ID: 1167588324

View in Genome Browser
Species Human (GRCh38)
Location 19:50387711-50387733
Sequence TGATCTGCGAGGAGAGACCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 132}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167588324_1167588327 -2 Left 1167588324 19:50387711-50387733 CCCGGGTCTCTCCTCGCAGATCA 0: 1
1: 0
2: 0
3: 13
4: 132
Right 1167588327 19:50387732-50387754 CATCACTCCCTGTCCCTCTCTGG 0: 1
1: 0
2: 1
3: 23
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167588324 Original CRISPR TGATCTGCGAGGAGAGACCC GGG (reversed) Intronic
901927116 1:12573279-12573301 GGAGCTGGGAGGAGAGAGCCAGG - Intronic
905803871 1:40862200-40862222 TGCTCTGCGGCGGGAGACCCGGG + Exonic
906000652 1:42421558-42421580 TGATCTGCAAGGGGAGAGCTGGG + Exonic
908632483 1:66124994-66125016 TGAGCTGCCAGGATAGACTCTGG + Intronic
910102456 1:83593617-83593639 TGCTCTGAAAGGAGAGACCCAGG - Intergenic
1065178352 10:23100256-23100278 AGATCTGGGAGGAGGAACCCAGG + Intronic
1067006998 10:42673660-42673682 TGAGTTGCTAGGAGAGACTCCGG + Intergenic
1068952421 10:62790606-62790628 TGATCACCTAGGAGGGACCCAGG + Intergenic
1069799233 10:71071983-71072005 TGATCTGGGAGGAGAGTGGCTGG + Intergenic
1070452523 10:76576285-76576307 TGATCTGTGAAAAGAGGCCCTGG - Intergenic
1074852473 10:117449717-117449739 CCATCTGGGAGGAGAGACTCAGG + Intergenic
1075129434 10:119725882-119725904 GGAGCTGGGAGGAGACACCCGGG + Intergenic
1081212562 11:40354710-40354732 TGTCCTGAAAGGAGAGACCCAGG - Intronic
1081958928 11:47119182-47119204 TGATCTGCGAGGCGGCAGCCTGG - Intronic
1083431277 11:62614683-62614705 TGATGCGGGAGGAGAGACCCAGG + Exonic
1085351101 11:75798280-75798302 TGATCTTCGAGGAGGGCTCCTGG + Exonic
1096580156 12:52579887-52579909 GGATCAGAGAGGAAAGACCCTGG - Intergenic
1096837594 12:54360934-54360956 TGACCAGGGAGTAGAGACCCAGG - Intergenic
1098074042 12:66707571-66707593 TGAAGTGCTAGGAGAGACCAAGG - Intronic
1098563861 12:71908862-71908884 TGGTCTGGGAGTAGAGACCCAGG + Intronic
1101422893 12:104564012-104564034 AGATCTACGTGGAGACACCCAGG + Intronic
1102572851 12:113838112-113838134 TGAGCTGCCAGGAGAGGCTCTGG - Intronic
1104203226 12:126612435-126612457 TGATCTGGGTGAAGAAACCCTGG - Intergenic
1104252585 12:127109487-127109509 TGCTCTGTGAGGAGAGACCTGGG + Intergenic
1105811778 13:24001826-24001848 TGATCTGTGGGGAGAGGCTCCGG + Intronic
1105869506 13:24491727-24491749 TGAGCTGCCAGGAGAGAAGCAGG - Intronic
1107830651 13:44372206-44372228 TGATCTGAGAGGAGTGAGTCAGG + Intergenic
1112097256 13:96147718-96147740 TGAGCTGCAGGGAGAGACTCTGG + Intronic
1116275559 14:42827405-42827427 TGCCCTGAGAGGAGAGACCCAGG - Intergenic
1116401765 14:44515885-44515907 TGACCTGCGAGGTGACAGCCTGG - Intergenic
