ID: 1167579069

View in Genome Browser
Species Human (GRCh38)
Location 19:50331484-50331506
Sequence AAGGGGAAGAAGAAGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4529
Summary {0: 1, 1: 7, 2: 104, 3: 809, 4: 3608}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167579069_1167579075 -9 Left 1167579069 19:50331484-50331506 CCCTCCCCCTTCTTCTTCCCCTT 0: 1
1: 7
2: 104
3: 809
4: 3608
Right 1167579075 19:50331498-50331520 CTTCCCCTTCTCCCCATCTCTGG 0: 4
1: 1
2: 10
3: 86
4: 689

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167579069 Original CRISPR AAGGGGAAGAAGAAGGGGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr