ID: 1167580125

View in Genome Browser
Species Human (GRCh38)
Location 19:50336545-50336567
Sequence CTGGATGTACTGGTGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 1, 2: 1, 3: 4, 4: 168}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167580125_1167580136 10 Left 1167580125 19:50336545-50336567 CCCTGCTCCACCAGTACATCCAG 0: 1
1: 1
2: 1
3: 4
4: 168
Right 1167580136 19:50336578-50336600 ACTCCTTCCACAGACAGAATGGG 0: 2
1: 0
2: 1
3: 7
4: 181
1167580125_1167580139 20 Left 1167580125 19:50336545-50336567 CCCTGCTCCACCAGTACATCCAG 0: 1
1: 1
2: 1
3: 4
4: 168
Right 1167580139 19:50336588-50336610 CAGACAGAATGGGAAAACCGAGG 0: 2
1: 0
2: 0
3: 15
4: 176
1167580125_1167580135 9 Left 1167580125 19:50336545-50336567 CCCTGCTCCACCAGTACATCCAG 0: 1
1: 1
2: 1
3: 4
4: 168
Right 1167580135 19:50336577-50336599 AACTCCTTCCACAGACAGAATGG 0: 2
1: 0
2: 2
3: 24
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167580125 Original CRISPR CTGGATGTACTGGTGGAGCA GGG (reversed) Intronic
900592718 1:3467171-3467193 CTGGATCTCCTGGTAGAGCTGGG - Exonic
902709530 1:18229196-18229218 CTGGAGGAAGTGATGGAGCATGG + Intronic
902758047 1:18562264-18562286 CTGGATGGACTGGAGGGGCTGGG - Intergenic
903918884 1:26785515-26785537 CTGAGTGTAATGGAGGAGCAAGG - Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
905199141 1:36304756-36304778 CTGGAGCTGCTGGTGGAGAACGG - Exonic
905643547 1:39608975-39608997 CTGGGAGTGCTGGTGGAGGAAGG + Intergenic
908087758 1:60654395-60654417 CTGGATCTACTGCTGAAGCTAGG - Intergenic
909107645 1:71432717-71432739 CTGGATGAATTGTTGGATCAAGG - Intronic
909748767 1:79133488-79133510 CTGGAAGTAATGGTGATGCAAGG + Intergenic
912953989 1:114139853-114139875 CTGGATGCCCTGGAGGAACAAGG - Exonic
914797237 1:150930678-150930700 CTGGGTGTGGTGGTGGGGCAGGG - Intronic
915120664 1:153628120-153628142 CTGGCTGTGCTGGTTGAGCCCGG - Intronic
916306767 1:163344403-163344425 CTGGAAGTACAGGTGGAAGAGGG + Intronic
918565243 1:185921991-185922013 CTGGATGTATTTGTGGAAGAAGG + Intronic
918857064 1:189770201-189770223 AGGGATGAATTGGTGGAGCAAGG + Intergenic
919657812 1:200214431-200214453 CTGGTTGTGCTGCTGGAGAAGGG + Intergenic
920439023 1:205966291-205966313 CTGGGTGGAATGGTGGAGGAGGG - Intergenic
920949245 1:210557061-210557083 CTGAATGAGCTGGAGGAGCATGG + Intronic
921093027 1:211860895-211860917 AAGGATGAACAGGTGGAGCATGG - Intergenic
922233365 1:223705013-223705035 GTGGATGAACTGGGGGAGTATGG - Intronic
922414014 1:225403856-225403878 CTGGGGGAACTGGGGGAGCAGGG - Intronic
922414032 1:225403901-225403923 CTGGGGGAACTGGGGGAGCAGGG - Intronic
922414045 1:225403928-225403950 CTGGAGGTACTGGTGGAGCCAGG - Intronic
