ID: 1167584112

View in Genome Browser
Species Human (GRCh38)
Location 19:50363634-50363656
Sequence CAGTAGTTCGAGGGGGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 597
Summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 544}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167584112_1167584129 28 Left 1167584112 19:50363634-50363656 CCCACTGCCCCCTCGAACTACTG 0: 1
1: 0
2: 2
3: 50
4: 544
Right 1167584129 19:50363685-50363707 CCTGAACTAGCTGGGACCATGGG 0: 1
1: 1
2: 22
3: 296
4: 3409
1167584112_1167584123 19 Left 1167584112 19:50363634-50363656 CCCACTGCCCCCTCGAACTACTG 0: 1
1: 0
2: 2
3: 50
4: 544
Right 1167584123 19:50363676-50363698 CCTCACCCTCCTGAACTAGCTGG 0: 1
1: 1
2: 59
3: 279
4: 1356
1167584112_1167584124 20 Left 1167584112 19:50363634-50363656 CCCACTGCCCCCTCGAACTACTG 0: 1
1: 0
2: 2
3: 50
4: 544
Right 1167584124 19:50363677-50363699 CTCACCCTCCTGAACTAGCTGGG 0: 1
1: 1
2: 63
3: 282
4: 1123
1167584112_1167584127 27 Left 1167584112 19:50363634-50363656 CCCACTGCCCCCTCGAACTACTG 0: 1
1: 0
2: 2
3: 50
4: 544
Right 1167584127 19:50363684-50363706 TCCTGAACTAGCTGGGACCATGG 0: 1
1: 0
2: 2
3: 27
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167584112 Original CRISPR CAGTAGTTCGAGGGGGCAGT GGG (reversed) Intronic
900155832 1:1202953-1202975 CAGTAGGTGGACGGGGCAGAGGG - Intergenic
900281268 1:1870975-1870997 CAGTAGTTGGAGGGTGATGTGGG - Intronic
900631085 1:3635745-3635767 CAGGAGGTCGAGGCTGCAGTGGG + Intronic
901736098 1:11313126-11313148 CAAGAGTTCGAGGCTGCAGTGGG - Intergenic
901864020 1:12092250-12092272 CAGGAGTTAGAGGTTGCAGTGGG - Intronic
901941111 1:12662559-12662581 GAGTGGATGGAGGGGGCAGTAGG + Intronic
902160779 1:14528673-14528695 CAGGAGGTCGAGGTTGCAGTGGG + Intergenic
902352142 1:15864681-15864703 CAGTAGTTCCAGGCTGCAGTGGG - Intronic
902529710 1:17082942-17082964 CAGGAGTTTGAGGCTGCAGTGGG - Intronic
903206560 1:21786766-21786788 CAGTAGCTGGAGGGGGATGTGGG - Intergenic
903230203 1:21917357-21917379 CAGGAGGTCGAGGCTGCAGTGGG + Intronic
904062193 1:27720483-27720505 CAGGAGTTAGAGGCTGCAGTGGG - Intergenic
904811262 1:33164850-33164872 CAGGAGTTTGAGGCTGCAGTAGG - Intronic
905691685 1:39947993-39948015 CAGGAGTTTGAGGCTGCAGTGGG - Intergenic
905709917 1:40093364-40093386 AAGTAGTAGGAGGGGGCAATAGG + Intronic
906039859 1:42780174-42780196 CAGGAGTTCAAGGCTGCAGTGGG - Intronic
906222415 1:44091835-44091857 TAGGAGTTCGAGGCTGCAGTGGG + Intergenic
906570223 1:46831569-46831591 CAGGAGGTCGAGGCTGCAGTGGG - Intergenic
907035068 1:51208907-51208929 CAGGAGGTGGAGGTGGCAGTGGG + Intergenic
907121172 1:52009491-52009513 CAGTAGCTGGAGGTCGCAGTGGG - Intergenic
907275070 1:53312436-53312458 CAGGAGTTTGAGGTTGCAGTGGG - Intronic
907388985 1:54144353-54144375 CAGGAGTTCAAGGGGGGATTTGG - Exonic
907486843 1:54783926-54783948 CAGGAGTTCAAGGCTGCAGTGGG + Intronic
908389518 1:63672086-63672108 CAGGAGTTTGAGGCTGCAGTGGG - Intergenic
909402330 1:75247950-75247972 CAGTAGCTGGAGGGGGATGTGGG + Intronic
910901347 1:92124505-92124527 CAGGAGTTTGAGGCTGCAGTGGG + Intronic
910901919 1:92130437-92130459 CAGGAGTTTGAGGCTGCAGTGGG + Intronic
911070483 1:93828228-93828250 CAGGAGTTCAAGGTTGCAGTGGG + Intronic
911088079 1:93996129-93996151 CAGCAGCTCGAGGGTGCAGAGGG + Exonic
912346177 1:108965417-108965439 CAGGAGTTCAAGGCTGCAGTGGG - Intergenic
912353728 1:109038603-109038625 CAGGAGTTTGAGGCTGCAGTGGG + Intronic
913037397 1:114983972-114983994 CAGGAGTTCAAGGTAGCAGTGGG - Intronic
914335207 1:146708763-146708785 CAGGAGTTTGAGGTTGCAGTGGG - Intergenic
914788734 1:150856882-150856904 CAGGAGTTTGAGGCTGCAGTGGG + Intronic
914904770 1:151734834-151734856 CAGTCGTTGGAGGGGGAAGCAGG + Intergenic
915108017 1:153546383-153546405 CAGGAGTTCGAGACTGCAGTTGG + Intronic
915184447 1:154092796-154092818 CAGTAGTTTGAGGTTACAGTGGG - Intronic
915501373 1:156320657-156320679 CAGGAGTTTGAGGCTGCAGTGGG + Intronic
916072952 1:161182160-161182182 CAGGAGTTCAAGGCTGCAGTGGG - Intergenic
916540541 1:165749587-165749609 CAGGAGTTCAAGGATGCAGTGGG + Intronic
916541064 1:165754918-165754940 CAGGAGTTTGAGGCTGCAGTGGG + Intronic
916830904 1:168489811-168489833 CAGGAGTTTGAGGCTGCAGTGGG + Intergenic
917380112 1:174397066-174397088 CAGGAGATCGAGGCTGCAGTGGG + Intronic
917406370 1:174711667-174711689 CAGGAGTGCCAGGGGGCACTCGG - Intronic
917765084 1:178207106-178207128 CAGGAGTTTGAGGCTGCAGTGGG + Intronic
918794825 1:188880354-188880376 CAGGAGTTCTAGGCTGCAGTGGG - Intergenic
920288782 1:204901679-204901701 CAGTAGCCCGAGGGGAGAGTGGG + Intronic
920370957 1:205479091-205479113 CAGGAGTTTGAGGCTGCAGTGGG - Intergenic
921370021 1:214412941-214412963 CAGGAGTTTGAGGCTGCAGTGGG - Intronic
921506537 1:215978051-215978073 CAGGAGGTCGAGGCTGCAGTGGG + Intronic
923272037 1:232364376-232364398 CAGGAGTTTGAGGCTGCAGTGGG + Intergenic
923901573 1:238331839-238331861 CAGGAGTTTGAGGCTGCAGTGGG - Intergenic
924605593 1:245532012-245532034 CAGAAGTTTGAGGCTGCAGTGGG + Intronic
1063120651 10:3103553-3103575 CAGGAGTTCAAGGCTGCAGTGGG + Intronic
1063579227 10:7290761-7290783 CAGGAGTTCGAAGCTGCAGTGGG + Intronic
1063903263 10:10757383-10757405 CAGGAGTTAGAGGCTGCAGTGGG + Intergenic
1064117380 10:12590289-12590311 CAGGAGGTCGAGGCTGCAGTGGG - Intronic
1064201150 10:13285979-13286001 CAGGAATTCGAGGCTGCAGTGGG - Intronic
1064216736 10:13406765-13406787 CAGGAGTTCCAGGCTGCAGTGGG - Intergenic
