ID: 1167579519

View in Genome Browser
Species Human (GRCh38)
Location 19:50333319-50333341
Sequence AGCACCGCTCCCCCAACCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 528
Summary {0: 1, 1: 1, 2: 5, 3: 65, 4: 456}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167579517_1167579519 -10 Left 1167579517 19:50333306-50333328 CCGGAGGAGGGGCAGCACCGCTC 0: 1
1: 0
2: 0
3: 25
4: 153
Right 1167579519 19:50333319-50333341 AGCACCGCTCCCCCAACCCAGGG 0: 1
1: 1
2: 5
3: 65
4: 456
1167579516_1167579519 -7 Left 1167579516 19:50333303-50333325 CCGCCGGAGGAGGGGCAGCACCG 0: 1
1: 0
2: 0
3: 24
4: 160
Right 1167579519 19:50333319-50333341 AGCACCGCTCCCCCAACCCAGGG 0: 1
1: 1
2: 5
3: 65
4: 456

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167579519 Original CRISPR AGCACCGCTCCCCCAACCCA GGG Intronic
900083021 1:873427-873449 AGACCCAGTCCCCCAACCCAGGG - Intergenic
900558229 1:3290664-3290686 AGCACTGTCCCCACAACCCAGGG + Intronic
900625850 1:3608195-3608217 AGCTGGGCTCCCCCAACCCCAGG - Intronic
900773856 1:4566900-4566922 AGCCCCCCTCCCCCACCCCAAGG - Intergenic
904261148 1:29288565-29288587 AGCACATCTCCTCCATCCCAGGG - Intronic
905009776 1:34739470-34739492 AACACCCCTCCCCCAACCCCCGG + Intronic
906060939 1:42948201-42948223 AGGACCTCTCCCCCAACGCTCGG + Intronic
906877851 1:49557821-49557843 ATCACCCCTCCCCTAACCCAAGG + Intronic
906915427 1:50004456-50004478 TGCATCCCTCCCCCAACCCCAGG + Intronic
908363227 1:63390458-63390480 ATCACCCCTCCCTCAACCCCAGG - Intronic
908918209 1:69157735-69157757 AGGATCCCTCCCCCAACCCAAGG + Intergenic
910229806 1:84974329-84974351 ATCACCTCTCCCCTAACCCCAGG + Intronic
910349377 1:86277960-86277982 GCCACCCCTCCCCCAACCCCAGG - Intergenic
910560202 1:88581972-88581994 ACCACCCCTCCCACAACCCAAGG + Intergenic
910840210 1:91554215-91554237 AGGACTGCTCCACAAACCCAGGG + Intergenic
911019699 1:93374420-93374442 ACCACCCCTCCCCTAACCCAAGG - Intergenic
911019775 1:93374967-93374989 ACCATCCCTCCCCCAACCCAAGG + Intergenic
912834739 1:112986216-112986238 AGCTCTACTCCCCCAACCCCTGG - Intergenic
912873193 1:113328533-113328555 ACCACCTCTCCCACAACCCCAGG - Intergenic
913706836 1:121434059-121434081 ATCACCCCTCCCCTAACCCTAGG + Intergenic
915343454 1:155188581-155188603 TCCACCGCCCCCCCAGCCCATGG - Intronic
915343480 1:155188641-155188663 TCCACCGCCCCCCCAGCCCACGG - Intronic
915343514 1:155188719-155188741 TCCACCGCACCCCCAGCCCACGG - Intronic
915343540 1:155188779-155188801 TCCACCGCCCCCCCAGCCCACGG - Intronic
915343566 1:155188839-155188861 TCCACCGCCCCCCCAGCCCACGG - Intronic
915343615 1:155188959-155188981 TCCACCGCCCCCCCAGCCCACGG - Intronic
915343640 1:155189020-155189042 TCCACCGCCCCCCCAGCCCACGG - Intronic
915343714 1:155189264-155189286 TCCACCGCCCCCCCAGCCCACGG - Intronic
915343740 1:155189324-155189346 TCCACCGCCCCCCCAGCCCACGG - Intronic
915343766 1:155189384-155189406 TCCACCGCCCCCCCAGCCCACGG - Intronic
915343792 1:155189444-155189466 TCCACCGCCCCCCCAGCCCACGG - Intronic
915343818 1:155189504-155189526 TCCACCGCCCCCCCAGCCCACGG - Intronic
915343862 1:155189624-155189646 TCCACCGCCCCCCCAGCCCACGG - Intronic
915343888 1:155189684-155189706 TCCACCGCCCCCCCAGCCCACGG - Intronic
915343914 1:155189744-155189766 TCCACCGCCCCCCCAGCCCACGG - Intronic
915343985 1:155189924-155189946 TCCACCGCCCCCCCAGCCCACGG - Intronic
915344010 1:155189984-155190006 TCCACCGCCCCCCCAACCCACGG - Intronic
915344036 1:155190044-155190066 TCCACCGCCCCCCCAGCCCACGG - Intronic
915344102 1:155190224-155190246 TCCACCGCGCCCCCAGCCCACGG - Intronic
915344193 1:155190461-155190483 TCCACCGCCCCCCCAGCCCACGG - Intronic
915344219 1:155190522-155190544 TCCACCGCCCCCCCAGCCCACGG - Intronic
915344292 1:155190702-155190724 TCCACCGCCCCCCCAGCCCACGG - Intronic
915344318 1:155190762-155190784 TCCACCGCCCCCCCAGCCCACGG - Intronic
915344409 1:155190971-155190993 TCCACCGCCCCCCCAGCCCACGG - Intronic
915344482 1:155191151-155191173 TCCACCGCCCCCCCAGCCCACGG - Intronic
915344508 1:155191211-155191233 TCCACCGCCCCCCCAGCCCACGG - Intronic
915344616 1:155191512-155191534 TCCACCGCCCCCCCAGCCCACGG - Intronic
915344640 1:155191572-155191594 TCCACCGCCCCCCCAGCCCACGG - Intronic
915344710 1:155191752-155191774 TCCACCGCCCCCCCAGCCCACGG - Intronic
915344736 1:155191812-155191834 TCCACCGCCCCCCCAGCCCACGG - Intronic
915344787 1:155191932-155191954 TCCACCGCCCCCCCAGCCCACGG - Intronic
915856757 1:159396936-159396958 ATCATCCCTCCCCTAACCCAAGG + Intergenic
917068910 1:171128044-171128066 ATCACCTCTCCCCCAAGCCTAGG + Intergenic
917191231 1:172421784-172421806 ACCACCCCTCCCCCATCCCCTGG + Intronic
917191298 1:172422172-172422194 AGCACCCCTCCCCCAACCCCAGG + Intronic
917840692 1:178975145-178975167 ACCACCCCTACCCCAACCCCAGG + Intergenic
