ID: 1167583026

View in Genome Browser
Species Human (GRCh38)
Location 19:50357705-50357727
Sequence AGCACCGCTCCCCGAACCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 153}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167583022_1167583026 -7 Left 1167583022 19:50357689-50357711 CCTCCGCGGGTGGGGCAGCACCG 0: 1
1: 0
2: 0
3: 3
4: 91
Right 1167583026 19:50357705-50357727 AGCACCGCTCCCCGAACCCGGGG 0: 1
1: 0
2: 1
3: 9
4: 153
1167583023_1167583026 -10 Left 1167583023 19:50357692-50357714 CCGCGGGTGGGGCAGCACCGCTC No data
Right 1167583026 19:50357705-50357727 AGCACCGCTCCCCGAACCCGGGG 0: 1
1: 0
2: 1
3: 9
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167583026 Original CRISPR AGCACCGCTCCCCGAACCCG GGG Intronic
900207990 1:1439744-1439766 TGCCCCGCGCCCCGACCCCGGGG + Exonic
900290778 1:1922759-1922781 GGCACCGCTCCCAGAAGCAGTGG + Intronic
901332685 1:8423511-8423533 AGCACCCCTCCCCGCCCCGGTGG + Intronic
905009776 1:34739470-34739492 AACACCCCTCCCCCAACCCCCGG + Intronic
906483928 1:46220175-46220197 GGCACTGCTCCCAGAACCAGTGG - Exonic
906877851 1:49557821-49557843 ATCACCCCTCCCCTAACCCAAGG + Intronic
908796197 1:67833281-67833303 CGCGCCGCGCCCCGACCCCGCGG + Intronic
910229806 1:84974329-84974351 ATCACCTCTCCCCTAACCCCAGG + Intronic
911019699 1:93374420-93374442 ACCACCCCTCCCCTAACCCAAGG - Intergenic
913706836 1:121434059-121434081 ATCACCCCTCCCCTAACCCTAGG + Intergenic
916171544 1:162004826-162004848 AGAACGACTCCCCGAAGCCGAGG + Intronic
917191298 1:172422172-172422194 AGCACCCCTCCCCCAACCCCAGG + Intronic
919008394 1:191928881-191928903 ATCACCGCTCCCCTAACCACAGG + Intergenic
922388619 1:225114445-225114467 ATCACCTCTCCCCCAACCCCAGG - Intronic
922685255 1:227633911-227633933 ATCACCCCTCCCCTAACCCCAGG + Intronic
923372516 1:233327801-233327823 CGCAGCGGTCCCCGAAGCCGCGG - Exonic
924436861 1:244049412-244049434 TGCACCGGTCCCCGGAGCCGCGG - Intronic
1063425271 10:5945794-5945816 AGCAGCCCTCCCAGGACCCGAGG + Intronic
1065426958 10:25615860-25615882 ACCACCCCTCCCCCAACCCCAGG - Intergenic
1069933665 10:71900514-71900536 ATCACCCCTCCCCTAACCCCAGG - Intergenic
1072344443 10:94489377-94489399 ACCACCCCTCCCCCAACCCCTGG - Intronic
1074503187 10:114044189-114044211 CGCACCGCTCCCCGACGGCGCGG + Exonic
1076008715 10:126969264-126969286 AGCACCCCTCCCCGAGCCCCTGG - Intronic
1076371616 10:129959345-129959367 GGCACCGACCCCGGAACCCGGGG + Intronic
1077247518 11:1546806-1546828 CCCGGCGCTCCCCGAACCCGAGG - Intergenic
1077858801 11:6157154-6157176 ACCACCCCTCCCCCAACCCCAGG + Intergenic
1084910028 11:72381178-72381200 ATCACCCCTCCCCGAACTCCAGG + Intronic
1087178705 11:95120623-95120645 ATCACCCCTCCCCTAACCCCAGG - Intronic
1088154920 11:106790941-106790963 AGCACCCCTCCCTCAACCCCAGG - Intronic
1088210709 11:107453356-107453378 ACCACCTCTCCCCCAACCCAAGG + Intronic
1093124632 12:15313597-15313619 ATCACCCCTCCCCTAACCCATGG - Intronic
1093687746 12:22076409-22076431 ATCCCCGCTCCCCTAACCCCAGG + Intronic
1096242539 12:49967105-49967127 AGCCCGGCTCCCCCAGCCCGGGG - Intergenic
1097147075 12:56949081-56949103 ATCACCCCTCCCCTAACCCCAGG - Intergenic