1065017963 10:21478948-21478970 CAGGAGTTTGAGGTTGCAGTGGG - Intergenic
1065231964 10:23607609-23607631 CAGGAGTTCAAGGTTGCAGTGGG - Intergenic
1065745774 10:28840401-28840423 CAGGAGTTCAAGGCTGCAGTGGG - Intergenic
1065849454 10:29774999-29775021 CAGGAGTTAGAGGCTGCAGTGGG + Intergenic
1066317468 10:34262338-34262360 CAGGAGTTTGAGGCTGCAGTGGG - Intronic
1068288008 10:54964254-54964276 CATTAGTTCGGTGGGGCAATTGG + Intronic
1069461070 10:68595077-68595099 CAGGAGTTCGAGGTTGCAGTGGG + Intronic
1069718626 10:70536225-70536247 CAGGAGTTCCAGGCTGCAGTGGG + Intronic
1070545606 10:77450021-77450043 CAGGAGTTGGAGGCTGCAGTGGG - Intronic
1071065971 10:81636564-81636586 CAGGAGTTTGAGGCTGCAGTGGG - Intergenic
1072130673 10:92491162-92491184 CAGGAGTTTGAGGCTGCAGTAGG + Intronic
1072505559 10:96062805-96062827 CAGGAGGTCGAGGCTGCAGTGGG - Intergenic
1072589112 10:96811058-96811080 CAGGAGTTCAAGGTTGCAGTGGG + Intergenic
1072677890 10:97482100-97482122 CAGGAGATCGAGGCTGCAGTGGG + Intronic
1074467768 10:113698577-113698599 CAGGAGATCGAGGCTGCAGTGGG + Intronic
1075062522 10:119266846-119266868 CAGGAGTTCAAGGCTGCAGTGGG - Intronic
1075108370 10:119558788-119558810 CAGGAGTTCGAGGCTGCAGTGGG - Intergenic
1075532429 10:123240919-123240941 CAGTAGATGGACAGGGCAGTGGG + Intergenic
1075710446 10:124527852-124527874 CAGGAGTTCCAGGCTGCAGTGGG - Intronic
1075824733 10:125345799-125345821 CAGGAGTTGGAGGCCGCAGTGGG - Intergenic
1077081188 11:725435-725457 CAGGAGGTCGAGGCTGCAGTGGG + Intronic
1078224015 11:9375599-9375621 CAGGAGTTTGAGGCTGCAGTGGG + Intergenic
1078486847 11:11731267-11731289 CAGGAGTTCGGGGAGGGAGTTGG - Intergenic
1078772102 11:14360472-14360494 CAGAAGTTGGAGGTTGCAGTGGG - Intronic
1080515979 11:33020709-33020731 CAGGAGTTCGAGGTTACAGTGGG - Intronic
1081502817 11:43682863-43682885 CAAGAGTTCGAGGCTGCAGTTGG - Intronic
1082050768 11:47768758-47768780 CAGGAGTTTGAGGATGCAGTGGG - Intergenic
1083025017 11:59543270-59543292 CAGGAGTTGGAGGCTGCAGTGGG + Intergenic
1083039761 11:59674224-59674246 CAGGAGTTTGAGGTAGCAGTGGG - Intergenic
1083756019 11:64792079-64792101 GAGAAGTTCTAGGGGGCAGCAGG + Exonic
1083850454 11:65363166-65363188 CAGGAATTTGAGGTGGCAGTGGG - Intergenic
1084067393 11:66712917-66712939 CAGGAGTTCTAGGCTGCAGTGGG - Intronic
1084187476 11:67482415-67482437 CAGGAGTTCGAGGCTGCAGTGGG - Intergenic
1084895007 11:72259858-72259880 CAGGAGTTCGAGGCTGTAGTGGG - Intergenic
1085385381 11:76154695-76154717 CAGAAGTCAGAGGGGGCATTTGG - Intergenic
1085577885 11:77623515-77623537 CAGTAGTTCAAGGCTGCAGTGGG + Intronic
1085668603 11:78439964-78439986 CTATAGTTCGTGGGGGCATTAGG + Intronic
1086316842 11:85603841-85603863 CAGGAGTTCGAGGCTTCAGTGGG + Intronic
1086477099 11:87188628-87188650 CAGTAGGTGGAGGTTGCAGTGGG + Intronic
1086498489 11:87427843-87427865 CAGAAGATGGAGGGGGCTGTAGG + Intergenic
1089628316 11:119765953-119765975 CAGTGGTTGTGGGGGGCAGTGGG - Intergenic
1091070213 11:132556010-132556032 CAGGAGGTCGAGGCTGCAGTGGG - Intronic
1091432160 12:445650-445672 CAGGAGTTCAAAGTGGCAGTGGG - Intergenic
1091573004 12:1706914-1706936 CAGGAGTTCAAGGCTGCAGTGGG + Intronic
1092411355 12:8255640-8255662 CAGGAGTTCAAGGGTGCAATGGG - Intergenic
1092689086 12:11087173-11087195 CAGGAGTTCAAGGCTGCAGTGGG - Intronic
1092692432 12:11128994-11129016 CAGGAGTTCCAGGCTGCAGTGGG - Intronic
1093530044 12:20149794-20149816 CAGAAGTTCAAGGCTGCAGTGGG + Intergenic
1093915318 12:24795692-24795714 CAGGAGTTCAAGGCTGCAGTGGG + Intergenic
1094449207 12:30566417-30566439 CAGGAGTTTGAGGCTGCAGTGGG - Intergenic
1094708943 12:32941752-32941774 CAGGAGGTCGAGGCTGCAGTGGG + Intergenic
1096279170 12:50236867-50236889 CAGGAGTTCGAGGCTGCCGTGGG + Intronic
1097204653 12:57310134-57310156 CAGGAGTTTGAGGGTGCAGTGGG + Intronic
1097205028 12:57313805-57313827 CAGAAGTTCAAGGCTGCAGTGGG + Intronic
1098296467 12:69009052-69009074 CAGGAGTTGGAGGCTGCAGTGGG + Intergenic
1099105453 12:78490589-78490611 CAGGCGTTCGAGGTTGCAGTGGG - Intergenic
1099203450 12:79701877-79701899 CAGGAGTTTGAGGCTGCAGTGGG - Intergenic
1099260014 12:80367048-80367070 CAGAAGTTTGAGGCTGCAGTGGG - Intronic
1100382821 12:94077632-94077654 CAGGAGTTTGAGGCTGCAGTGGG - Intergenic
1100432415 12:94542419-94542441 CAGCAGTTCCAGGCTGCAGTAGG + Intergenic
1100704174 12:97182308-97182330 CAGTAGGTTGAGGCTGCAGTGGG - Intergenic
1100782329 12:98041793-98041815 CAGAAGTTCAAGGCTGCAGTGGG + Intergenic
1100969332 12:100050736-100050758 CAGGAGTTCAAGGCTGCAGTGGG + Intronic
1101498351 12:105277459-105277481 CAGGAGTTCAAGGCTGCAGTGGG + Intronic
1101927840 12:108987993-108988015 CAGGAGGTCGAGGCTGCAGTGGG - Intronic
1101928975 12:108996856-108996878 CAGGAGTTTGAGGTTGCAGTGGG + Intronic
1101957805 12:109226195-109226217 CAGGAGTTCAAGGCTGCAGTGGG + Intronic
1102340259 12:112115948-112115970 CAGGAGTTTGAGGCTGCAGTGGG + Intergenic
1102351543 12:112196064-112196086 CAGTAGTTGGAGGCCACAGTGGG + Intronic
1103098686 12:118153336-118153358 CAGGAGTTCGAGGCTGCAGTGGG + Intronic
1103312004 12:120017656-120017678 CAGGAGTTCAAGGTTGCAGTAGG + Intronic
1103388254 12:120551057-120551079 CAGTAGGTCAAGGCTGCAGTGGG - Intronic
1103511425 12:121477455-121477477 CAGGAGTTGGAGGGTGTAGTGGG - Intronic
1103575458 12:121873907-121873929 CAGGAGTTCAAGGCTGCAGTGGG + Intergenic
1103745635 12:123121298-123121320 CAGGAGTTTGAGGCTGCAGTAGG + Intronic
1103795660 12:123501369-123501391 CAGGAGTTCGAGGCTGCAGTGGG + Intronic