918892651 1:190295391-190295413 ATCACTCCTCCCCCAACCCCAGG - Intronic
919008394 1:191928881-191928903 ATCACCGCTCCCCTAACCACAGG + Intergenic
919514980 1:198511371-198511393 ATCACTCCTCCCCCAACCCCAGG - Intergenic
920120171 1:203650388-203650410 AGCACCTCTCTCCCTCCCCAGGG - Intronic
920504449 1:206506761-206506783 AGAAAAGCTCCCCCAACCCTTGG + Intergenic
920953718 1:210598288-210598310 ATCACCCGTCCCCCAACCCCAGG - Intronic
921159833 1:212464994-212465016 AACACAGCTCCCCCAAGACAGGG + Intergenic
922388619 1:225114445-225114467 ATCACCTCTCCCCCAACCCCAGG - Intronic
922685255 1:227633911-227633933 ATCACCCCTCCCCTAACCCCAGG + Intronic
923656413 1:235920884-235920906 AGCACAGATCCCCCTCCCCAGGG - Intergenic
924365824 1:243292250-243292272 AGCCCCACTCCCCCACCTCAAGG - Intronic
1063367962 10:5502738-5502760 AGCTGAGCTCCCCCGACCCAGGG + Intergenic
1065228406 10:23571201-23571223 ATCACCCCTCCCCCAACTCCAGG + Intergenic
1065426958 10:25615860-25615882 ACCACCCCTCCCCCAACCCCAGG - Intergenic
1066519045 10:36195478-36195500 AGCCCCCCTCCCCAAACCAAAGG - Intergenic
1068104092 10:52592027-52592049 ACCTCCCCTCCCCCAACCCCAGG - Intergenic
1068334829 10:55621399-55621421 AGCAGGGGTCCCCCACCCCAGGG + Intronic
1068713014 10:60155207-60155229 ACCACCCCTCCCCCAGCCCCAGG + Intronic
1069805890 10:71124834-71124856 AGCACCTCAGCCCCAACCCAGGG - Intergenic
1069824153 10:71245113-71245135 ACCTCCTCTCCCCCAACCCTGGG + Intronic
1069933665 10:71900514-71900536 ATCACCCCTCCCCTAACCCCAGG - Intergenic
1070781075 10:79137818-79137840 AGCACCCCCCCCCCAGCCGAGGG - Intronic
1070789055 10:79178891-79178913 AGCCCTGCTCTCCCAAGCCAGGG + Intronic
1072344443 10:94489377-94489399 ACCACCCCTCCCCCAACCCCTGG - Intronic
1072533645 10:96343020-96343042 AGCTCTGCTTCCCTAACCCAGGG - Intergenic
1072845469 10:98825602-98825624 ACCCCCGCCCCCCCAACCCCGGG - Intronic
1076008715 10:126969264-126969286 AGCACCCCTCCCCGAGCCCCTGG - Intronic
1076376758 10:129993504-129993526 GCCACCCCTCCCCCAACCCCAGG + Intergenic
1077423093 11:2462108-2462130 AGCAACGCCCCCTCAGCCCAGGG - Intronic
1077858801 11:6157154-6157176 ACCACCCCTCCCCCAACCCCAGG + Intergenic
1079425946 11:20342578-20342600 AGCACCCATCCCCCAGCCAAGGG + Intergenic
1079473955 11:20808470-20808492 ACCAGCCCTCCCCCAACCCCAGG - Intronic
1080128512 11:28766253-28766275 GGCACCTCTCTCCCAACCCCAGG + Intergenic
1080351050 11:31386286-31386308 ATCAACCCTCCCCCAACCCTAGG + Intronic
1082760378 11:57121517-57121539 AGCTCCTCTCCCCTCACCCAAGG - Intergenic
1082970156 11:59012135-59012157 ATCACCCCTCCCCCAACTCCAGG + Intronic
1083304296 11:61754639-61754661 AGCCCCCACCCCCCAACCCATGG - Intronic
1083356121 11:62067537-62067559 AGCAATGCTCCCACAAGCCAAGG - Intergenic
1083744149 11:64725989-64726011 TGCCCCGGTCCCCCACCCCAGGG - Intergenic
1084273298 11:68040060-68040082 AGCACCGTACCCCCTCCCCAAGG + Intronic
1084753834 11:71222192-71222214 AGCACAGCTCCCCTGTCCCAAGG + Intronic
1085289103 11:75384622-75384644 AGCGCGGCTCCTGCAACCCACGG + Intergenic
1085778837 11:79390278-79390300 AGTACCCCTCCCCCAAGACAAGG - Intronic
1087178705 11:95120623-95120645 ATCACCCCTCCCCTAACCCCAGG - Intronic
1087417205 11:97872023-97872045 GCCACCCCTCCCCCAACCCCAGG - Intergenic
1087874436 11:103339200-103339222 ATCACCCCTCCCCCAACTCAAGG - Intronic
1088154920 11:106790941-106790963 AGCACCCCTCCCTCAACCCCAGG - Intronic
1088210709 11:107453356-107453378 ACCACCTCTCCCCCAACCCAAGG + Intronic
1088697699 11:112382636-112382658 TGCCGCCCTCCCCCAACCCAGGG - Intergenic
1088938289 11:114426410-114426432 ACCACCCCTCCCCCAGCCCCAGG - Intronic
1090317280 11:125803904-125803926 ATCACCCCTCCCCCAAGCCCAGG - Intergenic
1091066821 11:132521941-132521963 AGTACAGCTCCATCAACCCAAGG + Intronic
1092403443 12:8197486-8197508 ATTACCACTCCCCCAACCCCAGG - Intergenic
1093124632 12:15313597-15313619 ATCACCCCTCCCCTAACCCATGG - Intronic
1093259567 12:16918342-16918364 GTCACCCCTCCCCCAACCCCAGG - Intergenic
1093324923 12:17761298-17761320 GCCACCTCTCCCCCATCCCAAGG - Intergenic
1093687746 12:22076409-22076431 ATCCCCGCTCCCCTAACCCCAGG + Intronic
1095181779 12:39154475-39154497 ATCACCCCTTCCCCAACCCCAGG - Intergenic
1095181839 12:39154869-39154891 ACCACCCCTCCCTCATCCCATGG - Intergenic
1095860195 12:46908125-46908147 ATCATTGCTCCCCCAACCCCAGG + Intergenic
1096242539 12:49967105-49967127 AGCCCGGCTCCCCCAGCCCGGGG - Intergenic
1096524845 12:52204282-52204304 ACCGCGGCTCCCCCAACCCCCGG - Intergenic
1096800901 12:54109865-54109887 AGCCCAGCTTCCCCCACCCAGGG + Intergenic
1097147075 12:56949081-56949103 ATCACCCCTCCCCTAACCCCAGG - Intergenic
1098898949 12:76093037-76093059 TGCACCTCTCCTCCAACCCCTGG - Intergenic
1098946174 12:76592177-76592199 AGGGCCCCTCCCACAACCCATGG - Intergenic
1099474937 12:83096693-83096715 AGGACCCCTCCCACAACACAAGG + Intronic