1118262420 14:64260024-64260046 TGGTCTGGGAGGATGGACCCAGG - Intronic
1119882443 14:78111492-78111514 TGATCAGAGAGAAGAGAGCCTGG - Intergenic
1121591061 14:95110288-95110310 TGAGCTGCCAGGATAGACTCTGG - Intronic
1121646092 14:95517532-95517554 TGACCTGGGAGGAGAGCGCCAGG - Exonic
1125728050 15:41878122-41878144 TACACTTCGAGGAGAGACCCAGG - Intronic
1125835385 15:42746056-42746078 TGAGCTTCGAGGAGAGGCACTGG + Exonic
1126856998 15:52848304-52848326 TGATATCAGAGGAGAGACGCTGG - Intergenic
1128087936 15:64898572-64898594 TGACCTGCAAGGAGGGAGCCAGG + Intronic
1132630897 16:916862-916884 GGATCTGCGAGGGGACACCCGGG - Intronic
1134055791 16:11169020-11169042 TGAGCTTGGAGGAGAGGCCCTGG - Intronic
1134159840 16:11878724-11878746 TGACCTGAGAGGAGATACACGGG + Intronic
1134685147 16:16153286-16153308 TTATCTGCCAGTAGATACCCAGG - Intronic
1135093396 16:19540401-19540423 TGATCTGAAATGACAGACCCAGG - Intronic
1135133532 16:19871698-19871720 TGATCTGCTAGGACTGCCCCAGG + Intronic
1135250514 16:20897790-20897812 TTATCTGCCAGAAAAGACCCAGG + Intronic
1136588558 16:31202935-31202957 TGGCCTGCGAGGTGGGACCCGGG + Exonic
1137057708 16:35753394-35753416 TGAACTGCTTGGAGAGACCAGGG + Intergenic
1139664947 16:68448651-68448673 TGGTCTTGAAGGAGAGACCCAGG - Exonic
1143126543 17:4644887-4644909 TGATGGGAGAGGAAAGACCCAGG + Intergenic
1143748953 17:9014421-9014443 GGATCTGAAAGGAAAGACCCTGG - Intergenic
1144274608 17:13653593-13653615 TGATCTGTGAGAAGTGACCCAGG + Intergenic
1145751990 17:27361724-27361746 TGGTTTGAGAGGAGAGACCCAGG - Intergenic
1148048632 17:44758845-44758867 CGAGGTGCGAGGAGGGACCCCGG + Intergenic
1148496261 17:48054997-48055019 TGGTCTGCGAGATGAGCCCCAGG - Intronic
1150839677 17:68596105-68596127 TGATTTTCAAAGAGAGACCCAGG + Intronic
1150913598 17:69413680-69413702 TCACCTGGGAGGAGAGTCCCTGG - Intergenic
1152103503 17:78316111-78316133 GGCTCTGGGAGGAGAGACCTAGG - Intergenic
1156629163 18:38945843-38945865 TGATCTGTGATGAGTGACCTTGG + Intergenic
1157891826 18:51425460-51425482 TGAACTGGGAGGCGAGCCCCAGG + Intergenic
1162439010 19:10681200-10681222 TGAACTGCAAGGAGAGACCAGGG - Exonic
1162705109 19:12549775-12549797 TCCTCTGGGAGGAGTGACCCAGG + Intronic
1167588324 19:50387711-50387733 TGATCTGCGAGGAGAGACCCGGG - Intronic
1167887353 19:52512710-52512732 TGTTCTGCAAGGAGTGACCTCGG - Intergenic
1167892806 19:52555990-52556012 TGTTCTGCAAGGAGTGACCTCGG - Exonic
1167918913 19:52765201-52765223 TGTTCTGCAAGGAGTGACCTCGG + Exonic
1167928133 19:52839565-52839587 TGGTCTGCAAGGAGTGACCTTGG + Exonic
1168105903 19:54165563-54165585 CGAGCTGAGAGGGGAGACCCGGG + Exonic
925358042 2:3256393-3256415 TGATCTCCACGGGGAGACCCAGG - Intronic
931811132 2:65856238-65856260 TGACATTCGAGCAGAGACCCAGG + Intergenic