1103893252 12:124255531-124255553 CAGGAGGTCGAGGCTGCAGTGGG + Intronic
1104673598 12:130697447-130697469 CAGGAGTTCAAGGCTGCAGTGGG + Intronic
1104992294 12:132632675-132632697 CAGGAGGCCGAGGGGGCGGTCGG - Exonic
1105010170 12:132750310-132750332 CAGGAGTTTGAGGCTGCAGTGGG + Intronic
1105295046 13:19081407-19081429 CAGGAGTTTGAGGTTGCAGTGGG - Intergenic
1105492833 13:20904082-20904104 CAGGAGGTCGAGAGTGCAGTGGG + Intergenic
1106071848 13:26419946-26419968 CAGGAGTTCCAGGTTGCAGTGGG - Intergenic
1106136582 13:26978118-26978140 CAGAAGTTCAAGGCTGCAGTGGG - Intergenic
1106503066 13:30347789-30347811 CAGGAGTTCAAGGCTGCAGTAGG + Intergenic
1106868763 13:33996433-33996455 CAGGAGTTTGAGGCTGCAGTGGG - Intergenic
1107186198 13:37524182-37524204 CAGGAGGTAGAGGTGGCAGTAGG - Intergenic
1107365301 13:39666325-39666347 CAGGAGTTCAAGGTTGCAGTGGG + Intronic
1107767634 13:43754656-43754678 CAGGAGTTTGAGGCTGCAGTGGG - Intronic
1107896918 13:44974623-44974645 CAGGAGTTTGAGGTTGCAGTGGG - Intronic
1108350967 13:49590529-49590551 CAGGAGTTTGAGGCTGCAGTGGG - Intergenic
1108579024 13:51812805-51812827 CAGGAGTTCAAGGCTGCAGTGGG + Intergenic
1109092243 13:58062952-58062974 AAGTAGTTTGAGGGCGCAGTGGG - Intergenic
1111864464 13:93751593-93751615 CAGGAGTTTGAGGCTGCAGTGGG - Intronic
1112309582 13:98306586-98306608 CAGGAGTTCGAGGCTGCAGCGGG - Intronic
1112940750 13:104858732-104858754 CAGGAGTTTGAGGCTGCAGTGGG + Intergenic
1114178834 14:20347945-20347967 CAGAAGTTCAAGGTTGCAGTGGG - Intronic
1114298009 14:21347800-21347822 CAGGAGGTCGAGGATGCAGTGGG - Intronic
1115025622 14:28741885-28741907 CAGGAGTTCAAGGCTGCAGTGGG + Intergenic
1115090123 14:29564770-29564792 CAGGAGTTTGAGGTTGCAGTGGG - Intergenic
1115706325 14:36002623-36002645 CAGGAGTTCAAGGCTGCAGTGGG - Intergenic
1116728008 14:48587158-48587180 CAGGAGTTTGAGGCTGCAGTGGG + Intergenic
1116878808 14:50143249-50143271 CAGGAGTTCGAGACTGCAGTGGG + Intronic
1117359717 14:54960871-54960893 CAGGAGTTCGAGGGTGCAGTAGG - Intronic
1117880831 14:60312027-60312049 CAGGAGGTCGAGGCTGCAGTGGG - Intergenic
1118397169 14:65347628-65347650 CAGGAGGTCGAGGCTGCAGTGGG - Intergenic
1119328118 14:73774295-73774317 CAGTAATTGCAGGGTGCAGTGGG - Intronic
1119455389 14:74751094-74751116 CAGTAGGTGGAGGTTGCAGTGGG + Intergenic
1121206277 14:92171198-92171220 CAGGAGTTTGAGGCTGCAGTGGG - Exonic
1121208164 14:92186917-92186939 CAGGAGTTCGAGGCTGCAGTGGG - Intergenic
1121280710 14:92695573-92695595 CAGGAGTTGGAGGCTGCAGTGGG - Intergenic
1122457004 14:101861984-101862006 CAGAAGTTCGAGGCTGCAGTGGG - Intronic
1122669452 14:103359172-103359194 CAGGAGGTCGAGGCTGCAGTGGG - Intergenic
1124422516 15:29535174-29535196 CAGGAGTTCAAGGCTGCAGTGGG + Intronic
1125195576 15:37042075-37042097 CAAGAGTTCGAGGCTGCAGTGGG + Intronic
1125840272 15:42793987-42794009 CAGGAGTTAGAGGCTGCAGTGGG - Intronic
1125997888 15:44181827-44181849 CAGGAGTTCGAGGGTAAAGTGGG + Intronic
1126008416 15:44280298-44280320 CAGGAGTTTGAGGCTGCAGTGGG - Intergenic
1127226931 15:56940827-56940849 CAGAAGTTCAAGGATGCAGTAGG - Intronic
1127251542 15:57243950-57243972 CAGGAGTTGGAGGCTGCAGTGGG - Intronic
1128159038 15:65411051-65411073 CAGCACTCCGAGGGGGCCGTGGG + Exonic
1128990636 15:72256949-72256971 CAGGAGGTCGAGGCTGCAGTGGG - Intronic
1129057085 15:72827825-72827847 CAAGAGTTTGAGGGTGCAGTGGG + Intergenic
1129163420 15:73760821-73760843 CAGTACTTGGAGAGGGAAGTGGG - Intergenic
1129261905 15:74373410-74373432 CAGTAGGTAGTGGGGGCAGGAGG + Intergenic
1129340819 15:74885342-74885364 CAGGAGTTCGAGGCTGCAGTAGG + Intergenic
1129349612 15:74947708-74947730 CAGGAGGTGGAGGGTGCAGTAGG - Intergenic
1129496810 15:75990754-75990776 CAGAAGTTAGAGGGTACAGTGGG - Intronic
1129502276 15:76050877-76050899 CAGGAGTTCGAGGCTGCAGTGGG - Intronic
1130747536 15:86671996-86672018 CAGGAGTTCAAGGCTGCAGTGGG + Intronic
1130788784 15:87129403-87129425 CAGGAGTTCAAGGTGGTAGTAGG + Intergenic
1131243162 15:90766033-90766055 CAGGAGTTTGAGGCTGCAGTGGG + Intronic
1131540968 15:93274952-93274974 CAGGAGTTTGAGGCTGCAGTGGG + Intergenic
1133116710 16:3581707-3581729 CAGCTGTCCCAGGGGGCAGTGGG - Exonic
1133664954 16:7957939-7957961 CAGGAGTTCAAGGCTGCAGTGGG - Intergenic
1133754568 16:8752691-8752713 CAGGAGTTTGAGGCTGCAGTGGG + Intronic
1133812612 16:9172569-9172591 CAGTAGGTCATGGGGGGAGTGGG - Intergenic
1133935676 16:10267363-10267385 CAGGAGTTCAAGGCTGCAGTGGG + Intergenic
1134263606 16:12673973-12673995 CAGGAGTTGGAGGTTGCAGTGGG + Intronic
1135049237 16:19179199-19179221 CAGGAGTTTGAGGCTGCAGTGGG - Intronic
1135139681 16:19910921-19910943 CAGGAGTTCAAGGCTGCAGTGGG - Intergenic
1135267082 16:21036486-21036508 CAGGAGTTCGAGGCTGCAGTGGG - Intronic
1135543393 16:23349411-23349433 CAGGAGCTCGAGGCTGCAGTGGG + Intronic
1135735570 16:24929237-24929259 CAGGAGTTCGAGACTGCAGTGGG - Intronic
1135857267 16:26023471-26023493 CAGGAGTTTGAGGTTGCAGTGGG - Intronic
1135983124 16:27164111-27164133 CAGGAGTTCAAGGCTGCAGTGGG - Intergenic
1136040873 16:27577797-27577819 CAGGAGTTCGAGGCTGCAATAGG + Intronic
1136475333 16:30509652-30509674 CAGGAGTTTGAGGCTGCAGTGGG - Intronic
1137267318 16:46880031-46880053 CAGAAGTTCTAGGCTGCAGTGGG - Intergenic
1137653828 16:50142843-50142865 CAGGAGTTCCAGGATGCAGTGGG + Intergenic
1137736853 16:50731094-50731116 CAGGAGTTCAAGGCTGCAGTGGG + Intronic
1137973806 16:53012901-53012923 CAGGAGTTGGAGGCTGCAGTGGG + Intergenic
1138122351 16:54410853-54410875 CAGGAGGTCGAGGCTGCAGTGGG - Intergenic