1099610154 12:84857682-84857704 GCCACCACTCCCCCAACCCCAGG - Intergenic
1099807877 12:87543145-87543167 GTCACCGCTCCCCCAACCCCGGG + Intergenic
1100209756 12:92388748-92388770 ACCACCGCCCCCCCCACCCCTGG + Intergenic
1100362991 12:93895013-93895035 AGAACCGCTCCCCTTTCCCAAGG - Intergenic
1101026260 12:100609494-100609516 ACCACCCCTCCCCCATCCCCTGG - Intronic
1101607416 12:106258224-106258246 ATCACCCCTCCCCAAACCCCAGG + Intronic
1102301392 12:111774157-111774179 TGCCCCACTCCCCCACCCCAGGG - Intronic
1102640932 12:114366091-114366113 ACCCCCTCACCCCCAACCCAAGG + Intronic
1103364138 12:120369722-120369744 AGCCCCCCACCCCCACCCCAGGG + Intergenic
1104945726 12:132414187-132414209 AGAACCGCGACCCCAGCCCACGG + Intergenic
1106410068 13:29505516-29505538 ATCACCGCTCCCGAAACACATGG + Exonic
1107178045 13:37422775-37422797 ATCACCTCTCCCCAAACCCCAGG + Intergenic
1107524272 13:41214378-41214400 GCCACCCCTCCCCCAACCCCAGG - Intergenic
1109022801 13:57119500-57119522 ATCACCTCTCCCCTAACCCCAGG - Intergenic
1109567010 13:64131181-64131203 ACCACCCCTCCCCCAAACCCAGG + Intergenic
1110448836 13:75618308-75618330 AGCACCCCTCCTCCAAGCCCAGG - Intergenic
1110916810 13:81030984-81031006 ACCACCCCTTCCTCAACCCAAGG - Intergenic
1111639237 13:90946973-90946995 GCCACCACTCCCCCAACCCCAGG + Intergenic
1112901625 13:104363914-104363936 ACCACCCTTCCCCCAACCCCTGG - Intergenic
1113808819 13:113124921-113124943 AGCAATGCTCCCACAAGCCATGG - Intronic
1114248003 14:20933014-20933036 ACAACCGCTCCCCCAACCCCAGG + Intergenic
1114250838 14:20959113-20959135 ACAACTGCTCCCCCAACCCCAGG + Intergenic
1114898509 14:27025891-27025913 GTCACCCCTCCCCCAACCCAAGG - Intergenic
1115282457 14:31678744-31678766 ACCAACACTCCCCCAACCCCAGG - Intronic
1116176159 14:41473120-41473142 ATCACCCCTCCCCTAACCCCAGG - Intergenic
1116275671 14:42828082-42828104 ATCACTCCTCCCCCAACCCCAGG - Intergenic
1116422077 14:44744677-44744699 ATCACCCCTCCCCTAACCCCAGG + Intergenic
1117161510 14:52994648-52994670 ATCACCCCTCCCCCAACCCCAGG - Intergenic
1117870704 14:60197800-60197822 ACCACCCTTCCCCCAACCCCAGG + Intergenic
1118096783 14:62546312-62546334 ACCACCCCTCCCCCAACCCCTGG + Intergenic
1118539120 14:66802909-66802931 ATCACCCCTCCCCTAACCCCAGG - Intronic
1119764845 14:77181860-77181882 AGCACCGCGGCCCCAGCCCCAGG - Exonic
1121066798 14:90974804-90974826 AGAACTGCTCAGCCAACCCATGG + Intronic
1121832406 14:97063526-97063548 AGCACCGAGCCCCCATCCCCAGG - Intergenic
1121850131 14:97214101-97214123 ATCACCGCTCCCAGAACTCACGG + Intergenic
1122126521 14:99581458-99581480 GGCCTCGCTCCCCCCACCCATGG + Intronic
1122146486 14:99691904-99691926 GGCTTCACTCCCCCAACCCAAGG - Intronic
1122154703 14:99743095-99743117 CACACCGCACTCCCAACCCATGG + Intronic
1122155260 14:99746827-99746849 AGCAGGGCTCCTCCCACCCAGGG + Intronic
1122701771 14:103594405-103594427 AGCACTGCTGCCCCAAGGCAAGG - Intronic
1125993375 15:44132322-44132344 ATCAGAGGTCCCCCAACCCACGG - Intronic
1126053399 15:44707686-44707708 ACCACCCCTCTCCCAACCCCAGG - Intronic
1126227029 15:46282717-46282739 AGAACCTCTCCACCACCCCAAGG - Intergenic
1126830341 15:52596562-52596584 AGAACCACTGGCCCAACCCAAGG - Intronic
1127173418 15:56328027-56328049 GCCACCCCTCCCCCAACCCCAGG + Intronic
1127188658 15:56506802-56506824 AGCATCCCTCCCACAACACATGG + Intergenic
1128109391 15:65067282-65067304 GGCACTGATCCCCCTACCCAAGG - Intronic
1129030693 15:72615659-72615681 ACCACCCCTCCCCCAACCCCAGG - Intergenic
1129477534 15:75796182-75796204 ACCACCGCTCCCCCAACCCCAGG - Intergenic
1129835600 15:78703459-78703481 ACCACCCCTCCCGCAACCCCAGG - Intronic
1130511734 15:84595175-84595197 ACCACCCCTCCCCCAACCCCAGG + Intergenic
1132344939 15:101102467-101102489 ATCACCCCTTCCCCAACCCTGGG + Intergenic
1133335691 16:5005385-5005407 ATCTCCCCTCCCCCAACCCAGGG - Intronic
1134106271 16:11487614-11487636 AGCACCCGACCCCCAACCCCAGG + Intronic
1134802481 16:17098378-17098400 AGAACCCCTCCCCCAACTTAAGG - Intergenic
1135680630 16:24453833-24453855 CCCACCCCTACCCCAACCCAAGG + Intergenic
1135879482 16:26240356-26240378 ATCACCCCTCCCCTAACCCCAGG + Intergenic
1137437162 16:48465274-48465296 AGCACCTCTCCCCCCTCCAAAGG - Intergenic
1137859847 16:51835483-51835505 AGCACCGCTTGCTCCACCCATGG - Intergenic
1138265215 16:55655757-55655779 AGCACCGCTCGCCGCTCCCAAGG - Intronic
1138568620 16:57852468-57852490 AGCACCGCACCCGAAACCCAGGG - Intronic
1141224308 16:82100745-82100767 AGAACCACTCCTCCAAGCCATGG + Intergenic
1141423167 16:83930333-83930355 AGCACTGCTTCCCCACCCCCAGG - Intronic
1142035957 16:87862212-87862234 AGCACCACCCCCCCAACCGCTGG - Intronic
1142852334 17:2710356-2710378 AGCACCTGTCCCTCACCCCAAGG + Intronic
1143482923 17:7237903-7237925 CGCCCCGCCCCCCCAACTCACGG + Intronic
1145240969 17:21240926-21240948 AGCACCGCTAACCCACGCCAAGG - Exonic
