGGAGGGGAGAGG 0: 1
1: 1
2: 40
3: 391
4: 3445
1167577574_1167577578 -4 Left 1167577574 19:50325193-50325215 CCTAGAGATGTCATGGGCTTTAT 0: 1
1: 0
2: 1
3: 10
4: 180
Right 1167577578 19:50325212-50325234 TTATCAGATATGCAGAGGGGTGG 0: 1
1: 0
2: 0
3: 14
4: 171
1167577574_1167577577 -7 Left 1167577574 19:50325193-50325215 CCTAGAGATGTCATGGGCTTTAT 0: 1
1: 0
2: 1
3: 10
4: 180
Right 1167577577 19:50325209-50325231 GCTTTATCAGATATGCAGAGGGG 0: 1
1: 0
2: 2
3: 6
4: 144
1167577574_1167577587 27 Left 1167577574 19:50325193-50325215 CCTAGAGATGTCATGGGCTTTAT 0: 1
1: 0
2: 1
3: 10
4: 180
Right 1167577587 19:50325243-50325265 AGGAGTGCATTGGAGAGGGAAGG 0: 1
1: 0
2: 2
3: 76
4: 1029
1167577574_1167577582 2 Left 1167577574 19:50325193-50325215 CCTAGAGATGTCATGGGCTTTAT 0: 1
1: 0
2: 1
3: 10
4: 180
Right 1167577582 19:50325218-50325240 GATATGCAGAGGGGTGGGAGGGG 0: 1
1: 0
2: 5
3: 46
4: 542
1167577574_1167577581 1 Left 1167577574 19:50325193-50325215 CCTAGAGATGTCATGGGCTTTAT 0: 1
1: 0
2: 1
3: 10
4: 180
Right 1167577581 19:50325217-50325239 AGATATGCAGAGGGGTGGGAGGG 0: 1
1: 0
2: 3
3: 34
4: 452
1167577574_1167577584 17 Left 1167577574 19:50325193-50325215 CCTAGAGATGTCATGGGCTTTAT 0: 1
1: 0
2: 1
3: 10
4: 180
Right 1167577584 19:50325233-50325255 GGGAGGGGAGAGGAGTGCATTGG 0: 1
1: 0
2: 19
3: 537
4: 4722
1167577574_1167577575 -9 Left 1167577574 19:50325193-50325215 CCTAGAGATGTCATGGGCTTTAT 0: 1
1: 0
2: 1
3: 10
4: 180
Right 1167577575 19:50325207-50325229 GGGCTTTATCAGATATGCAGAGG 0: 1
1: 0
2: 0
3: 12
4: 91
1167577574_1167577576 -8 Left 1167577574 19:50325193-50325215 CCTAGAGATGTCATGGGCTTTAT 0: 1
1: 0
2: 1
3: 10
4: 180
Right 1167577576 19:50325208-50325230 GGCTTTATCAGATATGCAGAGGG 0: 1
1: 0
2: 0
3: 11
4: 140
1167577574_1167577580 0 Left 1167577574 19:50325193-50325215 CCTAGAGATGTCATGGGCTTTAT 0: 1
1: 0
2: 1
3: 10
4: 180
Right 1167577580 19:50325216-50325238 CAGATATGCAGAGGGGTGGGAGG 0: 1
1: 0
2: 1
3: 38
4: 389
1167577574_1167577585 22 Left 1167577574 19:50325193-50325215 CCTAGAGATGTCATGGGCTTTAT 0: 1
1: 0
2: 1
3: 10
4: 180
Right 1167577585 19:50325238-50325260 GGGAGAGGAGTGCATTGGAGAGG 0: 1
1: 1
2: 41
3: 429
4: 3558
1167577574_1167577579 -3 Left 1167577574 19:50325193-50325215 CCTAGAGATGTCATGGGCTTTAT 0: 1
1: 0
2: 1
3: 10
4: 180
Right 1167577579 19:50325213-50325235 TATCAGATATGCAGAGGGGTGGG 0: 1
1: 0
2: 1
3: 16
4: 149
1167577574_1167577586 23 Left 1167577574 19:50325193-50325215 CCTAGAGATGTCATGGGCTTTAT 0: 1
1: 0
2: 1
3: 10
4: 180
Right 1167577586 19:50325239-50325261 GGAGAGGAGTGCATTGGAGAGGG 0: 1
1: 0
2: 9
3: 60
4: 638

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167577574 Original CRISPR ATAAAGCCCATGACATCTCT AGG (reversed) Intronic