1138455090 16:57116476-57116498 CAGGAGTTTGAGGCTGCAGTGGG + Intronic
1138690386 16:58762291-58762313 CAGGAGTTCAAGGCTGCAGTAGG + Intergenic
1138790309 16:59896131-59896153 CAGGAGTTTGAGGCTGCAGTGGG - Intergenic
1139555796 16:67709232-67709254 CAGTAGGTCAAGGCTGCAGTGGG + Intronic
1139813305 16:69642023-69642045 CAGGAGGTCGAGGCTGCAGTGGG + Intronic
1139905465 16:70362649-70362671 CAGGAGGTCGAGGCTGCAGTGGG - Intronic
1139998418 16:71002476-71002498 CAGGAGTTTGAGGTTGCAGTGGG + Intronic
1140702449 16:77593742-77593764 CAGGAGTTGGAGGCCGCAGTAGG + Intergenic
1140760489 16:78104428-78104450 CAGGAGCTCGAGGCTGCAGTGGG + Intronic
1141499297 16:84432592-84432614 CAGGAGATGGAGGTGGCAGTGGG - Intronic
1141999381 16:87655425-87655447 CAGGAGATCGAGGCTGCAGTGGG - Intronic
1142044365 16:87915613-87915635 CAGGAGGTCGAGGCTGCAGTGGG + Intronic
1142384761 16:89756549-89756571 CAGGAGGTCGAGGCTGCAGTGGG + Intronic
1142405558 16:89887105-89887127 CAGGAGGTCGAGGCTGCAGTGGG - Intronic
1143534908 17:7532237-7532259 CAGGAGTTCAAGGCTGCAGTAGG + Intergenic
1143623918 17:8097201-8097223 CAGGAGTTTGAGGCTGCAGTGGG - Intronic
1144071957 17:11682322-11682344 AAGGAGTTCAAGGGTGCAGTAGG - Intronic
1144604920 17:16656665-16656687 CAGGAGTTCAAGGCTGCAGTGGG + Intergenic
1145409226 17:22641809-22641831 CAGGAGTTCGAGGCTGAAGTGGG - Intergenic
1145837008 17:27962014-27962036 CAGGAGTTTGAGGCTGCAGTGGG + Intergenic
1146010376 17:29189740-29189762 CAGGAGTTCGAGGCTGCAGTGGG + Intergenic
1146171523 17:30638033-30638055 CAGGAGTTTGAGGCTGCAGTGGG - Intergenic
1146334601 17:31958242-31958264 CAGTAGTTCGAGGTCACACTGGG - Intronic
1146344985 17:32054056-32054078 CAGGAGTTTGAGGCTGCAGTGGG - Intergenic
1146360424 17:32171292-32171314 CAGGAGTTGGAGGTTGCAGTGGG - Intronic
1146800507 17:35816033-35816055 CAGGAGGTCGAGGCTGCAGTGGG - Intronic
1147722797 17:42549002-42549024 CAGGAGTTGGAGGCTGCAGTGGG + Intergenic
1147735330 17:42633874-42633896 CAGGAGTTCGAGGCCGCAGTGGG - Intergenic
1149087816 17:52740245-52740267 CAGGAGTTCTAGGCTGCAGTGGG + Intergenic
1149228754 17:54506997-54507019 CAGGAGTTTGAGGCTGCAGTGGG + Intergenic
1149508091 17:57212712-57212734 CAGGAGTTTGAGGCTGCAGTGGG - Intergenic
1150414218 17:64974276-64974298 CAGGAGGTCGAGGCTGCAGTGGG + Intergenic
1150797424 17:68249377-68249399 CAGGAGGTCGAGGCTGCAGTGGG - Intronic
1151816423 17:76473595-76473617 CCGCAGCTCGGGGGGGCAGTGGG + Intronic
1151817440 17:76478240-76478262 CAGTGCTTTGAGGGGGCAGCAGG - Intronic
1153562519 18:6385326-6385348 CAGGAGTTTGAGGCTGCAGTGGG + Intronic
1153835634 18:8961749-8961771 CAGGAGTTCGAGGCTGCAGTGGG - Intergenic
1153840820 18:9006149-9006171 CAGGAGTTCAAGGCTGCAGTGGG + Intergenic
1154143516 18:11846797-11846819 CAGGAGTTTGAGGTTGCAGTGGG - Intronic
1155162440 18:23206882-23206904 CAGGAGTTCAAGGCTGCAGTGGG - Intronic
1155467322 18:26152396-26152418 CAGAAGGTCGAGGCTGCAGTGGG - Intronic
1155521846 18:26676252-26676274 CAGGAGTTTGAGGCTGCAGTAGG - Intergenic
1156401137 18:36741695-36741717 CAGGAGTTCAAGGCTGCAGTAGG + Intronic
1156843716 18:41638980-41639002 CAGGAGGTCGAGGATGCAGTGGG + Intergenic
1157848111 18:51022728-51022750 CAGGAGTTTGAGGCTGCAGTGGG - Intronic
1158547857 18:58411042-58411064 CAGAAGTTGGAGGCTGCAGTGGG + Intergenic
1158560002 18:58505641-58505663 CAGTAGTTGGGGTGGGCTGTGGG - Intronic
1158876520 18:61739273-61739295 CAGGAGATCGATGGTGCAGTGGG + Intergenic
1159019202 18:63129361-63129383 CAACAGTTCGAGGCTGCAGTGGG - Intronic
1160173227 18:76571693-76571715 CAGGAGTTGGAGGTTGCAGTGGG + Intergenic
1160561350 18:79758763-79758785 CTGTAGTTCCAGGAGGCACTTGG + Intergenic
1160631629 18:80250479-80250501 CAGGAGGTCGAGGCTGCAGTGGG + Intergenic
1160759881 19:778249-778271 CAGGAGGTCGAGGCTGCAGTGGG + Intergenic
1160760952 19:784088-784110 CAGGAGGTCGAGGCTGCAGTGGG - Intergenic
1161006479 19:1939798-1939820 CAGGAGGTCGAGGCTGCAGTGGG - Intergenic
1161351820 19:3797368-3797390 CAGGAGGTCGAGGCTGCAGTGGG - Intronic
1161780012 19:6285770-6285792 CAGGAGTTTGAGGCTGCAGTGGG + Intergenic
1161911730 19:7198955-7198977 CAGGAGTTTGAGGCTGCAGTGGG - Intronic
1162527148 19:11212942-11212964 CAGGAGTTTGAGGCTGCAGTGGG - Intronic
1162933811 19:13970589-13970611 CAGAAGTTCAAGGCTGCAGTAGG + Intronic
1163035911 19:14568795-14568817 CAGGAGTTTGAGGCTGCAGTGGG + Intronic
1163286349 19:16350669-16350691 CAGGAGTTCAAGGCTGCAGTGGG + Intergenic
1163310522 19:16511652-16511674 CAGGAGGTGGAGGAGGCAGTGGG - Intronic
1163762209 19:19143726-19143748 CAGGAGTTGGAGGCTGCAGTGGG - Intergenic
1164484923 19:28647169-28647191 CAGGAGTTCAAGGCTGCAGTGGG - Intergenic
1165012147 19:32856677-32856699 CAGAAGTTCCAGGCTGCAGTGGG - Intronic
1165312301 19:35035940-35035962 CGGGAGTTCGAGGCTGCAGTGGG - Intronic
1165312590 19:35037883-35037905 CAGGAGTTCCAGGCTGCAGTGGG + Intronic
1165316982 19:35061982-35062004 CAGGAGTTTGAGGCTGCAGTGGG + Intronic
1165533706 19:36425394-36425416 CAGGAGTTGGAGGTTGCAGTAGG - Intergenic
1166309156 19:41952653-41952675 CAGTAGGTCAAGGCTGCAGTGGG - Intergenic
1166571887 19:43802275-43802297 CAGTAGTGAGAAGGGGCAGGTGG - Intronic
1167045732 19:47047770-47047792 CAGGAGTTCAAGGCTGCAGTGGG + Intronic
1167083924 19:47296218-47296240 CAGGAGTTCGAGTCTGCAGTTGG + Intronic
1167140563 19:47647882-47647904 CCGTAGTTCGCGGGGGGAGTGGG + Intronic
1167341688 19:48920215-48920237 CAGGAGTTTGAGGCTGCAGTGGG - Intronic