1147888589 17:43701278-43701300 AGCACCCCCTCCCCCACCCAAGG + Intergenic
1148218158 17:45845145-45845167 AGCTCCGCTCCCCCAGCCAGCGG + Exonic
1148323748 17:46771821-46771843 AGCACCGCCCCCCCACCGCGCGG - Intronic
1148454687 17:47804776-47804798 GGCACCGCTCCCTGAACCCCTGG + Intergenic
1148861765 17:50608215-50608237 GGGACAGCTCCCCCTACCCATGG - Intronic
1149528895 17:57379328-57379350 ACCACATCTCCCCCAGCCCAGGG - Intronic
1150353664 17:64465260-64465282 GACACCGCTCCTCCAAGCCAGGG - Intronic
1151704136 17:75757860-75757882 AGAACCGCTCCCCTACCCTAGGG - Intronic
1152389858 17:79997117-79997139 AGAACCACTCCCCCACCGCAGGG - Intronic
1152594653 17:81232350-81232372 AGCCACGGTCCCCCAACCCTGGG - Intronic
1152701789 17:81823148-81823170 AGCAAGGCACCCCCATCCCAGGG + Intronic
1152766504 17:82143446-82143468 AGCACCCCTCCCCCTTTCCAGGG - Intronic
1153953639 18:10077296-10077318 AGCACTGCTCCCCACCCCCAGGG + Intergenic
1155282011 18:24249948-24249970 ACCATCCCTCCCCCAACCCCAGG + Intronic
1155767382 18:29652701-29652723 ACCACCTCTCCCCCAACTCCAGG + Intergenic
1156055531 18:32998518-32998540 ACCACCCTTCCCCCAACCCTAGG + Intronic
1156204760 18:34873509-34873531 AGCAAGGCTCCCGCAGCCCAGGG + Intronic
1156912448 18:42426503-42426525 ACTACCCCTCCCCCAACCCTTGG - Intergenic
1157067957 18:44373987-44374009 AGCCCCCCACCCCCAACCAAGGG - Intergenic
1157222073 18:45835745-45835767 GGCACAGCTCCCACAGCCCAGGG + Intronic
1159272209 18:66167936-66167958 ACCACCGTTCCCTCAACCCCAGG + Intergenic
1160859231 19:1230686-1230708 AGCACCCCTCCCCCAACCCAAGG - Exonic
1160957571 19:1700474-1700496 GGCACCCCCACCCCAACCCACGG - Intergenic
1161258935 19:3324917-3324939 AACACCCCTCCCCCAACTAAAGG + Intergenic
1162750319 19:12825672-12825694 AGGGTCGCTCCCCCAACTCAGGG + Exonic
1163618034 19:18341095-18341117 CACACCGCTCCCCCAACCCCTGG + Intronic
1165435680 19:35793456-35793478 AACATCTATCCCCCAACCCAGGG + Intergenic
1166314736 19:41982884-41982906 AGCCCCTGCCCCCCAACCCAAGG - Intronic
1166408409 19:42540102-42540124 ACCACCCCTCCCCCAACCTCAGG - Intronic
1167017610 19:46851105-46851127 AGGTCCCCTCCCCCCACCCAGGG + Intergenic
1167291283 19:48626350-48626372 AGCACCTCACCCCCATCCCCGGG - Exonic
1167579519 19:50333319-50333341 AGCACCGCTCCCCCAACCCAGGG + Intronic
1167583026 19:50357705-50357727 AGCACCGCTCCCCGAACCCGGGG + Intronic
1167762223 19:51457143-51457165 GGCCCTGCTCCCCCAACCCCAGG + Intronic
1167771927 19:51526054-51526076 AGCACAGCTGCCTCAACCCAGGG + Intronic
1168022916 19:53622948-53622970 AGGACAGCACCCCAAACCCATGG + Intergenic
1168433601 19:56301033-56301055 ACCACCTCTCCCCCATCCCCAGG - Intronic
925157862 2:1661099-1661121 GGCTCCCCTCCCCCAACCCTAGG - Intronic
925484777 2:4316178-4316200 ATCACCGCTCCTCCAACTCCAGG - Intergenic
925484857 2:4316592-4316614 ACCACTGCTCCCCCATCCCCTGG - Intergenic
926018430 2:9474482-9474504 AGCCCGGCTCCCGCAACCCACGG + Intronic
928767908 2:34670352-34670374 GTCACCCCTCCCCCAACCTAAGG + Intergenic
929511302 2:42568271-42568293 AGCACCTCTTCCCCCACCCAGGG - Intronic
930048479 2:47194690-47194712 AGGCCCACTCTCCCAACCCAGGG + Intergenic
930066582 2:47332457-47332479 AGGCCTGCTGCCCCAACCCATGG + Intergenic
931406973 2:61988617-61988639 ATCACCCCTCCACCAACCCCAGG - Intronic
931517143 2:63056517-63056539 AGCACCGGTCCCCCCATCCAAGG - Exonic
931582950 2:63796886-63796908 ACCACCCCTCTCCCAACCCCAGG + Intronic
931897803 2:66752516-66752538 AGAACTGCTCTCCTAACCCAGGG + Intergenic
932056537 2:68448956-68448978 TGCACCGCTCCCCTGAACCAAGG + Intergenic
932123712 2:69124779-69124801 AGCACTGCTCCACCAGCCCCAGG + Intronic
932858852 2:75267343-75267365 ACCACCACTCCCCAAACCCCAGG - Intergenic
933528930 2:83480841-83480863 AACACCAATCCCCCAACACATGG - Intergenic
934948812 2:98562455-98562477 CGCACAGCTCCCACAGCCCATGG + Intronic
935174726 2:100639955-100639977 AGCACAGCAGCCCCAGCCCATGG + Intergenic
935247099 2:101228229-101228251 AGGACTGCTCCCTCACCCCAAGG + Intronic
935576643 2:104717877-104717899 ATCACCGTTCCCCTAACCCCAGG - Intergenic
935750887 2:106232898-106232920 ACCATCCCTCCCCCAACCCTAGG + Intergenic
937429944 2:121829845-121829867 AGCACCACTCACCACACCCATGG - Intergenic
939170380 2:138688820-138688842 ACCACCGCCCCCCCAACCCCCGG + Intronic
939273536 2:139970669-139970691 ACCACTTCTCCCCCAACCCTAGG + Intergenic
941413280 2:165186958-165186980 AGCACCCCTGTCCCAACCCTAGG - Intronic
941651313 2:168095217-168095239 AGCACCGCATCCCAACCCCATGG + Intronic
941672706 2:168311473-168311495 ACCACCCCTCCCCCATCCCTGGG - Intergenic
941695896 2:168550693-168550715 AGGCCCACTGCCCCAACCCATGG + Intronic
942294855 2:174507492-174507514 ATCACCACTCCCCCAGCCCCAGG + Intergenic
942734787 2:179097243-179097265 ATCACCCCTCCCCTAACCCCAGG - Intergenic
942838405 2:180329365-180329387 ATCACCTTTCCCCTAACCCAAGG + Intergenic