1097742817 12:63264731-63264753 AGCAGGGGTCCCCAAACCCGAGG + Intergenic
1099807877 12:87543145-87543167 GTCACCGCTCCCCCAACCCCGGG + Intergenic
1101607416 12:106258224-106258246 ATCACCCCTCCCCAAACCCCAGG + Intronic
1107178045 13:37422775-37422797 ATCACCTCTCCCCAAACCCCAGG + Intergenic
1109022801 13:57119500-57119522 ATCACCTCTCCCCTAACCCCAGG - Intergenic
1114248003 14:20933014-20933036 ACAACCGCTCCCCCAACCCCAGG + Intergenic
1116176159 14:41473120-41473142 ATCACCCCTCCCCTAACCCCAGG - Intergenic
1116422077 14:44744677-44744699 ATCACCCCTCCCCTAACCCCAGG + Intergenic
1117161510 14:52994648-52994670 ATCACCCCTCCCCCAACCCCAGG - Intergenic
1118096783 14:62546312-62546334 ACCACCCCTCCCCCAACCCCTGG + Intergenic
1118539120 14:66802909-66802931 ATCACCCCTCCCCTAACCCCAGG - Intronic
1121850131 14:97214101-97214123 ATCACCGCTCCCAGAACTCACGG + Intergenic
1124612789 15:31219974-31219996 AGCAGTGGTCCCCAAACCCGGGG + Intergenic
1125567230 15:40685896-40685918 ATCACCCCTCCCAGAACCCCAGG - Intergenic
1129030693 15:72615659-72615681 ACCACCCCTCCCCCAACCCCAGG - Intergenic
1129477534 15:75796182-75796204 ACCACCGCTCCCCCAACCCCAGG - Intergenic
1130511734 15:84595175-84595197 ACCACCCCTCCCCCAACCCCAGG + Intergenic
1135879482 16:26240356-26240378 ATCACCCCTCCCCTAACCCCAGG + Intergenic
1138265215 16:55655757-55655779 AGCACCGCTCGCCGCTCCCAAGG - Intronic
1138568620 16:57852468-57852490 AGCACCGCACCCGAAACCCAGGG - Intronic
1139546674 16:67652975-67652997 AGCACCGAGCGCCGAGCCCGGGG - Intronic
1141964515 16:87432807-87432829 AGCAGCGCACACAGAACCCGGGG - Intronic
1145260646 17:21352509-21352531 AGCCCAGTTCCCCGAAACCGTGG - Intergenic
1148218158 17:45845145-45845167 AGCTCCGCTCCCCCAGCCAGCGG + Exonic
1148323748 17:46771821-46771843 AGCACCGCCCCCCCACCGCGCGG - Intronic
1148454687 17:47804776-47804798 GGCACCGCTCCCTGAACCCCTGG + Intergenic
1155300673 18:24426552-24426574 AGAACCCCACCCCAAACCCGGGG + Intergenic
1160859231 19:1230686-1230708 AGCACCCCTCCCCCAACCCAAGG - Exonic
1162373370 19:10291656-10291678 AGCACCGCGCCCCGCGCTCGGGG - Exonic
1163618034 19:18341095-18341117 CACACCGCTCCCCCAACCCCTGG + Intronic
1164508903 19:28881855-28881877 ACTTCCGCTCCCCGCACCCGCGG + Intergenic
1164646716 19:29863688-29863710 AGGGCCGCACCCCGAACCCCAGG - Intergenic
1166568460 19:43779271-43779293 AGCACCGCACCCAGAAGCCGAGG - Intronic
1167579519 19:50333319-50333341 AGCACCGCTCCCCCAACCCAGGG + Intronic
1167583026 19:50357705-50357727 AGCACCGCTCCCCGAACCCGGGG + Intronic
926088267 2:10033472-10033494 AGGCCCTCTCCCCGAACCCTGGG + Intergenic
932858852 2:75267343-75267365 ACCACCACTCCCCAAACCCCAGG - Intergenic
934894337 2:98100789-98100811 ATCACCCCTCCCTGAACCCCAGG - Intronic
935576643 2:104717877-104717899 ATCACCGTTCCCCTAACCCCAGG - Intergenic
936074219 2:109391401-109391423 CGCACCCCTCCCCGAGCCTGTGG - Intronic
939170380 2:138688820-138688842 ACCACCGCCCCCCCAACCCCCGG + Intronic
940517328 2:154698229-154698251 GGGACCGCTCCCCGCACCCCCGG - Intergenic
942734787 2:179097243-179097265 ATCACCCCTCCCCTAACCCCAGG - Intergenic