923215663 1:231845766-231845788 CTGGATGTGGTCGTGGAACAGGG + Intronic
1065698326 10:28400921-28400943 CTGGTTGTACTGGGGAAGGAAGG + Intergenic
1069774006 10:70916430-70916452 CTGGCAGTCCAGGTGGAGCAGGG + Intergenic
1070819324 10:79345844-79345866 CAGGATGCACTGGTAGAGGAAGG + Intergenic
1071297281 10:84231280-84231302 CTGGAGGTGATGGTAGAGCAAGG - Intergenic
1072955745 10:99886390-99886412 CTGGGCGTACTGGTGGAACTTGG + Exonic
1082862632 11:57870479-57870501 CTGGGAGTACTGGAGCAGCATGG - Intergenic
1082894896 11:58179688-58179710 CTGGCAGTGCTGCTGGAGCATGG + Exonic
1082896004 11:58190734-58190756 CTGGCTGTGCTGTGGGAGCACGG + Exonic
1085793806 11:79518761-79518783 CTGGAAGTTCTGGGAGAGCAGGG + Intergenic
1090730393 11:129568681-129568703 CTGGATGGACTGGAGGAAGAAGG + Intergenic
1091754114 12:3040699-3040721 CGGGAGGGACTGGGGGAGCAAGG + Intergenic
1094723852 12:33092323-33092345 CTAGATGTTCTGGTGGACCTGGG + Intergenic
1095965183 12:47862911-47862933 CTAGATGGGCTGGTGGAGCGGGG - Intronic
1103433831 12:120908999-120909021 CTGGAGGGACTGGTAGAGCCAGG - Intergenic
1104714154 12:131005556-131005578 CGGGATGCACTCGTGGGGCAAGG + Intronic
1105327486 13:19383220-19383242 CTGGTTGTGCTGCTGGAGAAGGG + Intergenic
1110546598 13:76763021-76763043 CTGGATGAACCGGTGGAGGTTGG - Intergenic
1114889243 14:26896082-26896104 CTGGATATCCAGCTGGAGCAAGG + Intergenic
1115729924 14:36257788-36257810 CTGGATGTGGTGGTGTAGCTGGG - Intergenic
1122852641 14:104545358-104545380 CTGGCTGTACTGATGGCCCAAGG + Intronic
1124140551 15:27073322-27073344 CTGGAGGTCCTGGAGGACCATGG - Intronic
1125761005 15:42095482-42095504 ATGAATGTAGTGGTTGAGCATGG + Intergenic
1128676423 15:69612407-69612429 CTGGCTGGAATGGTGGAGCTGGG - Intergenic
1130844768 15:87734400-87734422 GTGGGTGTCCTGGTGGTGCAAGG + Intergenic
1131389791 15:92037747-92037769 CTGAATGAACTGCTGGAGCAAGG - Intronic
1131532078 15:93202343-93202365 CTGGTTTTAGGGGTGGAGCAAGG - Intergenic
1135222623 16:20625740-20625762 CTGCCTGTACTGATGGAGGACGG + Intronic
1135462095 16:22653572-22653594 ATAAATGTACTGGTGGGGCATGG + Intergenic
1137389865 16:48072416-48072438 GTGGATGCACTGGAGGAGTAAGG - Intergenic
1138864232 16:60796722-60796744 CTGCCTGTACTGGTGGAATATGG - Intergenic
1140947731 16:79785745-79785767 TTGCATGTACTGGAGGAGCTAGG + Intergenic
1142212797 16:88816417-88816439 CTGGACTCAGTGGTGGAGCAGGG - Intronic
1142260497 16:89040513-89040535 CTGGCTGGCCTGGGGGAGCAAGG + Intergenic
1142954648 17:3513384-3513406 CTGGATATCCTGGGGGAGGAGGG - Exonic
1143284912 17:5781744-5781766 CTGCAGGTACAGGTGGAGGATGG + Intronic
1144226828 17:13157267-13157289 TTGGTTGTCGTGGTGGAGCAAGG + Intergenic