943099596 2:183471873-183471895 ACCACCCCTCCCCCAACCCCAGG - Intergenic
943309648 2:186310290-186310312 ATCACCCCTCCCCTAACCCTAGG + Intergenic
943513962 2:188862194-188862216 AGCCCCCACCCCCCAACCCAGGG + Intergenic
943557296 2:189421478-189421500 AGCACCCCTTCCCCAACCCCAGG + Intergenic
944078518 2:195759080-195759102 ACCACCCCTCCCCCAATCCCAGG + Intronic
944990592 2:205230589-205230611 ACCACTCCTCCCCCAACCCCAGG - Intronic
946411372 2:219516897-219516919 AGCACTGCTCCCCAAAGCAAGGG + Intronic
946984629 2:225257925-225257947 ATCACCCCTTCCCCAACCCCAGG + Intergenic
947385523 2:229586843-229586865 AGATCCGCTCCCCCAGCACAGGG + Intronic
947787720 2:232838808-232838830 TGCACCCCTCCCCCACCCCAGGG + Intronic
948475572 2:238216786-238216808 ATCACCCCTCCCCCAACCCCAGG - Intergenic
1168831349 20:846830-846852 TGCACCAGTGCCCCAACCCAAGG - Intronic
1169007520 20:2221062-2221084 AACTCCATTCCCCCAACCCAGGG - Intergenic
1170142837 20:13142336-13142358 ATCACCACTCCCCCATCTCAGGG - Intronic
1171852674 20:30319661-30319683 AGCCCAGCTTCCCCCACCCAGGG + Intergenic
1172059616 20:32177672-32177694 TTCTCCGCTCCCCCAACCCCTGG + Intergenic
1173029933 20:39347555-39347577 ATCACCACTCCCCCAAGCCAAGG + Intergenic
1173883546 20:46437348-46437370 CGCACCTCACCCCCACCCCAGGG - Intergenic
1176170481 20:63694298-63694320 AGCCCTGCCCCCCCACCCCAGGG + Intronic
1176220563 20:63967600-63967622 AGCACCGCTGTCCCAACACGAGG + Intronic
1176994946 21:15544288-15544310 ATCACCCCTCCCCCAACCTCAGG + Intergenic
1179012097 21:37563966-37563988 AGCACCGCCCCCCGAAGCCCGGG - Intergenic
1179395842 21:41039524-41039546 ATCACCACTCCCCTAACCCCAGG + Intergenic
1179910310 21:44443983-44444005 AGCGCTGCTCCTCCAACCCGGGG + Intergenic
1183296750 22:37034220-37034242 AGAACCAGCCCCCCAACCCATGG - Intergenic
1183650777 22:39152299-39152321 AGCACCGCTCCCTCCACGCTGGG - Intronic
1184300922 22:43560522-43560544 AGCATGGCTGCCCCTACCCAAGG - Intronic
1185381128 22:50507936-50507958 CGCCCCGCCCCCCCAACCCGTGG + Intergenic
950477280 3:13222140-13222162 AGCCCCCCTCCCCCAGCCCCTGG + Intergenic
950597542 3:13997528-13997550 GGAACCCCTCCCCCTACCCAAGG - Intronic
951125907 3:18983041-18983063 ATCACCCCTCCTCCAACCCCAGG - Intergenic
951259972 3:20495873-20495895 ACCATCTCTCCCCCAACCCCAGG - Intergenic
952132878 3:30384871-30384893 ATCACCCCTCCCCCAAACCTGGG - Intergenic
953196271 3:40737335-40737357 AGAACTGCTCAGCCAACCCAAGG - Intergenic
954431470 3:50473008-50473030 AGCCCAACTCCCCCAACCCGTGG - Intronic
954447723 3:50555559-50555581 TGCCCCTCTCCCCCAACCCAAGG - Intergenic
955120475 3:56053150-56053172 AGCCCTGCTCTCCCAACCTAAGG + Intronic
955326170 3:58010446-58010468 AGCAGCCCTCCCCCTCCCCAAGG + Intronic
957281930 3:78162229-78162251 ACCACTGCTCCCACAACCTAAGG + Intergenic
958631265 3:96686250-96686272 ATCACCTCTCCCCTAACCTAAGG - Intergenic
958682749 3:97352827-97352849 ATCACCCCTTCCCCATCCCAAGG + Intronic
959725101 3:109533694-109533716 ATCACCCCTCCCCTAACCCCAGG - Intergenic
961371005 3:126431450-126431472 GTCACCTCTCCCCCAAGCCATGG - Intronic
961442160 3:126959586-126959608 AGCAGTGCTGCCCCACCCCAAGG - Intronic
962151864 3:132902267-132902289 ACCACCCCTCCCCTAACCCCAGG + Intergenic
962759194 3:138493128-138493150 ACCACTCCTCCCCCAACCCCAGG - Intergenic
962767514 3:138579403-138579425 ATCACCCCTCCCCCAACCCCAGG + Intronic
963443659 3:145374252-145374274 TCCACCGCTCCCCCAACCCTGGG + Intergenic
963515230 3:146300860-146300882 ATCACCCCTCCCCTAACCCCAGG + Intergenic
964253635 3:154749791-154749813 GCCACCACTCCCCCAACCCCAGG + Intergenic
964258999 3:154812044-154812066 GTCACCACTCCCCCAACCCTAGG - Intergenic
964804023 3:160587367-160587389 ACCACTCCTCCCCCAACCCCAGG + Intergenic
965322334 3:167265539-167265561 ACCATCCCTCCCCCAACCCCAGG - Intronic
965350038 3:167600199-167600221 ACCACGACTCCCCCAACCCCAGG - Intronic
965379184 3:167967108-167967130 GTCACCCCTCCCCCAACCCCAGG + Intergenic
965742456 3:171890166-171890188 ACCACTACTCCCCCAACCCCAGG - Intronic
966454131 3:180095129-180095151 ACCACCCCTCCCCCATCCCCCGG - Intergenic
966919844 3:184604311-184604333 AGCACCCCTCCCCCGAGCCCTGG + Intronic
967336615 3:188351310-188351332 AGTCCAGCTCCCCCACCCCAGGG + Intronic
967677408 3:192316784-192316806 ATCACCCCTCCCCCAACCCCAGG + Intronic
968607634 4:1543010-1543032 ATCACAGCAGCCCCAACCCAGGG + Intergenic
969052855 4:4385613-4385635 GGCACCCCGCCCCCAACCCAGGG - Intronic
969291877 4:6245424-6245446 AGCACCGCACTCCCTGCCCAGGG - Intergenic
969725077 4:8913948-8913970 AGTCACGCTCCCCCAAGCCAAGG + Intergenic
970384354 4:15541560-15541582 AGCACCCCTCTCCCATCTCAAGG - Intronic
972253729 4:37332224-37332246 ACTACCCCTCCCCCAACCCCAGG + Intronic
974266887 4:59597641-59597663 ACCACCGCTTCCCCATCCCCTGG + Intergenic
974300974 4:60067046-60067068 GCCACCCCTCCCCCAACCCCAGG + Intergenic