908758174 1:67488104-67488126 ACAAAGCCTATGACATCATTTGG + Intergenic
910662352 1:89687429-89687451 AGAAAGAACATGACATCTTTGGG + Intronic
916373748 1:164128803-164128825 ATGAAGCACATGACAGCTATAGG - Intergenic
917892949 1:179456769-179456791 ATGAAGCCCTAGCCATCTCTTGG + Intronic
921246401 1:213246568-213246590 ATAAAGCACATAAAATCTTTTGG - Intronic
921391540 1:214619916-214619938 ACAAAGCACATGATATTTCTAGG - Intronic
1065770228 10:29071281-29071303 ATAAGTCTCATGAGATCTCTTGG - Intergenic
1065945228 10:30600146-30600168 TTAAAGTCCATGACATCACACGG - Intergenic
1068506295 10:57903974-57903996 ATTAAGACCATGAAATTTCTTGG + Intergenic
1070791890 10:79194604-79194626 ATAGAGCCCTGGATATCTCTGGG - Intronic
1072845072 10:98820366-98820388 ATAAAACCAAGGACTTCTCTTGG + Intronic
1073798278 10:107012778-107012800 ATAAATCCCATGGTATCTGTGGG - Intronic
1073834071 10:107420343-107420365 AGAAAGCCCATGCCATTTCTAGG - Intergenic
1075703112 10:124482033-124482055 AGAAAGCCCTTGACATTTCTGGG + Intronic
1079350549 11:19688200-19688222 ATGAAGCCCCTGAAAACTCTTGG + Intronic
1082764560 11:57156651-57156673 ATAAAGCACAGGATGTCTCTGGG + Intergenic
1085916037 11:80889193-80889215 ATACAGACCATGAGATATCTCGG + Intergenic
1086273239 11:85093668-85093690 ATAAACCTCATGACATCTGATGG - Intronic
1086545113 11:87958614-87958636 ATAAAGTCAAGGACATCTTTAGG - Intergenic
1088562202 11:111126550-111126572 ATAAAGCCCCTGGACTCTCTAGG - Intergenic
1089042741 11:115468952-115468974 ATAAATCTCATGACATCTGATGG - Intronic
1089181122 11:116583491-116583513 ATAATTGCCATGACAACTCTAGG - Intergenic
1089726487 11:120484984-120485006 AGAATACCCATGACATCTGTGGG - Intronic
1090717906 11:129446529-129446551 ATAACGGCAATAACATCTCTTGG - Intronic
1090891718 11:130929430-130929452 ATAAAGCCCCTCACATATATGGG + Intergenic
1091205365 11:133817443-133817465 ATACAGCCAATGACTGCTCTTGG + Intergenic
1091873178 12:3912097-3912119 ATAAAGCACCTGACCTCTCAGGG - Intergenic
1092782670 12:12001727-12001749 ATAAAGCCCATGAAAACGCCAGG + Intergenic
1095700019 12:45181562-45181584 ATAAAGCCCACAATATTTCTTGG - Intergenic
1095851390 12:46811278-46811300 AAAATGCCCATGACATCTGAGGG + Intronic
1095865082 12:46962897-46962919 ATGAAGCCCATGCAATATCTGGG - Intergenic
1098227920 12:68343752-68343774 ATAAAGCTGAGGAAATCTCTTGG + Intergenic
1101050877 12:100862756-100862778 ATAATGGCTATGACATCACTAGG + Intronic
1101369126 12:104108802-104108824 GTAAACACCCTGACATCTCTAGG - Intergenic
1103538216 12:121648127-121648149 AAAAAGTCCAGGACTTCTCTGGG - Intergenic
1104190088 12:126472957-126472979 AGAAAGTCCATAACTTCTCTTGG + Intergenic
1106106462 13:26737579-26737601 ATAAGTCTCATGAGATCTCTTGG + Intergenic
1108269983 13:48750006-48750028 ATTAAGCCCTTGTCATTTCTGGG - Intergenic