1147716768 17:42513877-42513899 GTGGATGGCCTGGTGGACCATGG - Exonic
1147794182 17:43030906-43030928 CTGGATGTGGTGTTGGAGCTGGG + Intergenic
1147901064 17:43785150-43785172 CTGGAGACCCTGGTGGAGCAGGG + Exonic
1147909785 17:43848652-43848674 CCGGAAGTACTGGTGCAGGAAGG + Exonic
1150299661 17:64037629-64037651 CTGGATGTACTTCTGGGGCCTGG - Intergenic
1151312116 17:73299717-73299739 GAGGATGTACATGTGGAGCAGGG + Intronic
1151830347 17:76545600-76545622 TAGGATGTGCTGGTGGAACAAGG - Intronic
1156470999 18:37377201-37377223 GTGGTTGGGCTGGTGGAGCAGGG + Intronic
1157312406 18:46561944-46561966 CTGGATGTGGTGGTGGATGAAGG - Intronic
1158605871 18:58895620-58895642 CAAGATGTCCTGGTGGAGCTGGG - Intronic
1158653127 18:59305506-59305528 CTGGACGTGCAGCTGGAGCAGGG + Intronic
1159778934 18:72638653-72638675 CAGGATGTTCTGTTGTAGCATGG - Intergenic
1160818573 19:1047495-1047517 CTGGCTCTGCTGGAGGAGCAGGG + Exonic
1161270819 19:3388262-3388284 CTGGATGGAATTGGGGAGCAAGG + Intronic
1162421239 19:10567269-10567291 CTGAAGGTCCTAGTGGAGCACGG - Exonic
1162728165 19:12702077-12702099 CCGGATGAACTGCTGCAGCATGG + Exonic
1162828139 19:13266947-13266969 CTGCAAGAACTGGTGGGGCATGG + Intronic
1163237321 19:16037315-16037337 CTGCATGTGCTGCTGGAGCTGGG + Intergenic
1165380472 19:35476044-35476066 CTGGATGAAGTGAGGGAGCAAGG + Intergenic
1165993257 19:39827639-39827661 CTGGATATACTGGTAGATCTGGG + Exonic
1166739036 19:45103145-45103167 CTGGATGAATTGGTGGTGGATGG + Intronic
1167031662 19:46966051-46966073 CTGGATGTACAAGTGAAGCTAGG - Intronic
1167580125 19:50336545-50336567 CTGGATGTACTGGTGGAGCAGGG - Intronic
1167583643 19:50360980-50361002 ATGGATGTACTGGTGGAGCAGGG - Exonic
1167632102 19:50631751-50631773 CTGGCTGTCCTGGTGTAGCCAGG - Intronic
1167649369 19:50721091-50721113 CTGGAGGTGCTGTTGGAGCTGGG - Intergenic
1168586359 19:57596740-57596762 AGGGATGAACAGGTGGAGCACGG + Intergenic
927591830 2:24363269-24363291 CTGGATGCAGTCGAGGAGCAAGG - Intergenic
928374117 2:30761215-30761237 CTACATGGAATGGTGGAGCAGGG + Intronic
932388476 2:71361241-71361263 CTGGTAATAATGGTGGAGCATGG - Intronic
934092956 2:88570350-88570372 CTGGAAGAGCTGGGGGAGCAGGG - Intronic
936523422 2:113226848-113226870 CTGGAAGAAGTGGTGGAGCTTGG + Intronic
938404977 2:131027154-131027176 TTGGCTGTACTGCTGGAGCAGGG - Intronic
939001198 2:136737261-136737283 CTAGATTTACTGGTGGTGCAGGG + Intergenic
944306963 2:198189488-198189510 CTGGATGGAGTCGGGGAGCAGGG - Intronic
948619498 2:239225537-239225559 CTGGATGGAGGGGTGGAGCCTGG + Intronic
1172761193 20:37323700-37323722 GTGGCTGTACTGGCGGGGCATGG - Intergenic
1174266853 20:49338169-49338191 CAGGAAGGACTGGCGGAGCAGGG + Intergenic