974337650 4:60570521-60570543 ATCACCCCTCCCCAAACCCTAGG - Intergenic
974559210 4:63495227-63495249 GTCACCCCTCCCCCAACCCAAGG + Intergenic
976943826 4:90739421-90739443 ATCACCCCTCCCCCAACTCCAGG - Intronic
977294428 4:95194804-95194826 AACACCCCTGCCCCCACCCAAGG - Intronic
978082910 4:104616423-104616445 ACCACCCCTCCCCCAACCTCAGG - Intergenic
978319489 4:107478450-107478472 ATCACCCCTCCTCCAACCCAAGG + Intergenic
979413400 4:120406479-120406501 ATCACCCCTCCCCCAACCCCAGG + Intergenic
979427317 4:120584003-120584025 ATCACCCCTCTCCCAACCCCCGG + Intergenic
980172463 4:129306194-129306216 ACCACCCCTCCCCTAACCCCAGG - Intergenic
980960635 4:139471001-139471023 ATCACCCCTCCCCTAACCCCAGG - Intronic
982170326 4:152655617-152655639 AGCACCCCTCCCCCCACCCCTGG + Intronic
982339773 4:154284916-154284938 ACCACCCCTCCCCTAACCCCAGG + Intronic
982683445 4:158459597-158459619 ACCATCCCTCCCCCAACCCCAGG - Intronic
982798134 4:159669332-159669354 ACCACCCTTCCCCCAACCCCAGG - Intergenic
982932620 4:161428409-161428431 ACCACCCCTCCGCCAACCCCAGG + Intronic
983338124 4:166421674-166421696 ATCACCTCTCCCCAAACCCCAGG - Intergenic
983755361 4:171328590-171328612 ATCACCCCTCCCTCAACCCCAGG + Intergenic
983894991 4:173071528-173071550 ATCACTCCTCCCCCAACCCCAGG - Intergenic
986608177 5:9544498-9544520 AGATCAGCTCCCCCAACCCCCGG + Intronic
986885309 5:12226500-12226522 ACCACCACTCCTACAACCCAAGG - Intergenic
987163906 5:15174049-15174071 ACCACCCTTCCCCCAACCCAAGG + Intergenic
988384131 5:30539497-30539519 ACCACCCCTCCCCCAACCCAAGG + Intergenic
989489472 5:42033174-42033196 ATCACCCCTCCCCCAACCCCAGG - Intergenic
989970827 5:50521836-50521858 ATCACCCCTCCCCTAACCCCAGG - Intergenic
990446476 5:55898020-55898042 AGCACCGCCTCCGCAACCCAGGG - Intronic
990579111 5:57151158-57151180 GCCACCCCTCCCCCAACCCCGGG - Intergenic
990592814 5:57283225-57283247 ATCACCCCTCCCCTAACCCCAGG + Intergenic
991227865 5:64293200-64293222 AGCACACCTACCCCAAGCCAAGG - Intronic
991395369 5:66198968-66198990 ACCACCCCTCCCCCAACCCCAGG - Intergenic
992184952 5:74234872-74234894 TGTACCCCTCCCCCAACCCAGGG + Intergenic
992527569 5:77628030-77628052 ACCAGGGCTCCCCCAACCCCGGG - Intergenic
993981197 5:94545398-94545420 GCCACCCCTCCCCCAACCCCAGG + Intronic
994533630 5:100999608-100999630 ACCACCCCTCCACCAACCCGAGG + Intergenic
995290324 5:110444040-110444062 ATCACCCCTTCCCCAACCCCAGG - Intronic
995685373 5:114766493-114766515 TGCTGCCCTCCCCCAACCCAGGG + Intergenic
996058927 5:119011373-119011395 AGCCCCGCTCACCCGACGCAGGG - Intergenic
996192616 5:120564206-120564228 ACCACCCCTCCCCCAACCGAAGG - Intronic
996878159 5:128262843-128262865 AGCACCTCTGCCACAGCCCATGG + Intronic
1000517883 5:162262311-162262333 ACCACCCCTCCCTCATCCCATGG + Intergenic
1001590063 5:172858956-172858978 AGCACAGCTCCCCCAGCCACAGG - Intronic
1001845319 5:174916804-174916826 ACCACCCCTCCCCCAACCTCAGG + Intergenic
1003170232 6:3715781-3715803 AGAACCCCTACCCCCACCCAGGG - Intergenic
1005812881 6:29530063-29530085 TGCTCAGCTCCCCCAGCCCAGGG + Intergenic
1006840986 6:37027818-37027840 ACCAGCCCACCCCCAACCCATGG + Intronic
1007636877 6:43304974-43304996 GTCACCACTGCCCCAACCCAAGG - Exonic
1008214980 6:48777850-48777872 ATCACCTCTCCCCTAACCCCAGG + Intergenic
1008314650 6:50025529-50025551 ATCACCTCTCCCCTAACCCCAGG + Intergenic
1008596180 6:53044131-53044153 AGCAGGGGTCCCCAAACCCAGGG + Intronic
1008910222 6:56723900-56723922 TCCGCTGCTCCCCCAACCCAGGG + Intronic
1008940436 6:57040513-57040535 ATCACCCCTGCCCCAACCCCAGG + Intergenic
1009663689 6:66647885-66647907 ATCAACCCTCCCCCAACCCTGGG - Intergenic
1009687879 6:66986937-66986959 ATCACCCCTCCCCTAACCCCAGG - Intergenic
1009978696 6:70701092-70701114 ATCACCACTCCCCCAATCCCAGG - Intronic
1011598319 6:89037444-89037466 GCCACCCCTCCCCCAACCCCAGG + Intergenic
1012030052 6:94048380-94048402 ATCACCGCTCCCTCAACCCTGGG - Intergenic
1012189436 6:96261619-96261641 ATCACCCCTCCCCAAACCCCAGG + Intergenic
1012224423 6:96688331-96688353 ACCATCCCTCCCCCAACCCCAGG + Intergenic
1012620693 6:101340168-101340190 ATCACCACTCCCCTAACCCCAGG - Intergenic
1015446906 6:133316837-133316859 AGCACCTCTCGGCCAACACAAGG - Intronic
1016054789 6:139567169-139567191 ACCACCTCTCCCCCAACCATAGG - Intergenic
1016135148 6:140532092-140532114 ATCACCTCTCCCCTAACCCCAGG + Intergenic
1016541357 6:145169903-145169925 ACCACCCCTCCCCCACCCCCTGG + Intergenic
1017650372 6:156576109-156576131 ACCACCCCTCCACCAACCCCAGG + Intergenic
1017896825 6:158687212-158687234 AGCACAGATCCCCCAGCCCCAGG - Intronic
1018350776 6:162956641-162956663 AGCAATGCTGCCCCAAGCCAAGG - Intronic
1019044326 6:169131636-169131658 ACCACCCCTCCCCCAAACCCAGG + Intergenic
1019190735 6:170249239-170249261 AGCACTGCTGCCCCACCCCCGGG - Intergenic