1109744284 13:66601785-66601807 ATTATGGCCATGACATCACTAGG - Intronic
1110184637 13:72658273-72658295 ATAAGTCTCATGACATCTGTTGG - Intergenic
1110245821 13:73323354-73323376 ATGAAGCACATTAAATCTCTTGG - Intergenic
1112295062 13:98179259-98179281 ATAAATCCCATGAGATCTGATGG - Intronic
1116664537 14:47758189-47758211 CTAAAGCCCATAACACATCTTGG + Intergenic
1116813440 14:49561659-49561681 ATAAGTCCCATGAGATCTGTTGG + Intergenic
1118236304 14:64008353-64008375 ATTAGGCCCAGGACATCTTTGGG + Intronic
1119476541 14:74933663-74933685 ATAAAGTGGATCACATCTCTTGG - Intergenic
1120312373 14:82845683-82845705 AAAAAGCCCATCACTTCTCTGGG - Intergenic
1124510739 15:30322269-30322291 ATAAACCCCATGAAATCTCGAGG - Intergenic
1124732149 15:32208266-32208288 ATAAACCCCATGAAATCTCGAGG + Intergenic
1126499973 15:49334792-49334814 TTAAAGGCAATGACATCTCAAGG + Intronic
1126973745 15:54150278-54150300 AAACAACCCTTGACATCTCTTGG + Intronic
1127838822 15:62812324-62812346 ATAATGTACATGACATCTATGGG + Intronic
1129930754 15:79408705-79408727 ATAAATCACTTGACCTCTCTAGG + Intronic
1131559520 15:93427305-93427327 CTAAAGCCCATGGCATCTCAAGG - Intergenic
1131694838 15:94865125-94865147 CTGAAGCCAATGACATTTCTTGG - Intergenic
1134778871 16:16877337-16877359 ACAAAGCCTATGACTTCACTTGG - Intergenic
1137254450 16:46763512-46763534 ATGAAGGCGATGACTTCTCTTGG + Intronic
1139122893 16:64042402-64042424 ATAAGTCTCATGACATCTCATGG - Intergenic
1139742646 16:69048793-69048815 AGTAAGCCCCTGAAATCTCTAGG - Intronic
1141783572 16:86182167-86182189 ATATAGCCCATGCCATGTCGTGG + Intergenic
1141928349 16:87183984-87184006 AAAAAGCTCATGAGAGCTCTGGG - Intronic
1142342703 16:89534282-89534304 TTCAAGCACATAACATCTCTAGG + Intronic
1148246924 17:46038427-46038449 ATAAAGCCCAGGGCATTTATAGG - Intronic
1151285162 17:73105647-73105669 ATGAAGCCCATCGCATCCCTGGG + Intergenic
1159100682 18:63955078-63955100 AAGAAGCTGATGACATCTCTTGG - Intronic
1159571327 18:70116557-70116579 ATTAAGCACTTGACATCTGTAGG - Intronic
1165918672 19:39277924-39277946 TTAAAACCAATCACATCTCTGGG - Intergenic
1167577574 19:50325193-50325215 ATAAAGCCCATGACATCTCTAGG - Intronic
1168573743 19:57491260-57491282 ATAAAGTCCATCTCAGCTCTGGG - Intronic
1168575352 19:57504449-57504471 ATAAAGTCCATCTCAGCTCTGGG - Intronic
926912891 2:17867804-17867826 ATAAATCTCATGAGATCTTTAGG + Intergenic
927401748 2:22720408-22720430 ATAAATCTCATGAGATCTGTTGG - Intergenic
931848722 2:66231639-66231661 TTAAAGTCTATGACATTTCTTGG - Intergenic
932138085 2:69248323-69248345 ATAAAGCCGATGATATTTCATGG + Exonic
933181155 2:79229383-79229405 ATAAATCTCATGACATCTGATGG + Intronic
939371754 2:141310329-141310351 ACAAAGTCCTTGACATCTCTGGG + Intronic
