ID: 1167577901

View in Genome Browser
Species Human (GRCh38)
Location 19:50326495-50326517
Sequence CCGCAGTGCCGCATTCGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 20
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 18}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167577901_1167577918 23 Left 1167577901 19:50326495-50326517 CCGGCGCGAATGCGGCACTGCGG 0: 1
1: 0
2: 1
3: 0
4: 18
Right 1167577918 19:50326541-50326563 ACGCGGCACGGTGGGGGGAGGGG 0: 1
1: 0
2: 0
3: 13
4: 208
1167577901_1167577911 14 Left 1167577901 19:50326495-50326517 CCGGCGCGAATGCGGCACTGCGG 0: 1
1: 0
2: 1
3: 0
4: 18
Right 1167577911 19:50326532-50326554 CGGCTCAGGACGCGGCACGGTGG 0: 1
1: 0
2: 0
3: 2
4: 61
1167577901_1167577915 18 Left 1167577901 19:50326495-50326517 CCGGCGCGAATGCGGCACTGCGG 0: 1
1: 0
2: 1
3: 0
4: 18
Right 1167577915 19:50326536-50326558 TCAGGACGCGGCACGGTGGGGGG 0: 1
1: 0
2: 0
3: 3
4: 118
1167577901_1167577908 11 Left 1167577901 19:50326495-50326517 CCGGCGCGAATGCGGCACTGCGG 0: 1
1: 0
2: 1
3: 0
4: 18
Right 1167577908 19:50326529-50326551 TCCCGGCTCAGGACGCGGCACGG 0: 1
1: 0
2: 0
3: 4
4: 83
1167577901_1167577914 17 Left 1167577901 19:50326495-50326517 CCGGCGCGAATGCGGCACTGCGG 0: 1
1: 0
2: 1
3: 0
4: 18
Right 1167577914 19:50326535-50326557 CTCAGGACGCGGCACGGTGGGGG 0: 1
1: 0
2: 1
3: 5
4: 85
1167577901_1167577917 22 Left 1167577901 19:50326495-50326517 CCGGCGCGAATGCGGCACTGCGG 0: 1
1: 0
2: 1
3: 0
4: 18
Right 1167577917 19:50326540-50326562 GACGCGGCACGGTGGGGGGAGGG 0: 1
1: 0
2: 0
3: 17
4: 209
1167577901_1167577919 24 Left 1167577901 19:50326495-50326517 CCGGCGCGAATGCGGCACTGCGG 0: 1
1: 0
2: 1
3: 0
4: 18
Right 1167577919 19:50326542-50326564 CGCGGCACGGTGGGGGGAGGGGG 0: 1
1: 0
2: 3
3: 39
4: 497
1167577901_1167577912 15 Left 1167577901 19:50326495-50326517 CCGGCGCGAATGCGGCACTGCGG 0: 1
1: 0
2: 1
3: 0
4: 18
Right 1167577912 19:50326533-50326555 GGCTCAGGACGCGGCACGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 76
1167577901_1167577903 -6 Left 1167577901 19:50326495-50326517 CCGGCGCGAATGCGGCACTGCGG 0: 1
1: 0
2: 1
3: 0
4: 18
Right 1167577903 19:50326512-50326534 CTGCGGCTCCGCGTCCTTCCCGG 0: 1
1: 3
2: 1
3: 15
4: 164
1167577901_1167577906 6 Left 1167577901 19:50326495-50326517 CCGGCGCGAATGCGGCACTGCGG 0: 1
1: 0
2: 1
3: 0
4: 18
Right 1167577906 19:50326524-50326546 GTCCTTCCCGGCTCAGGACGCGG 0: 1
1: 0
2: 1
3: 7
4: 79
1167577901_1167577904 0 Left 1167577901 19:50326495-50326517 CCGGCGCGAATGCGGCACTGCGG 0: 1
1: 0
2: 1
3: 0
4: 18
Right 1167577904 19:50326518-50326540 CTCCGCGTCCTTCCCGGCTCAGG 0: 1
1: 0
2: 0
3: 18
4: 149
1167577901_1167577913 16 Left 1167577901 19:50326495-50326517 CCGGCGCGAATGCGGCACTGCGG 0: 1
1: 0
2: 1
3: 0
4: 18
Right 1167577913 19:50326534-50326556 GCTCAGGACGCGGCACGGTGGGG 0: 1
1: 0
2: 1
3: 12
4: 87
1167577901_1167577916 21 Left 1167577901 19:50326495-50326517 CCGGCGCGAATGCGGCACTGCGG 0: 1
1: 0
2: 1
3: 0
4: 18
Right 1167577916 19:50326539-50326561 GGACGCGGCACGGTGGGGGGAGG 0: 1
1: 0
2: 0
3: 22
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167577901 Original CRISPR CCGCAGTGCCGCATTCGCGC CGG (reversed) Intronic
917962346 1:180154981-180155003 CCGCGGGGCCGCGTTAGCGCCGG - Exonic
919754523 1:201058574-201058596 CCGCAGCTCCGCATTAGCTCGGG - Intronic
1084427394 11:69092509-69092531 TCGCAGTTCCGCATTTGTGCAGG - Intergenic
1093039922 12:14365934-14365956 CCGCAGCTCCGCAACCGCGCAGG - Intronic
1097186038 12:57196976-57196998 CTGCAGTGCCGCTGTCGCCCTGG + Exonic
1107740126 13:43441655-43441677 CCGCAGTGCCGCCTTCGGGCAGG - Intronic
1125140369 15:36399311-36399333 GAGCAGTGCTACATTCGCGCAGG + Intergenic
1132599120 16:766137-766159 CAGCAGGGCCGCATCCACGCAGG - Exonic
1139952789 16:70680172-70680194 CCGCCGAGCCGCAGTCCCGCCGG + Intronic
1141578591 16:84981825-84981847 CCGCAGTGGCGGATGCGCTCGGG + Intronic
1143583918 17:7842119-7842141 GCGCAGCGCCGCAGCCGCGCGGG - Intronic
1147168674 17:38605966-38605988 CCGCAGTGACACACCCGCGCCGG - Intergenic
1148744402 17:49910366-49910388 CCGCGGTGCCGCGTTTGAGCCGG + Intergenic
1163697501 19:18771454-18771476 CAGCAGTACCGCACTAGCGCCGG + Exonic
1165058559 19:33194237-33194259 CCGCCGAGCCGCAGTGGCGCTGG - Intronic
1167577901 19:50326495-50326517 CCGCAGTGCCGCATTCGCGCCGG - Intronic
1183720329 22:39558404-39558426 CCGCAGAGCCGCAGCCGCGGAGG - Intergenic
985999382 5:3618337-3618359 CCTCAGTGCCGCTTTTGAGCTGG - Intergenic
1028477572 7:91267328-91267350 CCGCAGTGCTGAACTCGCCCCGG - Exonic
1028755164 7:94425879-94425901 CCTCAGTGCAGCATTCTCGTGGG + Intronic