1019319162 7:407699-407721 AGGACCGCTCCCCACACCCAAGG + Intergenic
1019481203 7:1267589-1267611 ACCAAAGCTCCCCCAGCCCAGGG - Intergenic
1019801497 7:3091457-3091479 AGCAGCCCTCCCACCACCCAGGG - Intergenic
1020426280 7:8069504-8069526 AGCACAGCTGCCCCACCCCCTGG - Intronic
1021374421 7:19889017-19889039 AGCACCTCTCCCCCCACCAAAGG - Intergenic
1022348167 7:29538754-29538776 ATCACCCCTCCCCTAACCCCAGG + Intergenic
1022542043 7:31146482-31146504 ACCACCCCTCCCCCAACCCCAGG - Intergenic
1023240917 7:38146550-38146572 ATCACCACTCCCCCAACCCCAGG + Intergenic
1024262818 7:47584391-47584413 AGCTTCGCTTCCCCAGCCCAGGG + Intergenic
1024369166 7:48559972-48559994 ACCACCCTTCCCTCAACCCAAGG - Intronic
1027674367 7:81141437-81141459 ATCACCCCTCCTCCAACCCCAGG + Intergenic
1027702769 7:81488447-81488469 AACACCTCTCCCTCAACCTAAGG + Intergenic
1027921394 7:84399893-84399915 ATCACCCCTCCCCCAACTCCAGG + Intronic
1028160858 7:87483469-87483491 ACCACCCTTCCCCCAACCCCAGG + Intergenic
1030323233 7:108192098-108192120 AGCACGGGTCCCCAAACCCTGGG + Intronic
1031231687 7:119114941-119114963 ATCACCCCTCCCCTAACCCCAGG - Intergenic
1032094084 7:128929012-128929034 TGCACCCCACCCCCAACCAAGGG - Intergenic
1032095810 7:128938100-128938122 GGCACCGCTCCCGCCACCCTCGG - Intronic
1032138853 7:129308048-129308070 GTCACCCCTCCCTCAACCCAAGG - Intronic
1032727034 7:134599637-134599659 GCCACCCCTCCCCCACCCCACGG - Intergenic
1033947624 7:146741121-146741143 ATCACCCCTCTCCCAACCCCAGG - Intronic
1034184328 7:149162883-149162905 CGCCCCCCTCCCCCCACCCAGGG - Intronic
1034548504 7:151805100-151805122 AGCACAGCTGCCCCAACTCAAGG - Intronic
1034581864 7:152050580-152050602 ACCACCCCTCCCTCAACCCCAGG - Intronic
1035139026 7:156738514-156738536 ACCACCTCTCCACCAACCCCAGG + Intronic
1036272717 8:7322107-7322129 ATTACCACTCCCCCAACCCCAGG + Intergenic
1036348631 8:7988241-7988263 ATTACCACTCCCCCAACCCCAGG - Intergenic
1036814880 8:11894679-11894701 AGCACCCCTCCCACAATCCCAGG - Intergenic
1036843901 8:12148710-12148732 ATTACCACTCCCCCAACCCCAGG - Intergenic
1036865271 8:12391030-12391052 ATTACCACTCCCCCAACCCCAGG - Intergenic
1037354213 8:17999616-17999638 GCCACCCCTCCCCCAACCCCAGG - Intronic
1042593366 8:70420406-70420428 AACACCAGTCCCCCAACCCCAGG + Intergenic
1043307734 8:78817994-78818016 ATCACCCCTCCCCCAAACCCAGG - Intergenic
1043366784 8:79542563-79542585 ATCACCCCTCCCTCAACCCCAGG + Intergenic
1043763093 8:84094597-84094619 ATCACCCCTCCCCCAACTCCAGG - Intergenic
1045174454 8:99706807-99706829 AGCACTGTAGCCCCAACCCAAGG + Intronic
1045599039 8:103692831-103692853 ATCACCCCTCCCCCAACCCCAGG - Intronic
1045904285 8:107324433-107324455 AGCACTGCTGCCTCAAGCCAAGG + Intronic
1047138436 8:122107533-122107555 ATCACCCCTCCCCCAACCCCAGG - Intergenic
1047900970 8:129422339-129422361 ACCACCGCTCCCTCATCCCCAGG + Intergenic
1049349067 8:142154425-142154447 TGCGCAGCTCCCCCAGCCCATGG + Intergenic
1049831035 8:144700743-144700765 CACACCCCTCACCCAACCCAGGG - Intergenic
1049940164 9:537739-537761 AGCACCCCTCCCCAAAATCATGG - Intronic
1050238886 9:3613286-3613308 ATCACCCCTTCCCCAACCCCAGG - Intergenic
1050355688 9:4780920-4780942 GCCACCCCTCCCCCAACCCCAGG + Intergenic
1051314159 9:15810489-15810511 AGCCCCACCCCCCCACCCCATGG - Intronic
1051921708 9:22274701-22274723 ATCACCGTTCCCCTAACCCCAGG + Intergenic
1052573822 9:30265187-30265209 GCCACCTCTCCCCCAACCCCAGG - Intergenic
1053142462 9:35690190-35690212 AGCACGGAGCCCCCAGCCCAAGG - Exonic
1053790465 9:41682945-41682967 AGCCCAGCTTCCCCCACCCAGGG + Intergenic
1054154690 9:61631860-61631882 AGCCCAGCTTCCCCCACCCAGGG - Intergenic
1054178810 9:61894644-61894666 AGCCCAGCTTCCCCCACCCAGGG + Intergenic
1054474466 9:65562936-65562958 AGCCCAGCTTCCCCCACCCAGGG - Intergenic
1054658727 9:67686187-67686209 AGCCCAGCTTCCCCCACCCAGGG - Intergenic
1054906770 9:70419705-70419727 AGCACCGCACCCCAACTCCATGG + Intergenic
1055227246 9:74014499-74014521 GCCACCTCTCCCCCATCCCATGG + Intergenic
1055778568 9:79794041-79794063 AGCACTCCACCTCCAACCCAAGG - Intergenic
1056893761 9:90521594-90521616 ATCACCGATCCTCCAACACAAGG + Intergenic
1057168840 9:92948789-92948811 ACCACCCCTGCCCCAACACAAGG - Intronic
1057586376 9:96332305-96332327 AGCACCAGTCCCCAAAGCCAAGG + Intronic
1058013605 9:100004648-100004670 ACCACCCCTCCCCCAACCCCAGG - Intronic
1058767741 9:108198427-108198449 ATCACCCCTCCCCTAACCCCAGG + Intergenic
1059405997 9:114098605-114098627 CCCACCCCACCCCCAACCCAGGG - Intronic
1061328062 9:129875948-129875970 AGCAGCGCGCCCACAGCCCAAGG - Intronic
1062180836 9:135190109-135190131 ACGACCGCCCCCCAAACCCAGGG - Intergenic
1062452845 9:136622776-136622798 GGCACCGCTCTCCCTAGCCACGG + Intergenic
1062636218 9:137492937-137492959 AGCCCCGCCCACCCAGCCCATGG - Intronic
1185783924 X:2873734-2873756 AGCACCCCGCCCCCAGCCCCTGG + Intronic
