ID: 1167585957

View in Genome Browser
Species Human (GRCh38)
Location 19:50376054-50376076
Sequence CACCACTGCACTCCAGTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 18992
Summary {0: 53, 1: 1868, 2: 4815, 3: 6520, 4: 5736}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167585954_1167585957 10 Left 1167585954 19:50376021-50376043 CCAGGACGCAGAGGCTGGAGTGA 0: 1
1: 23
2: 4170
3: 62700
4: 125109
Right 1167585957 19:50376054-50376076 CACCACTGCACTCCAGTCTGGGG 0: 53
1: 1868
2: 4815
3: 6520
4: 5736
1167585953_1167585957 11 Left 1167585953 19:50376020-50376042 CCCAGGACGCAGAGGCTGGAGTG 0: 1
1: 10
2: 2642
3: 40000
4: 128500
Right 1167585957 19:50376054-50376076 CACCACTGCACTCCAGTCTGGGG 0: 53
1: 1868
2: 4815
3: 6520
4: 5736

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167585957 Original CRISPR CACCACTGCACTCCAGTCTG GGG Intronic
Too many off-targets to display for this crispr