940662504 2:156564633-156564655 ATAAAAACCATTACATCTCAAGG + Intronic
946128505 2:217585829-217585851 ATAAATCCCAAGCTATCTCTTGG + Intronic
1168792899 20:591934-591956 ATAAAAACAATGACCTCTCTGGG - Intergenic
1169618418 20:7476581-7476603 CTAAATCCCATGTAATCTCTTGG + Intergenic
1171428619 20:25064471-25064493 GCAAGGCCCCTGACATCTCTAGG + Intergenic
1172289056 20:33762139-33762161 GCAAACCCCATGACCTCTCTGGG + Intronic
1173281486 20:41632091-41632113 TCAGAGCCCATGACAACTCTGGG + Intergenic
1173646347 20:44635512-44635534 ATAAAGCCCAGCCCAGCTCTAGG + Intronic
1175048690 20:56132524-56132546 GGAAAGCCATTGACATCTCTGGG - Intergenic
1175161987 20:57015348-57015370 ATACAGCCCATGATCTCTGTGGG + Intergenic
1177260221 21:18719965-18719987 CTAAAGCCCAGGACAGGTCTAGG + Intergenic
1178660342 21:34502492-34502514 ATAAAGGACAGGACATGTCTTGG - Intergenic
1179399699 21:41072425-41072447 ATAGAGCCCCTGACCTCACTGGG + Intergenic
1180984331 22:19895541-19895563 ATAGAGCACATGGCATCTCATGG - Exonic
1181507120 22:23366815-23366837 ATAAAGCTCATGAGATCTGATGG + Intergenic
1181677454 22:24465424-24465446 ATAATGGCCATGACATCACCAGG + Intergenic
1185017176 22:48351637-48351659 ACAAAGGCCATGCCACCTCTGGG + Intergenic
1185142009 22:49107795-49107817 ATAAAATCCATGGCCTCTCTGGG + Intergenic
949829788 3:8201595-8201617 ATAAGGCCCTTGCCATTTCTGGG - Intergenic
949879629 3:8651265-8651287 ATCCAGCCCATTGCATCTCTCGG + Intronic
952209771 3:31218280-31218302 TCAAACCACATGACATCTCTAGG + Intergenic
954158256 3:48700416-48700438 ATAAAGCCCATGCAATGTGTGGG + Intronic
954171432 3:48805990-48806012 TTAAATCCCTTGACATCTGTAGG - Intronic
955739063 3:62070377-62070399 ACAAAATCCATGCCATCTCTTGG - Intronic
963251844 3:143110902-143110924 ATAAAGCCCATGTCATGGCACGG - Intergenic
966469859 3:180276896-180276918 ATACAGCCAAGGACATTTCTAGG - Intergenic
968944796 4:3658077-3658099 AACAATCCCATGACATCCCTAGG + Intergenic
969473300 4:7402944-7402966 AAAAAGCCCATGTCATTTCCAGG + Intronic
969981826 4:11164949-11164971 ATAAAGTCTATGAGATGTCTAGG + Intergenic
970845924 4:20537297-20537319 ATGATGGCCATGACATCTCGAGG + Intronic
972342165 4:38162038-38162060 ATAAATCCCATGACAGCAGTAGG + Intergenic
974575330 4:63712411-63712433 ATAAATCCCATTACAGTTCTTGG + Intergenic
975403165 4:73960941-73960963 ATAAACCTCATGACATCTGATGG + Intergenic
978680530 4:111376339-111376361 ATAAAGTCTATGAAACCTCTTGG - Intergenic
979507682 4:121516189-121516211 ATAAAACTAATGACCTCTCTTGG + Intergenic
979726557 4:123969475-123969497 ATGAAGCCCATGACCGCTCATGG - Intergenic
980545923 4:134261159-134261181 ATAAAACTCATGATATCTCATGG - Intergenic
980645845 4:135641867-135641889 ACAAAGCCCAAGACCTCACTGGG + Intergenic
983698558 4:170562845-170562867 ATAAATCACATGACATTTATTGG + Intergenic