932889522 2:75579914-75579936 TGCTCTGAGGGGAGAGACCCAGG + Intergenic
933151613 2:78921987-78922009 TGATCTGCTGGGATAGGCCCTGG + Intergenic
935361086 2:102246765-102246787 TCATATCTGAGGAGAGACCCTGG + Intergenic
937223352 2:120354361-120354383 CGTTCTGCGGGGAGAGGCCCTGG + Intergenic
942871858 2:180744260-180744282 TGATCTGGCAGGAGAGAACAGGG + Intergenic
943965599 2:194328149-194328171 TCAGCTGAGAGGAGAGACACAGG - Intergenic
944158429 2:196633761-196633783 TGAGCTGCGGGGATAGACTCTGG + Intergenic
944461029 2:199950731-199950753 TGAGCTGCCAGGAGAGACTCTGG + Intronic
948857813 2:240738365-240738387 TGAAAGTCGAGGAGAGACCCCGG - Intronic
1168837895 20:890065-890087 TCATCAGGGAGGAGGGACCCGGG + Intronic
1172954862 20:38748835-38748857 TCACCTGTGAGGAGACACCCAGG - Exonic
1173593116 20:44240764-44240786 TGTTCAGGGAGGAGAGACACTGG + Intergenic
1173876666 20:46376577-46376599 TGATCAGCTAGGACAGACCGAGG - Intronic
1174766837 20:53262769-53262791 TGATCTTCCAGGAGAGAGTCGGG - Intronic
1175689843 20:61057354-61057376 CCATCTGCGAGAACAGACCCTGG + Intergenic
1176386283 21:6139956-6139978 TGACCTGGGGGGAGACACCCTGG + Intergenic
1179737190 21:43398296-43398318 TGACCTGGGGGGAGACACCCTGG - Intergenic
1180170414 21:46055386-46055408 TGAGCTGGGAGGCGAGGCCCTGG + Intergenic
1180198069 21:46209120-46209142 TGATCTGGCAGGAGGGACCGGGG + Intronic
1181478310 22:23181653-23181675 TGCTCTCCGAGGAGCGTCCCCGG - Exonic
1185113462 22:48917717-48917739 ACATCTGGGAGCAGAGACCCAGG + Intergenic
950667233 3:14505076-14505098 GGATTTGCCAGGAGAGACCAGGG + Intronic
953672390 3:44974441-44974463 TGCTCAGAAAGGAGAGACCCTGG - Intronic
954461405 3:50629077-50629099 TGATCTTAGGGGAGCGACCCTGG - Intronic
954479706 3:50787550-50787572 TGACCTGTGAGAAGTGACCCAGG - Intronic
954846793 3:53566402-53566424 TGACATTCGAGCAGAGACCCAGG - Intronic
961404109 3:126666845-126666867 TGCTCTGTGAGCAGGGACCCCGG + Intergenic
962015191 3:131431867-131431889 TTCCCTGAGAGGAGAGACCCAGG + Intergenic
962903254 3:139779126-139779148 TGAGGTACGAGGAGAGATCCCGG + Intergenic
963701446 3:148631037-148631059 TGCCCTGAGGGGAGAGACCCAGG + Intergenic
965540235 3:169864740-169864762 TGATCTGTGAGGAGATGTCCAGG - Intronic
966946043 3:184777703-184777725 TGACCCTGGAGGAGAGACCCAGG - Intergenic
968969809 4:3787945-3787967 TGATCTGCCTGGAGAAAGCCCGG - Intergenic
972369895 4:38413104-38413126 TGGGCTGGGAGGAGAGGCCCAGG - Intergenic
976210916 4:82668880-82668902 TCATCTCAAAGGAGAGACCCTGG - Intronic
979215225 4:118155459-118155481 TGAACTGCCAGGATAGGCCCTGG + Intronic
982563700 4:156962950-156962972 TGATCTGCCAGGAAGGACCTGGG - Intronic
986370232 5:7072952-7072974 TGATCTGAGAGGAAAAACGCTGG - Intergenic
988662260 5:33284434-33284456 TGAGCTGGGAGTAGAGACTCTGG - Intergenic
