ID: 1167585953

View in Genome Browser
Species Human (GRCh38)
Location 19:50376020-50376042
Sequence CACTCCAGCCTCTGCGTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171153
Summary {0: 1, 1: 10, 2: 2642, 3: 40000, 4: 128500}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167585953_1167585955 9 Left 1167585953 19:50376020-50376042 CCCAGGACGCAGAGGCTGGAGTG 0: 1
1: 10
2: 2642
3: 40000
4: 128500
Right 1167585955 19:50376052-50376074 CACACCACTGCACTCCAGTCTGG 0: 884
1: 24317
2: 81542
3: 175694
4: 204444
1167585953_1167585956 10 Left 1167585953 19:50376020-50376042 CCCAGGACGCAGAGGCTGGAGTG 0: 1
1: 10
2: 2642
3: 40000
4: 128500
Right 1167585956 19:50376053-50376075 ACACCACTGCACTCCAGTCTGGG 0: 892
1: 25374
2: 107217
3: 199260
4: 215289
1167585953_1167585957 11 Left 1167585953 19:50376020-50376042 CCCAGGACGCAGAGGCTGGAGTG 0: 1
1: 10
2: 2642
3: 40000
4: 128500
Right 1167585957 19:50376054-50376076 CACCACTGCACTCCAGTCTGGGG 0: 53
1: 1868
2: 4815
3: 6520
4: 5736

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167585953 Original CRISPR CACTCCAGCCTCTGCGTCCT GGG (reversed) Intronic
Too many off-targets to display for this crispr