984042379 4:174750862-174750884 AAAGGGCCCAGGACATCTCTAGG + Intronic
984233470 4:177128995-177129017 ATAAAGCCTTTGAGATGTCTGGG - Intergenic
984871157 4:184326340-184326362 ATAAAGCACATGAGATATCATGG + Intergenic
985564051 5:606472-606494 AGAAAGCCCAGGACTTCTCAGGG - Intergenic
986228577 5:5840600-5840622 ATAAAGGCTATAACATCACTAGG + Intergenic
986785638 5:11111706-11111728 ACAATGCACTTGACATCTCTGGG + Intronic
988356856 5:30187748-30187770 ATAAATCTCATGAGATCTCATGG + Intergenic
989966425 5:50470907-50470929 ATAAAGCCCACCACAGCTCAAGG - Intergenic
991142587 5:63261859-63261881 ATATAGCCTATGACACATCTAGG - Intergenic
991592107 5:68264079-68264101 ATAAAACCCATTACATCCTTGGG + Intronic
994580141 5:101631475-101631497 ATAAAAACCATGACATATGTAGG + Intergenic
995058846 5:107792379-107792401 ATAATGGCTATGACATCACTAGG + Intergenic
995713427 5:115057697-115057719 ATGAAACATATGACATCTCTGGG - Intergenic
996457613 5:123702598-123702620 ATAATGCCCTTAACATCTGTGGG - Intergenic
997248705 5:132372391-132372413 AAGAAGCACATGGCATCTCTTGG + Intronic
997556549 5:134804213-134804235 ATAAACCTCCTGACATCTCAGGG - Intronic
1000150248 5:158493329-158493351 ATAAAGCACATGACAACACAAGG + Intergenic
1000222479 5:159227296-159227318 AGAAAGCCCATGCCCTCTCTGGG + Intergenic
1000398013 5:160796535-160796557 ACAAGGCCCATCACATCCCTAGG + Intronic
1004052944 6:12107129-12107151 ACTAAACCCATGGCATCTCTAGG - Intronic
1004249500 6:14012023-14012045 ATAAATCTCATGAGATCTCATGG - Intergenic
1004738243 6:18430073-18430095 AAAAAGTCCATGACATTTATCGG + Intronic
1004948772 6:20644937-20644959 GTACAGCCTATGACATATCTAGG + Intronic
1010514102 6:76752791-76752813 ATAAATACCAAGACATCTCCAGG - Intergenic
1014147505 6:118015034-118015056 ATAAGTCTCATGACATCTCATGG + Intronic
1014469735 6:121799606-121799628 ATTAAGCCCATAACATCTCTGGG - Intergenic
1015453202 6:133394576-133394598 AAAAAGCCTATGACAAATCTAGG + Intronic
1015831630 6:137376354-137376376 ATAAATCCCATGAGATCTGATGG + Intergenic
1018648141 6:165967111-165967133 TCAAAGCCCAGGGCATCTCTAGG - Intronic
1022711249 7:32853163-32853185 AAAGAGCCCAGGACTTCTCTGGG + Intergenic
1022913408 7:34921801-34921823 AAAGAGCCCAGGACCTCTCTGGG - Intergenic
1022992146 7:35719010-35719032 ATAGAGCCCATGAGATTTCATGG + Intergenic
1023294542 7:38701233-38701255 AGAAAACCAATGACATATCTAGG + Intergenic
1024244523 7:47459235-47459257 CCAAAGCACATGGCATCTCTGGG - Intronic
1025298844 7:57799889-57799911 ACAAAGCCCATGCTACCTCTAGG - Intergenic
1030292013 7:107882165-107882187 ATATAGCATATGTCATCTCTTGG - Intergenic
1030617913 7:111757592-111757614 ATTTAGCCCATCAAATCTCTGGG + Intronic
1030969762 7:116041727-116041749 ATAAAACCTGTGAAATCTCTGGG - Intronic
1031956447 7:127947345-127947367 ATAAAGCTCCTGGCATATCTAGG - Intronic