994931707 5:106196051-106196073 TGATCTTTGTTGAGAGACCCTGG - Intergenic
1002484337 5:179524154-179524176 TGATCTGGGAGGGGAGATCACGG + Intergenic
1003278226 6:4670527-4670549 TGAGGTGGGAGGAGAGACCTAGG + Intergenic
1005456192 6:26021827-26021849 TGATCTACGAGGAGACTCGCGGG + Exonic
1005830999 6:29671030-29671052 TGATCTGAGAGGTGAGGCACTGG - Intronic
1006462938 6:34174404-34174426 TGCCCTGGGAGGAGAGACCTGGG - Intergenic
1007305353 6:40899666-40899688 TGTTATGGGAGAAGAGACCCTGG + Intergenic
1011023950 6:82845734-82845756 CGCTCTGAAAGGAGAGACCCAGG + Intergenic
1012961442 6:105626244-105626266 TGCTCTGAAAGGAGAGATCCTGG + Intergenic
1013169586 6:107624497-107624519 TGATCTGTGCTGGGAGACCCTGG + Intronic
1017054086 6:150422536-150422558 TGCTGGGCAAGGAGAGACCCAGG + Intergenic
1018902215 6:168057336-168057358 GGATCTGCGGGGAGAGGCCATGG + Exonic
1018906648 6:168079664-168079686 GGTTCTGCCAGGAGGGACCCTGG + Intronic
1026378464 7:69775465-69775487 TTATCAGTGAGGAGAGTCCCTGG - Intronic
1032237260 7:130136123-130136145 TGATCTGAGGGAAGAGCCCCAGG + Intergenic
1034633971 7:152552751-152552773 TGCTCTGCAAGCAGAGACCTTGG + Intergenic
1036750569 8:11441259-11441281 GGACCTGAGAGGACAGACCCAGG - Intronic
1041090819 8:54299588-54299610 GGCTCTGGGAGGAGAGACCTCGG + Intergenic
1041634752 8:60130389-60130411 TGATCTGCGAGGAGGCAGCCTGG - Intergenic
1044815673 8:96109835-96109857 TGACCTGAGGGAAGAGACCCAGG - Intergenic
1045354862 8:101376618-101376640 GCATCTGATAGGAGAGACCCTGG + Intergenic
1046879223 8:119290045-119290067 TGATCTGCGAGGCGGCAGCCTGG - Intergenic
1047762891 8:127967243-127967265 TCATCTTCCAGGAGAGATCCCGG - Intergenic
1049287595 8:141784484-141784506 TGATCAGCTGGGAGACACCCTGG + Intergenic
1049334682 8:142077010-142077032 TGCTCAGGGAGGGGAGACCCAGG + Intergenic
1056888806 9:90470070-90470092 GGATCTGGGAGTAGAGGCCCAGG - Intergenic
1057481173 9:95446930-95446952 TGGAATGCGAGGAGAGGCCCCGG - Exonic
1057497238 9:95570981-95571003 GGAGCTGCCAGGAGAGTCCCAGG + Intergenic
1058945720 9:109854159-109854181 TGATCTGCTGGTAGTGACCCTGG - Intronic
1060553775 9:124498141-124498163 TGATCAGCTAGAAGAGACGCCGG + Intronic
1062318342 9:135978770-135978792 GGGTCTGAGAGGAGAGCCCCTGG - Intergenic
1062628453 9:137453364-137453386 TGATGTGGGAAGGGAGACCCTGG + Intronic
1062716255 9:138011670-138011692 GGATCTGCGAGGAGGGACCTGGG + Intronic
1186107936 X:6226801-6226823 TGCTGTGGGAGGAGAGGCCCAGG - Intronic
1189875660 X:45433638-45433660 TGCTCTGAAGGGAGAGACCCAGG - Intergenic
1192238572 X:69312285-69312307 TCATCTGCCAGGAGGGCCCCAGG + Intergenic
1197776080 X:130119567-130119589 TGCTCTGGGAGGAGACACCTTGG + Intergenic
1200108943 X:153729261-153729283 TGATCTGCGAGGCCAGGTCCTGG - Exonic