1167406952 19:49316961-49316983 CAGGAGTTCAAGGTTGCAGTGGG + Intronic
1167584112 19:50363634-50363656 CAGTAGTTCGAGGGGGCAGTGGG - Intronic
1168453366 19:56483926-56483948 CAGTAATGGGAGGGGGCAGGGGG - Intergenic
925989905 2:9246359-9246381 CAGGAGGTCGAGGCTGCAGTGGG - Intronic
927122190 2:19976268-19976290 TAGTAGTTAGAGGGGGAACTTGG - Intronic
927804501 2:26134187-26134209 CAGGAGTTCAAGGCTGCAGTGGG - Intronic
928155657 2:28874035-28874057 CAGGAGTTCGATGCTGCAGTAGG - Intergenic
928610774 2:32990029-32990051 CAGGAGTTTGAGGCTGCAGTGGG + Intronic
929249824 2:39740778-39740800 CAGGAGTTGGAGGCTGCAGTGGG - Intronic
929500725 2:42489314-42489336 CAGGAGTTCCAGGCTGCAGTGGG + Intronic
929631779 2:43470132-43470154 CAGGAGGTCGAGGCAGCAGTGGG + Intronic
929704455 2:44195601-44195623 CAGGAGTTCAAGGCTGCAGTGGG + Intronic
930077303 2:47417311-47417333 CAGAAGTTTGAGGCTGCAGTGGG + Intronic
930410342 2:51017407-51017429 CAGGAGTTCTAGGAGGCAGTGGG - Intronic
930760903 2:55034426-55034448 CAGGAGTTTGAGGCTGCAGTGGG + Intronic
931060752 2:58526700-58526722 CAGGAGTTTGAGGCTGCAGTGGG - Intergenic
931298621 2:60955401-60955423 CAGGAGTTTGAGGCTGCAGTGGG - Intronic
931524307 2:63135803-63135825 CAGGAGTTAGAGGCTGCAGTAGG - Intronic
931740962 2:65243553-65243575 CAGAAGTTTGAGGCTGCAGTGGG + Intronic
932195637 2:69780666-69780688 CAGGAGTTCGAGGCTGCAGAGGG + Intronic
932232679 2:70095578-70095600 CAGGAGTTTGAGGCTGCAGTGGG - Intergenic
932510965 2:72289811-72289833 CAGAAGATCGAGGCTGCAGTGGG + Intronic
933855715 2:86412324-86412346 CAGGAGTTCAAGGCTGCAGTGGG - Intergenic
934071304 2:88386212-88386234 CAGAAATTCGAGGCTGCAGTGGG + Intergenic
935267349 2:101406403-101406425 CAGGAGTTCAAGGCTGCAGTGGG - Intronic
935797190 2:106654674-106654696 CAGGAGTTCAAGGCTGCAGTGGG + Intergenic
935808825 2:106775282-106775304 CAGGAGTTCGAGGCTGCAGTAGG + Intergenic
937270222 2:120645154-120645176 CAGGAGTTCAAGGCTGCAGTGGG - Intergenic
937329065 2:121012413-121012435 CAGGAGTTTGAGGTTGCAGTGGG + Intergenic
940142551 2:150509277-150509299 CAGAAGTTTGAGGCTGCAGTGGG - Intronic
940943364 2:159588448-159588470 CAGGAGTTGGAGGCTGCAGTGGG + Intronic
940947109 2:159630247-159630269 CAGGAGTTCAAGGCTGCAGTGGG + Intergenic
941829144 2:169935237-169935259 CAGAAGTTGGAGGCTGCAGTGGG - Intronic
941889543 2:170564397-170564419 CAGGAGATGGAGGTGGCAGTGGG + Intronic
941930732 2:170936298-170936320 CAGGAGTTCAAGGCTGCAGTGGG - Intronic
942130269 2:172871835-172871857 CAGTAGTTCTGGGTGGCAGTTGG + Intronic
942441959 2:176046186-176046208 CAGTAGTTCAAGGCTGCAGTGGG + Intergenic
943667004 2:190619424-190619446 CAGGAGTTTGAGGTTGCAGTGGG + Intergenic
943694727 2:190913871-190913893 CAGGAGTTTGAGGCTGCAGTGGG - Intronic
945143887 2:206715746-206715768 TAGGAGTTCAAGGGGGCTGTAGG + Intronic
945590604 2:211725534-211725556 CAGTAGTTCAAAGATGCAGTGGG + Intronic
945953257 2:216060587-216060609 CAGGAGTTCAAGGTTGCAGTGGG + Intronic
946229813 2:218284302-218284324 CTGTTGTTAGAGGGGGCAGTGGG - Intronic
946242523 2:218365632-218365654 CAGGAGTTGGAGGCTGCAGTGGG - Intronic
947161581 2:227220531-227220553 CAGGAGTTGGAGGCTGCAGTTGG - Intronic
947650656 2:231783808-231783830 CAGGAGTTCGAGGTTGCAGTGGG - Intronic
1169084794 20:2820033-2820055 CAGTAATTAGAAGGGGCAGAAGG + Intronic
1169187491 20:3631014-3631036 CAGGAGTTTGAGGCTGCAGTGGG - Intronic
1170157744 20:13284133-13284155 CAGTAGATCGACAGGGCAGCTGG + Intronic
1170658536 20:18314476-18314498 CAGAATTTCTAGGAGGCAGTAGG - Intronic
1170684985 20:18561676-18561698 CAGGAGTTCAAGGTTGCAGTGGG + Intergenic
1171972636 20:31573584-31573606 CAGGAGGTCGAGGTTGCAGTGGG - Intronic
1172476094 20:35238946-35238968 CAGGAGTTGGAGGCTGCAGTGGG - Intronic
1172581662 20:36053175-36053197 CAGGAGTTGGAGGTTGCAGTGGG - Intergenic
1172844524 20:37921914-37921936 CAGGAGTTCAAGGCTGCAGTGGG - Intronic
1173473437 20:43341233-43341255 CAGGAGTTTGAGGCTGCAGTGGG - Intergenic
1173838425 20:46140378-46140400 AAGGAGTTGGAGGGGGCAGAGGG + Intergenic
1174337747 20:49875242-49875264 CAGGAGTTCAAGGCTGCAGTGGG + Intronic
1175161897 20:57014535-57014557 CAGGAGGTCGAGGCTGCAGTGGG - Intergenic
1175697514 20:61113695-61113717 CAGTAGGATGAGGGGGCAGAAGG - Intergenic
1176366253 21:6034535-6034557 CAGTGGTTCCTGGGGACAGTAGG - Intergenic
1177526418 21:22297160-22297182 CAGGAGTTCAAGGCTGCAGTGGG - Intergenic
1178110280 21:29363307-29363329 CAGTAGCTCCAGGGGACAGCTGG - Intronic
1179757264 21:43504010-43504032 CAGTGGTTCCTGGGGACAGTAGG + Intergenic
1180564751 22:16653282-16653304 CAGGAGTTTGAGGCTGCAGTGGG + Intergenic
1180663455 22:17489527-17489549 CAGGAGGTCGAGGCTGCAGTGGG - Intronic
1181643447 22:24217041-24217063 CAGGAGGTCGAGGCTGCAGTGGG + Intergenic
1182076882 22:27500958-27500980 CAGGAGTTCAAGGCTGCAGTAGG + Intergenic
1182118046 22:27768730-27768752 CAGGAGTTTGAGGCTGCAGTAGG + Intronic
1182136560 22:27909851-27909873 CAGGAGTTAGAGGTTGCAGTGGG - Intronic
1182159871 22:28110859-28110881 CAGAAGTTCGAGGCTGCAGTAGG + Intronic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1182679455 22:32067443-32067465 CAGGAGTTTGAGGCTGCAGTAGG - Intronic
1184126220 22:42489189-42489211 CAGGAGTCCGAGGCTGCAGTGGG + Intergenic
1184341839 22:43890597-43890619 CAGTGGTTCTGGGGGGCAGGCGG - Intronic
1185316714 22:50182468-50182490 CAGTAGTCCTTGGGGGCAGCCGG + Intergenic
950018715 3:9771099-9771121 CAGGAGTTTGAGGCTGCAGTGGG - Intronic
950406137 3:12806232-12806254 CAGGAGTTTGAGGCTGCAGTGGG + Intronic