1176215200 20:63944582-63944604 CTGGATGTACTGGTCGAAGGAGG + Exonic
1182432895 22:30311006-30311028 GTGGATGTGCAGGGGGAGCATGG + Intronic
1184787096 22:46677193-46677215 CTTGATGTACTGGCTGAGAATGG - Exonic
950021293 3:9789646-9789668 GTGGAGGCACTGGTGGGGCAGGG - Intronic
950969105 3:17168650-17168672 GAGGATGTGCTGGTGGAGGAAGG + Intronic
951301277 3:21000198-21000220 CTGCCTGTGCTGATGGAGCAAGG + Intergenic
953411800 3:42694628-42694650 CATGATGAACTGGGGGAGCATGG - Intronic
953553816 3:43926146-43926168 TTGGTTGTCCTGGTAGAGCAGGG + Intergenic
955941074 3:64147419-64147441 CTGGCTGTGCTGGTTCAGCATGG + Exonic
956874056 3:73444682-73444704 GTGGAGGTAGTGGTGGAGTAAGG + Intronic
962210140 3:133470976-133470998 CTGGAAGGAATGGAGGAGCATGG + Intronic
963423396 3:145091434-145091456 CTGGGTGTTCTGGCGGCGCAAGG + Intergenic
963769358 3:149373943-149373965 CTGGATGTACTAGTAGAAAATGG - Intronic
966514965 3:180809401-180809423 TTGGCTGAACTGGTGGATCATGG - Intronic
969662259 4:8537154-8537176 CTGCTTGTGCTGGTGGAGCTGGG + Intergenic
970389373 4:15592165-15592187 TTGGATGGAATAGTGGAGCATGG - Intronic
971344744 4:25801744-25801766 CTGGGAGCACTGGTGTAGCAAGG + Intronic
973267344 4:48224124-48224146 CTGAATGTACAGGTGGAGTTGGG + Intronic
973548412 4:52005814-52005836 CTGGCTGTAGTGCTGGAGCCAGG - Intronic
974603754 4:64122611-64122633 ATTTACGTACTGGTGGAGCAAGG + Intergenic
974666332 4:64967471-64967493 CAGGATTTACTGCTGGAGGAAGG + Intergenic
977682238 4:99809484-99809506 CTGTTTGTGCTGGTGAAGCAAGG - Intergenic
979235990 4:118400902-118400924 CTGGATTTACTGGCTAAGCAAGG + Intergenic
979244645 4:118487571-118487593 CTGAATGTAATGGTGAAGAATGG + Intergenic
983423763 4:167555855-167555877 CTGGAGGTGCAGGTGGGGCAAGG + Intergenic
983567688 4:169171866-169171888 CTGGATCTAGAGGTGGGGCAGGG + Intronic
986317589 5:6600918-6600940 CTGGCTGGACAGGTGGAGCCTGG - Intronic
987812825 5:22860201-22860223 CTGGATGTACAGTTGTATCATGG - Intergenic
993629823 5:90272411-90272433 TTGGAAGTACTGTTGGAGAAGGG + Intergenic
997232879 5:132257034-132257056 CTGAATGTTCTGGGGAAGCAGGG + Intronic
1000410255 5:160929894-160929916 CTTGAGGTACTGGTGCAACATGG - Intergenic
1000591273 5:163160628-163160650 AAGGATGAACAGGTGGAGCATGG + Intergenic
1001575651 5:172762383-172762405 CTGGTTGTGCTGCTGGAGAAGGG - Intergenic
1001989086 5:176101052-176101074 CTGGAAGACCTGGAGGAGCATGG + Exonic
1002227784 5:177737085-177737107 CTGGAAGACCTGGAGGAGCATGG - Exonic
1004353079 6:14907926-14907948 GTGGTTGTACTGGCTGAGCATGG - Intergenic
1005031496 6:21513004-21513026 CAGCATGTACTGGTCGGGCATGG + Intergenic
1005875404 6:30007037-30007059 CTGGTTGTAGTAGCGGAGCAGGG - Intergenic
1005905640 6:30260052-30260074 CTGGTTGTAATAGCGGAGCAGGG - Intergenic
