ID: 1167579069 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:50331484-50331506 |
| Sequence | AAGGGGAAGAAGAAGGGGGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 4529 | |||
| Summary | {0: 1, 1: 7, 2: 104, 3: 809, 4: 3608} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1167579069_1167579075 | -9 | Left | 1167579069 | 19:50331484-50331506 | CCCTCCCCCTTCTTCTTCCCCTT | 0: 1 1: 7 2: 104 3: 809 4: 3608 |
||
| Right | 1167579075 | 19:50331498-50331520 | CTTCCCCTTCTCCCCATCTCTGG | 0: 4 1: 1 2: 10 3: 86 4: 689 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1167579069 | Original CRISPR | AAGGGGAAGAAGAAGGGGGA GGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||