951546855 3:23834653-23834675 CAGGAGTTTGAGGCTGCAGTGGG + Intronic
952309385 3:32174189-32174211 CAGGAGTTGGAGGCTGCAGTGGG - Intergenic
952456616 3:33478549-33478571 CAGCAGTTCAAGGCTGCAGTGGG + Intergenic
952485466 3:33805506-33805528 CAGGAGATCGAGGCTGCAGTAGG - Intronic
952876767 3:37951605-37951627 CAGGAGGTCGAGGCTGCAGTGGG + Intronic
953654336 3:44837132-44837154 CATCAGTTCTAGGGGACAGTTGG + Intronic
954007343 3:47602216-47602238 CAGGAATTCGAGGCTGCAGTGGG + Intronic
954819327 3:53312022-53312044 CAGGAGTTGGAGGCTGCAGTGGG - Intronic
954937848 3:54343363-54343385 CAGGAGGTCGAGGCTGCAGTGGG - Intronic
955184970 3:56706195-56706217 CAGGAGGTCGAGGCTGCAGTGGG - Intergenic
955214072 3:56970570-56970592 CAGGGGTTGGAGGGGGAAGTGGG - Intronic
955698633 3:61661144-61661166 CAGGAGTTTGAGGCTGCAGTAGG - Intronic
955760235 3:62272019-62272041 CAGTAGGTCAAGGCTGCAGTGGG + Intronic
956161418 3:66357338-66357360 CAGAAGTTGGAGGCTGCAGTGGG + Intronic
956186362 3:66566460-66566482 CAGGAGTTTGAGGCTGCAGTGGG - Intergenic
956456241 3:69423220-69423242 CAGGAGTTTGAGGCTGCAGTGGG - Intronic
956695361 3:71914228-71914250 CAGGAGTTGGAGGCTGCAGTGGG + Intergenic
957821947 3:85388100-85388122 CAGGAGGTCGAGGCTGCAGTAGG - Intronic
957978996 3:87483773-87483795 CAGGAGTTCCAGGTTGCAGTGGG - Intergenic
958991253 3:100848542-100848564 CAGAAGTTTGAGGCTGCAGTGGG - Intronic
959048867 3:101504989-101505011 CAGGAGGTCGAGGCTGCAGTGGG + Intronic
960757003 3:121025308-121025330 CAGTAGATTGAGGGAGTAGTTGG + Intronic
960831257 3:121851249-121851271 CAGGAGTTGGAGGCTGCAGTGGG - Intronic
961169464 3:124786326-124786348 CAGGAGTTTGAGGCTGCAGTAGG + Intronic
961669423 3:128518034-128518056 CAGTTGAGGGAGGGGGCAGTGGG + Intergenic
961793833 3:129395281-129395303 CAGGAGTTCAAGGGTGCAGCAGG + Intergenic
961800582 3:129445603-129445625 CAGTAATTCAAGGGAGCAGAAGG + Intronic
961972710 3:130987383-130987405 CAGGAGTTTGAGGTTGCAGTGGG - Intronic
962107028 3:132401118-132401140 CAGGAGTTCGAGGGTGCAGTAGG + Intergenic
962260551 3:133900635-133900657 CAGGAGTTTGAGGTTGCAGTGGG - Intergenic
963238740 3:142982059-142982081 CTGTAGTTGGAGGAGGTAGTAGG + Intronic
963511518 3:146253658-146253680 CAGGAGGTCGAGGCCGCAGTGGG - Intergenic
963618120 3:147569568-147569590 CAGCAGTTCCAGGCTGCAGTGGG + Intergenic
964589732 3:158347617-158347639 CAGGAGTTTGAGGTTGCAGTGGG - Intronic
964845288 3:161038383-161038405 CAGAAGTTTGAGGCTGCAGTGGG - Intronic
966310617 3:178589550-178589572 CAGGAGTTCGAGGGTACAGTGGG - Intronic
966555229 3:181251478-181251500 CAGTAGGTGGAGGTTGCAGTGGG - Intergenic
968094117 3:195916003-195916025 CAGCAGTTCGAGGCTGCAGTGGG + Intergenic
968167764 3:196481361-196481383 CAGGAGTTTGAGGTTGCAGTGGG + Intronic
968337949 3:197929695-197929717 CAGGAGTTCGAGGCTGCAGTGGG + Intronic
971198715 4:24492763-24492785 CAGGAGTTGGAGGGTGTAGTGGG - Intergenic
971290534 4:25334909-25334931 CAGGAGTTTGAGGGTACAGTGGG - Intronic
974672531 4:65050965-65050987 CAGTAGTTTGAAGGAGCAGAAGG - Intergenic
975585758 4:75946881-75946903 CAGGAGTTCAAGGCTGCAGTGGG + Intronic
975658231 4:76662806-76662828 TAGGAGTTCGAGGCTGCAGTAGG + Intronic
975851379 4:78576377-78576399 CAGGAGTTTGAGGCTGCAGTGGG - Intronic
976073593 4:81271411-81271433 CAGTAGGTGGAGGCTGCAGTGGG + Intergenic
976250944 4:83051349-83051371 CAGTAATTTGAGGCTGCAGTGGG + Intronic
976349808 4:84048676-84048698 CAGGAGTTGGAGGTTGCAGTGGG - Intergenic
976419420 4:84822636-84822658 CAGGAGTTTGAGGTTGCAGTGGG + Intronic
976654164 4:87470025-87470047 CAGCAGTTCGAGGGTACAGGAGG - Intergenic
977381790 4:96283801-96283823 CAGTAGTTCAAGATTGCAGTGGG - Intergenic
977912937 4:102558722-102558744 CAGAAGTTCAAGGTGGCATTGGG - Intronic
979541612 4:121890150-121890172 CAGAAGTTGGAGAGGGCAGGGGG + Intronic
980177263 4:129361938-129361960 CAGAAGTTCAAGGGCACAGTGGG + Intergenic
980750537 4:137081315-137081337 CAGGAGTTCGAGGCTGCAGATGG - Intergenic
980940318 4:139268041-139268063 CAGGAGTTCAAGGCTGCAGTAGG + Intronic
981556017 4:145995372-145995394 CAGGAGTTCTAGGTGGCAGTGGG - Intergenic
983255732 4:165397976-165397998 CAGGAGTTGGAGGCTGCAGTGGG + Intronic
984076658 4:175189997-175190019 CAGGAGTTCAAGGCTGCAGTGGG + Intergenic
987809110 5:22810807-22810829 CAGAAGTTTGAGAGTGCAGTGGG + Intronic
989075450 5:37560883-37560905 CAGGAGTTCAAGGCTGCAGTGGG - Intronic
989623816 5:43410622-43410644 CAGCAGGTCGAGGAGGCAGAGGG - Intronic
990041057 5:51379068-51379090 TAGGAGTTCTAGGGGGCAGGGGG + Intergenic
990800639 5:59598868-59598890 CAGGAGTTCAAGGCTGCAGTGGG + Intronic
990937423 5:61165133-61165155 CAGGAGTTCGAAGAGGCAGTGGG - Intergenic
990978043 5:61576043-61576065 CAGGAGTTCGAGGCTGCAGTGGG + Intergenic
991308140 5:65203313-65203335 CAGGAGTTCTAGGCTGCAGTGGG + Intronic
991913563 5:71584676-71584698 CAGGAGTTTGAGGCTGCAGTGGG - Intergenic
992053134 5:72959432-72959454 CAGGAGTTCAAGGTTGCAGTAGG + Intronic
992441133 5:76798588-76798610 CAGGAGTTCGAGGTTGCAGTGGG + Intergenic
992732180 5:79683068-79683090 CAGGAGTTCGAGGCTGCAGTGGG + Intronic
992973193 5:82083589-82083611 CAGTTGTATGAGGGGTCAGTTGG - Intronic
993704326 5:91152738-91152760 CAGAAGTTTGAGGCTGCAGTGGG - Intronic
994358611 5:98824579-98824601 CAGGAGTTCGAGGCTGCAGAAGG - Intergenic
995886404 5:116899549-116899571 CAGTAGTTCAAGGTTGCAGTGGG - Intergenic
998227007 5:140334899-140334921 CAGGAGTTCCTCGGGGCAGTTGG - Intronic
998232404 5:140369223-140369245 CAGGAGTTTGAGAGTGCAGTAGG + Intronic