943099596 2:183471873-183471895 ACCACCCCTCCCCCAACCCCAGG - Intergenic
943309648 2:186310290-186310312 ATCACCCCTCCCCTAACCCTAGG + Intergenic
943557296 2:189421478-189421500 AGCACCCCTTCCCCAACCCCAGG + Intergenic
947605667 2:231483765-231483787 AGCAAAGGTCCCCGAACCCGAGG - Intergenic
948475572 2:238216786-238216808 ATCACCCCTCCCCCAACCCCAGG - Intergenic
1171182694 20:23102521-23102543 AGCACCCTTCCCAGAACCCCAGG - Intergenic
1175755602 20:61527870-61527892 AGCTCTGTTCCCAGAACCCGGGG + Intronic
1176220563 20:63967600-63967622 AGCACCGCTGTCCCAACACGAGG + Intronic
1179012097 21:37563966-37563988 AGCACCGCCCCCCGAAGCCCGGG - Intergenic
1179395842 21:41039524-41039546 ATCACCACTCCCCTAACCCCAGG + Intergenic
1179910310 21:44443983-44444005 AGCGCTGCTCCTCCAACCCGGGG + Intergenic
1182439849 22:30356821-30356843 GGCACCGCTCACCGACACCGAGG - Exonic
1182899081 22:33883197-33883219 AGCAGCGCTCCCCGACACTGTGG - Intronic
1183479297 22:38054272-38054294 AGCACCTGGCCCCGAACCAGGGG + Intergenic
1185348527 22:50321263-50321285 AGCATGGCTCCCAGAAGCCGCGG + Intronic
1185381128 22:50507936-50507958 CGCCCCGCCCCCCCAACCCGTGG + Intergenic
954431470 3:50473008-50473030 AGCCCAACTCCCCCAACCCGTGG - Intronic
959725101 3:109533694-109533716 ATCACCCCTCCCCTAACCCCAGG - Intergenic
959752007 3:109849458-109849480 ATCACCCCTCCCCGAATCCCAGG + Intergenic
962151864 3:132902267-132902289 ACCACCCCTCCCCTAACCCCAGG + Intergenic
962767514 3:138579403-138579425 ATCACCCCTCCCCCAACCCCAGG + Intronic
963443659 3:145374252-145374274 TCCACCGCTCCCCCAACCCTGGG + Intergenic
963515230 3:146300860-146300882 ATCACCCCTCCCCTAACCCCAGG + Intergenic
965020159 3:163218508-163218530 ATCACCCCTCCCTGAACCCTAGG - Intergenic
967677408 3:192316784-192316806 ATCACCCCTCCCCCAACCCCAGG + Intronic
972104215 4:35462084-35462106 ATCACCCCTCCCCGGACCCCTGG - Intergenic
974337650 4:60570521-60570543 ATCACCCCTCCCCAAACCCTAGG - Intergenic
976765305 4:88592510-88592532 AGCCCCTCTCGCCGGACCCGGGG - Exonic
979413400 4:120406479-120406501 ATCACCCCTCCCCCAACCCCAGG + Intergenic
980172463 4:129306194-129306216 ACCACCCCTCCCCTAACCCCAGG - Intergenic
980960635 4:139471001-139471023 ATCACCCCTCCCCTAACCCCAGG - Intronic
982170326 4:152655617-152655639 AGCACCCCTCCCCCCACCCCTGG + Intronic
982339773 4:154284916-154284938 ACCACCCCTCCCCTAACCCCAGG + Intronic
983338124 4:166421674-166421696 ATCACCTCTCCCCAAACCCCAGG - Intergenic
988384131 5:30539497-30539519 ACCACCCCTCCCCCAACCCAAGG + Intergenic
989489472 5:42033174-42033196 ATCACCCCTCCCCCAACCCCAGG - Intergenic
989970827 5:50521836-50521858 ATCACCCCTCCCCTAACCCCAGG - Intergenic
990592814 5:57283225-57283247 ATCACCCCTCCCCTAACCCCAGG + Intergenic
991395369 5:66198968-66198990 ACCACCCCTCCCCCAACCCCAGG - Intergenic
994533630 5:100999608-100999630 ACCACCCCTCCACCAACCCGAGG + Intergenic
1005157137 6:22819684-22819706 ACCATCCCTCCCCGAACCTGAGG - Intergenic
1006304961 6:33213356-33213378 AGCCCCGCTCGCGGAACTCGAGG - Intergenic
1008214980 6:48777850-48777872 ATCACCTCTCCCCTAACCCCAGG + Intergenic
1008314650 6:50025529-50025551 ATCACCTCTCCCCTAACCCCAGG + Intergenic