1187594558 X:20756616-20756638 AGTACCCCTCCCCCAACCCCAGG - Intergenic
1187844857 X:23524734-23524756 ATCACCCCTCCCCTAACCCGAGG + Intergenic
1188078592 X:25808224-25808246 ACCACCCCTACCCCAACCCCAGG - Intergenic
1188668248 X:32851684-32851706 ACCACCCCTCCCCCATCCCCTGG + Intronic
1188815367 X:34705968-34705990 ATCACCCCTCCCCTAACCCCAGG - Intergenic
1190105291 X:47556344-47556366 AGCTCCTCTCTGCCAACCCAGGG - Intergenic
1190344062 X:49321812-49321834 TGAACCCCACCCCCAACCCAGGG - Intergenic
1190345156 X:49331357-49331379 TGAACCCCACCCCCAACCCAGGG - Intergenic
1190346250 X:49340923-49340945 TGAACCCCACCCCCAACCCAGGG - Intergenic
1190347502 X:49531952-49531974 TGAACCCCACCCCCAACCCAGGG - Intergenic
1190348603 X:49541508-49541530 TGAACCCCACCCCCAACCCAGGG - Intergenic
1190349704 X:49551064-49551086 TGAACCCCACCCCCAACCCAGGG - Intergenic
1190350808 X:49560617-49560639 TGAACCCCACCCCCAACCCAGGG - Intronic
1190351909 X:49570175-49570197 TGAACCCCACCCCCAACCCAGGG - Intergenic
1190353010 X:49579724-49579746 TGAACCCCACCCCCAACCCAGGG - Intergenic
1190354111 X:49589271-49589293 TGAACCCCACCCCCAACCCAGGG - Intergenic
1190355213 X:49598795-49598817 TGAACCCCACCCCCAACCCAGGG - Intronic
1190538036 X:51448364-51448386 ATCACCCCTCCCCCAACCCTAGG - Intergenic
1190717467 X:53115738-53115760 GCCACCCCTCCCCCAACCCCAGG - Intergenic
1190735156 X:53250954-53250976 AGCACAGAACCCCCACCCCAGGG - Exonic
1191059403 X:56278610-56278632 ACCACCCCTTCCCCAACCCTAGG - Intronic
1191694550 X:63976944-63976966 ATCACCCCTCCCTCAACCCCAGG + Intergenic
1192382664 X:70635210-70635232 GTCACCCCTCCCCCAACCCCAGG + Intronic
1192958862 X:76104623-76104645 ATCACCCCTCCCCTAACCCCAGG - Intergenic
1193016335 X:76738252-76738274 ATCACCCCTCCCCCAACCACAGG + Intergenic
1193063523 X:77232945-77232967 ATCACCCCTCCCCTAACCCCAGG + Intergenic
1193088466 X:77468591-77468613 AGCACCTCTGGACCAACCCAGGG + Intergenic
1193147562 X:78093037-78093059 ATCACCCCTCCCCTAACCCCAGG - Intronic
1193161951 X:78238316-78238338 ATCACCCCTCCCCTAACCCCAGG - Intergenic
1193260708 X:79403687-79403709 ATCACCCCTCCCCTAACCCCAGG + Intergenic
1193984797 X:88227758-88227780 ATCACCCCTCCCCTAACCCCAGG + Intergenic
1194195068 X:90882703-90882725 AGAGCAGCTGCCCCAACCCATGG - Intergenic
1194358579 X:92918799-92918821 ATCACCCCTCCCCTAACCCCAGG - Intergenic
1194835169 X:98672704-98672726 ATCACCCCTCCCCTAACCCCAGG - Intergenic
1195123012 X:101775528-101775550 ATCACCTCTCCCCTAACCCCAGG - Intergenic
1195199283 X:102532481-102532503 ACCATCCCTCCCCCAACCCCAGG + Intergenic
1195595379 X:106683025-106683047 ATCACCCCTCCCCCAACCTTAGG + Intergenic
1195601271 X:106751585-106751607 ATCACCCCTCCCCCAACTCCAGG + Intronic
1195647989 X:107254129-107254151 TTCACCCCTCCCCCAACCCCAGG + Intergenic
1195783113 X:108485767-108485789 GTCACCGCTCCCTCAACCCCAGG - Intronic
1195849214 X:109264762-109264784 ATCACCCCTCCCCTAACCCCAGG - Intergenic
1196126703 X:112109030-112109052 ATCACCCCTCCCTCAACCCCAGG - Intergenic
1196466068 X:115972795-115972817 ATCACCCCTCCCCCAACCCCTGG + Intergenic
1196922050 X:120594750-120594772 ATCACCCCTCCCCCAATCCTAGG + Intronic
1197075675 X:122350198-122350220 ACCGCCCCTCCCCTAACCCAAGG + Intergenic
1197476658 X:126933454-126933476 ATCACCCCTCCCCTAACCCCAGG - Intergenic
1197663855 X:129201948-129201970 ACCACCTCTTCCCCAACCAAAGG - Intergenic
1197953081 X:131918729-131918751 ATCACCCCTCCCCTAACCCCAGG + Intergenic
1198190418 X:134299213-134299235 ATCACGCCTCCCCTAACCCAAGG + Intergenic
1198241911 X:134796114-134796136 AGCAGCGCTCCCCTAATCCATGG - Exonic
1199223094 X:145340052-145340074 AGCACCCCTCCTCCAACCCCAGG + Intergenic
1200001864 X:153066343-153066365 AGTACTGCTCCCCCCACCCCAGG + Intergenic
1200005869 X:153083682-153083704 AGTACTGCTCCCCCCACCCCAGG - Intergenic
1200069568 X:153521271-153521293 AGCACCGCCCACCCAACAGAAGG - Intronic
1200267096 X:154652540-154652562 CGCACCGCTCCCCCGACCAGGGG - Exonic
1200335536 X:155347488-155347510 AACGCCCATCCCCCAACCCACGG - Intergenic
1200350932 X:155493737-155493759 AACGCCCATCCCCCAACCCACGG + Intronic
1200666757 Y:6034489-6034511 ATCACCCCTCCCCTAACCCCAGG - Intergenic
1200686308 Y:6263253-6263275 GGCCTCTCTCCCCCAACCCACGG + Intergenic
1200991849 Y:9354500-9354522 GGCCTCTCTCCCCCAACCCACGG + Intergenic
1200994503 Y:9374780-9374802 GGCCTCTCTCCCCCAACCCACGG + Intronic
1200997166 Y:9395126-9395148 GGCCTCTCTCCCCCAACCCACGG + Intergenic
1200999682 Y:9463664-9463686 GGCCTCTCTCCCCCAACCCACGG + Intergenic
1201002340 Y:9483972-9483994 GGCCTCTCTCCCCCAACCCACGG + Intronic
1201004999 Y:9504259-9504281 GGCCTCTCTCCCCCAACCCACGG + Intergenic
1201007657 Y:9524586-9524608 GGCCTCTCTCCCCCAACCCACGG + Intergenic
1201010283 Y:9544776-9544798 GGCCTCTCTCCCCCAACCCACGG + Intergenic