998353107 5:141513781-141513803 CAGTGCTTCGAGGAGGCAGGCGG - Intergenic
998363126 5:141608228-141608250 CAGGAGTTCCAGGCTGCAGTGGG + Intronic
998395136 5:141813355-141813377 CAGGAGGTCGAGGCTGCAGTAGG - Intergenic
999452866 5:151691506-151691528 GAGTGGTTGGAGAGGGCAGTGGG - Intergenic
999714307 5:154347435-154347457 CAGGAGTTTGAGGCTGCAGTGGG - Intronic
999775261 5:154807622-154807644 CAATAGTTCGAGACTGCAGTGGG - Intronic
1001658021 5:173368970-173368992 CAGGAGTTTGAGGCTGCAGTGGG - Intergenic
1001735988 5:174002025-174002047 CAGGAGTTAGAGGCAGCAGTGGG - Intronic
1001936136 5:175707354-175707376 CAGGAGTTAGAGGTTGCAGTGGG + Intergenic
1002013028 5:176299317-176299339 CAGGAGTTCTAGGCTGCAGTAGG + Intronic
1002072613 5:176689244-176689266 CAGGAGTTCAAGGCTGCAGTGGG + Intergenic
1002278421 5:178117535-178117557 TAGGAGTTCGAGGCTGCAGTGGG + Intronic
1002965151 6:1957874-1957896 CAGGAGTTCGAGGCTGCAGTGGG - Intronic
1002984028 6:2170551-2170573 CAGGAGTTCAAGGTTGCAGTGGG + Intronic
1003073711 6:2964908-2964930 CAGGAGTTCGAGGCTGCAGTGGG - Intronic
1003342664 6:5236881-5236903 CAGGAGGTCGAGGTTGCAGTGGG + Intronic
1004194369 6:13489922-13489944 CAGGAGTTCAAGGCTGCAGTGGG + Intergenic
1004459559 6:15823053-15823075 CAGGAGTTCAAGGCTGCAGTGGG - Intergenic
1004633396 6:17443176-17443198 CAGGAGTTCTAGGCTGCAGTGGG + Intronic
1004655011 6:17651227-17651249 CAGGAGTTCGAGGCTGTAGTGGG + Intronic
1004658868 6:17691883-17691905 CAGGAGTTTGAGGCTGCAGTGGG - Intronic
1004770706 6:18777878-18777900 CAGGAGGTCGAGGCTGCAGTGGG + Intergenic
1004905279 6:20232178-20232200 CAGGAGTTTGAGGCTGCAGTGGG + Intergenic
1005296957 6:24436180-24436202 CAGGAGTTTGAGGCTGCAGTGGG + Intronic
1005870860 6:29973849-29973871 CAGTGGTTCCAGGGGCCAGGGGG + Intergenic
1006006055 6:31002455-31002477 CAGGAGTTAGAGGCTGCAGTGGG + Intergenic
1006775343 6:36588097-36588119 CAGGAGTTCGAGGCTGCAGTGGG - Intergenic
1007490727 6:42219683-42219705 CAGGAGTTTGAGGCTGCAGTGGG - Intergenic
1007586400 6:42992746-42992768 CAGGAGTTCAAGGCTGCAGTGGG + Intronic
1007993660 6:46283367-46283389 CAGGAGATCGAGGTTGCAGTGGG + Intronic
1008448662 6:51623655-51623677 CAGGAGGTGGAGGGCGCAGTGGG - Intronic
1008622659 6:53286487-53286509 CAGGAGTTCTAGGCTGCAGTGGG + Intronic
1009573822 6:65426047-65426069 CAGGAGTTTGAGGCTGCAGTGGG - Intronic
1010167829 6:72938451-72938473 CAGGAGTTGGAGGTTGCAGTGGG - Intronic
1010670122 6:78676691-78676713 CAGTTGTTTGAGGTGTCAGTCGG - Intergenic
1010873975 6:81078306-81078328 CAGGAGTTCAAGGCTGCAGTTGG - Intergenic
1011283676 6:85702342-85702364 CAGGAGGTCGAGGTTGCAGTGGG - Intergenic
1011446602 6:87448227-87448249 CAGGAGTTTGAGGCTGCAGTGGG - Intronic
1011945069 6:92890657-92890679 CAGTGGTTCCAGGGTCCAGTGGG - Intergenic
1013129183 6:107215316-107215338 CAGGAGTTCAAGGCTGCAGTGGG + Intronic
1013240842 6:108244227-108244249 CAGGAGGTCGAGGTTGCAGTAGG - Intronic
1014254335 6:119146502-119146524 CAGGAGTTCAAGGCTGCAGTGGG - Intronic
1014284040 6:119476395-119476417 TGGTAGTCCGAGGGGGCAGCTGG - Intergenic
1014408775 6:121088022-121088044 CAGGAGGTCGAGGCCGCAGTGGG - Intronic
1014783484 6:125591525-125591547 CAGGAGTTCAAGGCTGCAGTGGG - Intergenic
1014843416 6:126246171-126246193 CAGGAGATCGAGGCTGCAGTGGG + Intergenic
1015055891 6:128902730-128902752 CAGTAGTTCAAGGCTGCAGTGGG - Intronic
1015592873 6:134839228-134839250 CAGTACTTCCATAGGGCAGTGGG - Intergenic
1015763727 6:136692880-136692902 CAGGAGGTGGAGGTGGCAGTGGG + Intronic
1016061914 6:139639248-139639270 CAGGAGTTTGAGGCTGCAGTGGG + Intergenic
1016958519 6:149649544-149649566 CAGGAGTTGGAGGCTGCAGTGGG + Intergenic
1017539277 6:155383460-155383482 CAGGAGTTGGAGGCTGCAGTAGG + Intergenic
1017650939 6:156582074-156582096 CAGGAGTTTGAGGCTGCAGTGGG - Intergenic
1019671434 7:2281902-2281924 CTGTCGTTCGAGGGGCCTGTGGG - Intronic
1019787204 7:2984625-2984647 CAGGAGTTCAAGGCTGCAGTGGG - Intronic
1019791375 7:3016022-3016044 CAGGAGTTCAAGGCTGCAGTAGG + Intronic
1021534225 7:21684708-21684730 AAGTATTTCAAGGGGGCAGGAGG + Intronic
1021539961 7:21746527-21746549 CAGGAGTTCGAGGTTGCAGTGGG + Intronic
1022495049 7:30847811-30847833 CAGGAGTTGGAGGCTGCAGTGGG - Intronic
1023737423 7:43247562-43247584 CAGGAGTTAGAGGCTGCAGTGGG + Intronic
1023776613 7:43613768-43613790 CAGGAGTTCGAGGCTGCAGTGGG + Intronic
1024471491 7:49772181-49772203 CAGGAGTTTGAGGCTGCAGTGGG + Intergenic
1025825918 7:65010394-65010416 CAGGAGTTCTAGGCTGCAGTGGG - Intergenic
1025898909 7:65728179-65728201 CAGGAGTTCTAGGCTGCAGTGGG - Intergenic
1026098806 7:67368072-67368094 CAGGAGTTCAAGGCTGCAGTGGG + Intergenic
1026409640 7:70106644-70106666 CAGGAGTTCAAGGCTGCAGTGGG + Intronic
1026502953 7:70958465-70958487 CAGGAGTTGGAGGCTGCAGTGGG - Intergenic
1026534274 7:71227288-71227310 CAGGAGTTCAAGGCTGCAGTGGG + Intronic
1026593231 7:71713775-71713797 CAGGAGTTTGAGGCTGCAGTGGG - Intergenic
1026739805 7:72971959-72971981 CAGGAGTTTGAGGCTGCAGTGGG - Intergenic
1026797074 7:73373130-73373152 CAGGAGTTCGAGGCTGCAGTGGG - Intergenic
1027103927 7:75393111-75393133 CAGGAGTTTGAGGCTGCAGTGGG + Intergenic
1027251204 7:76399915-76399937 CAGGAGTTTGAGGCTGCAGTGGG + Intronic
1027355952 7:77355861-77355883 CAGGAGTTTGAGGCTGCAGTGGG - Intronic
1028475595 7:91249859-91249881 CAGCAGTTGGAGGCTGCAGTGGG + Intergenic
1029237288 7:99131641-99131663 CAGGAGTTTGAGGCTGCAGTGGG + Intronic
1030242893 7:107348933-107348955 CAGGAGTTCGAGTCTGCAGTGGG - Intronic