1009687879 6:66986937-66986959 ATCACCCCTCCCCTAACCCCAGG - Intergenic
1012030052 6:94048380-94048402 ATCACCGCTCCCTCAACCCTGGG - Intergenic
1012189436 6:96261619-96261641 ATCACCCCTCCCCAAACCCCAGG + Intergenic
1012620693 6:101340168-101340190 ATCACCACTCCCCTAACCCCAGG - Intergenic
1016135148 6:140532092-140532114 ATCACCTCTCCCCTAACCCCAGG + Intergenic
1018976538 6:168571875-168571897 AGCCCTGGTCCCCGCACCCGGGG - Intronic
1018976848 6:168573053-168573075 AGCCCTGGTCCCCGCACCCGGGG - Intronic
1019319162 7:407699-407721 AGGACCGCTCCCCACACCCAAGG + Intergenic
1022091540 7:27110884-27110906 AGCACGGCTCCCTGCGCCCGGGG - Intronic
1022348167 7:29538754-29538776 ATCACCCCTCCCCTAACCCCAGG + Intergenic
1022542043 7:31146482-31146504 ACCACCCCTCCCCCAACCCCAGG - Intergenic
1023240917 7:38146550-38146572 ATCACCACTCCCCCAACCCCAGG + Intergenic
1030323233 7:108192098-108192120 AGCACGGGTCCCCAAACCCTGGG + Intronic
1031231687 7:119114941-119114963 ATCACCCCTCCCCTAACCCCAGG - Intergenic
1045599039 8:103692831-103692853 ATCACCCCTCCCCCAACCCCAGG - Intronic
1047138436 8:122107533-122107555 ATCACCCCTCCCCCAACCCCAGG - Intergenic
1048484183 8:134832051-134832073 CGCCCCGCGCCCCGAGCCCGAGG + Intergenic
1051921708 9:22274701-22274723 ATCACCGTTCCCCTAACCCCAGG + Intergenic
1058013605 9:100004648-100004670 ACCACCCCTCCCCCAACCCCAGG - Intronic
1058767741 9:108198427-108198449 ATCACCCCTCCCCTAACCCCAGG + Intergenic
1062452691 9:136622148-136622170 AGCACTGCTCACAGGACCCGGGG + Intergenic
1187594558 X:20756616-20756638 AGTACCCCTCCCCCAACCCCAGG - Intergenic
1187844857 X:23524734-23524756 ATCACCCCTCCCCTAACCCGAGG + Intergenic
1188815367 X:34705968-34705990 ATCACCCCTCCCCTAACCCCAGG - Intergenic
1190538036 X:51448364-51448386 ATCACCCCTCCCCCAACCCTAGG - Intergenic
1192958862 X:76104623-76104645 ATCACCCCTCCCCTAACCCCAGG - Intergenic
1193063523 X:77232945-77232967 ATCACCCCTCCCCTAACCCCAGG + Intergenic
1193147562 X:78093037-78093059 ATCACCCCTCCCCTAACCCCAGG - Intronic
1193161951 X:78238316-78238338 ATCACCCCTCCCCTAACCCCAGG - Intergenic
1193260708 X:79403687-79403709 ATCACCCCTCCCCTAACCCCAGG + Intergenic
1193984797 X:88227758-88227780 ATCACCCCTCCCCTAACCCCAGG + Intergenic
1194358579 X:92918799-92918821 ATCACCCCTCCCCTAACCCCAGG - Intergenic
1194835169 X:98672704-98672726 ATCACCCCTCCCCTAACCCCAGG - Intergenic
1195123012 X:101775528-101775550 ATCACCTCTCCCCTAACCCCAGG - Intergenic
1195849214 X:109264762-109264784 ATCACCCCTCCCCTAACCCCAGG - Intergenic
1196466068 X:115972795-115972817 ATCACCCCTCCCCCAACCCCTGG + Intergenic
1197476658 X:126933454-126933476 ATCACCCCTCCCCTAACCCCAGG - Intergenic
1197953081 X:131918729-131918751 ATCACCCCTCCCCTAACCCCAGG + Intergenic
1198241911 X:134796114-134796136 AGCAGCGCTCCCCTAATCCATGG - Exonic
1198267362 X:135022085-135022107 AGCACCGGTCCCCAGGCCCGAGG + Exonic
1199223094 X:145340052-145340074 AGCACCCCTCCTCCAACCCCAGG + Intergenic
1200267096 X:154652540-154652562 CGCACCGCTCCCCCGACCAGGGG - Exonic
1200666757 Y:6034489-6034511 ATCACCCCTCCCCTAACCCCAGG - Intergenic