ID: 1167585955

View in Genome Browser
Species Human (GRCh38)
Location 19:50376052-50376074
Sequence CACACCACTGCACTCCAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 486881
Summary {0: 884, 1: 24317, 2: 81542, 3: 175694, 4: 204444}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167585953_1167585955 9 Left 1167585953 19:50376020-50376042 CCCAGGACGCAGAGGCTGGAGTG 0: 1
1: 10
2: 2642
3: 40000
4: 128500
Right 1167585955 19:50376052-50376074 CACACCACTGCACTCCAGTCTGG 0: 884
1: 24317
2: 81542
3: 175694
4: 204444
1167585954_1167585955 8 Left 1167585954 19:50376021-50376043 CCAGGACGCAGAGGCTGGAGTGA 0: 1
1: 23
2: 4170
3: 62700
4: 125109
Right 1167585955 19:50376052-50376074 CACACCACTGCACTCCAGTCTGG 0: 884
1: 24317
2: 81542
3: 175694
4: 204444

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167585955 Original CRISPR CACACCACTGCACTCCAGTC TGG Intronic
Too many off-targets to display for this crispr