1006436489 6:34028355-34028377 CTGGATGTACAGCTGGCGGAGGG + Exonic
1011301675 6:85881404-85881426 CTTGATGGACTGGTAGAGAAAGG - Intergenic
1012253901 6:97010302-97010324 CTGGTAGGGCTGGTGGAGCAGGG + Intronic
1018685186 6:166298699-166298721 AGGGATGTCCTGTTGGAGCAGGG - Intergenic
1019442062 7:1052496-1052518 TTGGAGGTGCTGGAGGAGCAGGG + Intronic
1021010840 7:15463617-15463639 CTGGATGTACTTCTTGAGGAAGG - Intronic
1024100423 7:46027097-46027119 GTGGATGTATTGGAGGAACACGG + Intergenic
1025712743 7:63927317-63927339 CTGGCGGCACTGGGGGAGCAGGG - Intergenic
1026899755 7:74030257-74030279 CTGGCTGTCCTGGGGGAGCCTGG + Intronic
1031331713 7:120473843-120473865 CTGGATATACTGGGAGAGAAAGG + Intronic
1032987933 7:137359546-137359568 CTAGATCTCCTGGTTGAGCAGGG + Intergenic
1033099868 7:138460718-138460740 CTGGATGTTCTGGTGGCACACGG - Exonic
1034275514 7:149822150-149822172 CTGGGTGTCCAGGTGGAGGAAGG - Intergenic
1035070166 7:156138615-156138637 CTGAATGTGCTGATGGAGGAGGG + Intergenic
1041362284 8:57066503-57066525 CTTGATGTTCTGGTGGTGAATGG + Intergenic
1043994700 8:86798737-86798759 CATGTGGTACTGGTGGAGCAGGG - Intergenic
1047306808 8:123659225-123659247 ATGGATGGATTGGTGGAGGATGG - Intergenic
1047787333 8:128166585-128166607 CTGGGGCTGCTGGTGGAGCAGGG + Intergenic
1055417934 9:76104366-76104388 CTGGATGGAGTGGAGGAGAAAGG - Intronic
1056367768 9:85922865-85922887 CTGGAGGTTCAGGTGGAGCCAGG + Intergenic
1057563314 9:96146077-96146099 ATGGGGGTACTGGTGGAGGAAGG + Intergenic
1060409597 9:123391185-123391207 TTGGATGTACTGGCTGAGCCAGG + Intronic
1061024045 9:128035982-128036004 CTGTGTGTGCTGGTGGGGCAGGG + Intergenic
1061045144 9:128160744-128160766 CTGAAGGAAGTGGTGGAGCAAGG - Intronic
1061223295 9:129265024-129265046 CTGGATGAGATGGAGGAGCAGGG - Intergenic
1061972146 9:134050619-134050641 CTGGAAATACTAGTGGAGCCTGG - Intronic
1188293491 X:28417393-28417415 CTGAATGGACTGATGCAGCATGG - Intergenic
1189081293 X:37975368-37975390 CAGCATGTACTGGAGCAGCAGGG + Intronic
1190765627 X:53473454-53473476 CTGGTAGTGCTGGGGGAGCAGGG + Intergenic
1192411025 X:70932196-70932218 CAAGATGTCTTGGTGGAGCAGGG - Intergenic
1193432302 X:81423345-81423367 CTGGATGTACTGCATGATCATGG - Intergenic
1195803008 X:108734404-108734426 CTGGAGGAACTGGTGGAAAAGGG - Exonic
1198704157 X:139429202-139429224 CTGTATTTACTGGTGGATCCTGG + Intergenic
1198804793 X:140483618-140483640 CAGGAGTTAGTGGTGGAGCATGG - Intergenic
1199303659 X:146241703-146241725 CTGGATACACTGGAGGTGCAAGG + Intergenic
1200082926 X:153588234-153588256 CTGGTTGTGCTGCTGGAGAAGGG - Exonic
1202604344 Y:26626389-26626411 CTGGTTGTGCTGCTGGAGAAGGG - Intergenic