1032779823 7:135156367-135156389 ATAAAGCCTTTGAGATGTCTGGG - Intronic
1034080425 7:148272323-148272345 ATAAAGTCTATGACATCACTCGG - Intronic
1034309469 7:150074157-150074179 AGAAAGCCCCTAACTTCTCTAGG + Intergenic
1034797387 7:154026484-154026506 AGAAAGCCCTTAACTTCTCTAGG - Intronic
1035931071 8:3780732-3780754 ATAAAGCCCATTTAATCTCTTGG + Intronic
1036046964 8:5153836-5153858 ATAAAGTTCAGGACAACTCTTGG + Intergenic
1037244979 8:16823143-16823165 ATAAATCTCATGAGATCTCATGG - Intergenic
1039934035 8:42024264-42024286 ATAATGTCTATGACATCACTAGG + Intronic
1047324204 8:123820771-123820793 CTAATGTCCATGAAATCTCTCGG - Intergenic
1048122937 8:131601825-131601847 AGAAACCCTATGACATCTTTAGG - Intergenic
1048313832 8:133347585-133347607 ATAAATCTCATGAGATCTCATGG + Intergenic
1049704158 8:144032120-144032142 ATAAAGCCTAAGAGACCTCTGGG - Intronic
1050897625 9:10902850-10902872 ATAAGGCCCATGACAGCTGATGG - Intergenic
1051276627 9:15405102-15405124 ATACAGCCAATGACATTACTAGG - Intergenic
1051979644 9:22998355-22998377 ATAAATCTCATGACATCTGATGG - Intergenic
1052692228 9:31829350-31829372 CTAAAACCCATGTCATCTGTAGG - Intergenic
1053536267 9:38929469-38929491 TTCAAGCCAATGACATCACTTGG + Intergenic
1054629868 9:67434479-67434501 TTCAAGCCAATGACATCACTTGG - Intergenic
1055322655 9:75097612-75097634 ATAAAGCCCCAGACATATTTAGG + Intronic
1055464897 9:76555254-76555276 ATAAAGGCCACAACATCACTAGG + Intergenic
1058099413 9:100902446-100902468 ATAAAGCCCATTACCTGCCTGGG - Intergenic
1061381985 9:130264343-130264365 GTACAGCCCATGTCATGTCTGGG - Intergenic
1185699935 X:2223243-2223265 ATAAGTCCCATGACATCTGATGG + Intronic
1186401630 X:9265941-9265963 ATAAACTCGATGTCATCTCTGGG + Intergenic
1187258876 X:17667077-17667099 ATAAGTCCCTTAACATCTCTAGG - Intronic
1187283929 X:17884702-17884724 ATCCACCCCATGTCATCTCTAGG - Intergenic
1188736330 X:33720903-33720925 ATAAAGCCCATCACAGCACATGG - Intergenic
1189872184 X:45395525-45395547 AGAAAGCCTATGAGAACTCTGGG - Intergenic
1191188466 X:57639162-57639184 ATAAGACTCATGACATCTCATGG + Intergenic
1191710471 X:64144943-64144965 AAAAATCACATGACATCTATTGG - Intergenic
1196042883 X:111224826-111224848 AAAAAGCCAGTGACTTCTCTAGG - Intronic
1197124952 X:122933427-122933449 ACAAAACCAATGACATTTCTTGG + Intergenic
1197676507 X:129336160-129336182 ATAAACCCCATGAGATCTGATGG - Intergenic
1197835760 X:130692202-130692224 ATAAAGCCCATGACTTCAAATGG - Intronic
1200326117 X:155241576-155241598 ATAAAGACACTGACATCTGTAGG + Intergenic
1200778630 Y:7194346-7194368 GTGAAGCCCATCAGATCTCTTGG - Intergenic
1200958078 Y:8971431-8971453 ATAAATCCCAGGCCATCTTTGGG - Intergenic
1201584699 Y:15547884-15547906 ATAGAGCCCAAGACAGATCTAGG - Intergenic