1030573700 7:111259562-111259584 CAGGAGTTCAAGGATGCAGTGGG + Intronic
1030636226 7:111952207-111952229 CAGTAGTTCAACTGAGCAGTTGG - Intronic
1031500471 7:122508536-122508558 CAGGAGTTCAAGGCTGCAGTAGG - Intronic
1031774914 7:125896213-125896235 CAGGAGGTCGAGGCTGCAGTGGG - Intergenic
1032703723 7:134404378-134404400 CAGGAGGTCGAGGCTGCAGTGGG + Intergenic
1033373782 7:140736974-140736996 CAGGAGTTTGAGGCTGCAGTGGG + Intronic
1034488432 7:151380649-151380671 CAGGGGCTCGAGGGGCCAGTGGG - Intronic
1037570159 8:20151043-20151065 CAGGAGGTCGAGGCTGCAGTGGG - Intronic
1038197540 8:25382085-25382107 CAGGAGTTCAAGGTTGCAGTGGG - Intronic
1038540953 8:28389638-28389660 CAGAAGTTGGAGGCTGCAGTGGG + Intronic
1039210522 8:35207431-35207453 CAGGAGTTCGAGGCTACAGTGGG + Intergenic
1039855885 8:41413674-41413696 CAGGAGTTTGAGGGTACAGTGGG - Intergenic
1041061372 8:54037830-54037852 CAGGAGTTCGAGGCTGCACTGGG + Intergenic
1042178714 8:66062934-66062956 CAGGAGTTTGAGGCTGCAGTAGG + Intronic
1042248869 8:66736529-66736551 CAGGAGTTCAAGGCTGCAGTGGG - Intronic
1042445711 8:68883185-68883207 CAGGAGTTTGAGGCTGCAGTGGG + Intergenic
1042491666 8:69406257-69406279 CAGGAGTTGGAGGTAGCAGTGGG + Intergenic
1043229353 8:77781325-77781347 CAGGAGTTCCAGGCTGCAGTGGG - Intergenic
1044482696 8:92711272-92711294 CAGAAGTTAGAGGCTGCAGTGGG + Intergenic
1044665619 8:94631908-94631930 CAGGAGGTCGAGGCTGCAGTAGG - Intergenic
1045616078 8:103913358-103913380 CAGGAGTTCGAGGTTACAGTGGG + Intronic
1046750220 8:117919257-117919279 CAGGAGTTCGAGGCTACAGTGGG - Intronic
1046754893 8:117962850-117962872 CAGGAGTTCAAGGCTGCAGTGGG + Intronic
1047393164 8:124470804-124470826 CTGTAGTGGGAGGAGGCAGTAGG - Intergenic
1047488699 8:125356400-125356422 CAGAAGTTGGAGGTTGCAGTGGG - Intronic
1047582809 8:126235441-126235463 CAGGAGGTCGAGGCTGCAGTGGG - Intergenic
1048328879 8:133458957-133458979 TAGGAGTTCGAGGCTGCAGTGGG - Exonic
1048883598 8:138890520-138890542 CAGGAGTTCAAGGCTGCAGTAGG - Intronic
1049647868 8:143744277-143744299 CACAAGTTCCAGGGGGCAGGAGG + Intergenic
1049863707 8:144919441-144919463 CAGGAGGTGGAGGGTGCAGTGGG - Intergenic
1050350475 9:4736749-4736771 CAGGAGTTCGAGGCTGCAGTGGG - Intronic
1052993391 9:34535973-34535995 GAGTAGTTCCAGTGGGCAGTAGG + Intergenic
1053316553 9:37056971-37056993 CAGGAGTTGGAGGTTGCAGTGGG - Intergenic
1055083814 9:72293848-72293870 CAGGAGTTCGAGGCTGCAGTGGG + Intergenic
1056117669 9:83456904-83456926 CAGAAGGTCGAGGCTGCAGTGGG + Intronic
1056724944 9:89106535-89106557 CAGTAGTGAGGGGAGGCAGTCGG + Intronic
1057862570 9:98653068-98653090 CAGGAGTTCGAGGCTGCAGTGGG - Intronic
1057985420 9:99708576-99708598 CAGGAGTTCGAGGCTGCAGTGGG + Intergenic
1058006023 9:99915664-99915686 CAGAAGTTTGAGGTTGCAGTAGG - Intronic
1058911767 9:109526599-109526621 CAGTAGGTTGAGGCTGCAGTGGG + Intergenic
1059098664 9:111447196-111447218 TAGGAGTTCGAGGCTGCAGTTGG - Intronic
1060254978 9:122019521-122019543 CAGGAGGTCGAGGCTGCAGTGGG - Intronic
1060431445 9:123554294-123554316 CAGGAGTTTGAGGCTGCAGTAGG - Intronic
1060573867 9:124670316-124670338 CAGGAGTTGGAGGCTGCAGTGGG + Intronic
1060841996 9:126801073-126801095 CAGGAGTTTGAGGCTGCAGTGGG - Intergenic
1060898113 9:127232380-127232402 CAGGAGTTCAAGGCTGCAGTGGG - Intronic
1061114360 9:128599590-128599612 CAAGAGTTCGAGGCTGCAGTAGG - Intronic
1062222039 9:135421759-135421781 CAGGAGTCGGAGGGTGCAGTGGG - Intergenic
1062558568 9:137128868-137128890 CAGGAGGTCGAGGCCGCAGTGGG + Intergenic
1185630228 X:1511591-1511613 CAGGAGTTGGAGGCTGCAGTGGG - Intronic
1186225808 X:7397769-7397791 CAGGAGTTGGAGGCTGCAGTGGG - Intergenic
1187152825 X:16696629-16696651 CAGAAGTTTGAGGCTGCAGTGGG + Intronic
1187352521 X:18533925-18533947 CAAGAGTTCTAGGGGCCAGTGGG - Intronic
1187428929 X:19203872-19203894 CAGGAGTTAGAGGTTGCAGTGGG - Intergenic
1188205388 X:27349918-27349940 CAGGAGTTCGAGGCTGTAGTGGG + Intergenic
1189338056 X:40182694-40182716 CAGGAGTTCAAGGTTGCAGTGGG - Intergenic
1189502153 X:41572156-41572178 CAGGAGTTCGAGGATGCAGTGGG - Intronic
1189919165 X:45886595-45886617 CAGGAGTTTGAGGTTGCAGTGGG + Intergenic
1190166351 X:48075839-48075861 CAGGACTTCGAGGCTGCAGTGGG + Intergenic
1192022043 X:67403889-67403911 CAGTAGTTTGCTGGGGGAGTGGG + Intergenic
1192480414 X:71480319-71480341 CAGGAGTTTGAGGTTGCAGTGGG + Intronic
1192736787 X:73856747-73856769 CAGTAGTTCAAGGATACAGTGGG + Intergenic
1193660995 X:84258191-84258213 CAGGAGTTCGAGGCTGCAGTGGG + Intergenic
1194707496 X:97193084-97193106 CAGGAGGTCGAGGCTGCAGTGGG - Intronic
1195725281 X:107908786-107908808 CAGGAGTTCAAGGGTACAGTGGG + Intronic
1195996132 X:110733393-110733415 GAGTAGTCTGTGGGGGCAGTTGG - Intronic
1196419100 X:115504899-115504921 CAGGAGTTTGAGGTTGCAGTGGG - Intergenic
1197651192 X:129066374-129066396 CAGGAGGTCGAGGCTGCAGTGGG + Intergenic
1199965271 X:152814760-152814782 CAGTAGTTCCAGGGGCCCCTAGG - Intergenic
1200311682 X:155084894-155084916 CAGGAGTTGGAGGTGGCAGTGGG + Intronic
1201320078 Y:12688825-12688847 CAGGAATTCGAGGTTGCAGTGGG - Intergenic
1201441243 Y:14010639-14010661 CAGGAGTTCAAGGCTGCAGTGGG + Intergenic
1201443328 Y:14032069-14032091 CAGGAGTTCAAGGCTGCAGTGGG - Intergenic
1201490571 Y:14536832-14536854 CAGTAGTTTGAGGCTGCAGTAGG + Intronic
1202102899 Y:21329313-21329335 CAGAAGGTGGAGGTGGCAGTGGG + Intergenic
1202601156 Y:26594242-26594264 CAGGAGTTTGAGGCTGCAGTGGG + Intergenic