ID: 1167588871

View in Genome Browser
Species Human (GRCh38)
Location 19:50391669-50391691
Sequence CATCAGAGGGAGACTGAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 611
Summary {0: 1, 1: 0, 2: 4, 3: 51, 4: 555}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167588862_1167588871 20 Left 1167588862 19:50391626-50391648 CCGTGAGCCGAGATGGCGGCAGC 0: 1
1: 2
2: 4
3: 72
4: 672
Right 1167588871 19:50391669-50391691 CATCAGAGGGAGACTGAGAGGGG 0: 1
1: 0
2: 4
3: 51
4: 555
1167588863_1167588871 13 Left 1167588863 19:50391633-50391655 CCGAGATGGCGGCAGCACAGTCC 0: 22
1: 231
2: 900
3: 375
4: 1028
Right 1167588871 19:50391669-50391691 CATCAGAGGGAGACTGAGAGGGG 0: 1
1: 0
2: 4
3: 51
4: 555
1167588865_1167588871 -8 Left 1167588865 19:50391654-50391676 CCAGCCTCAGCTCGGCATCAGAG 0: 5
1: 165
2: 622
3: 479
4: 482
Right 1167588871 19:50391669-50391691 CATCAGAGGGAGACTGAGAGGGG 0: 1
1: 0
2: 4
3: 51
4: 555

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167588871 Original CRISPR CATCAGAGGGAGACTGAGAG GGG Intronic
901254813 1:7813851-7813873 CATCAGAACAAGACTCAGAGAGG + Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901974034 1:12930252-12930274 CATGGGAGGGAGGCTGAGAGGGG + Intronic
902011146 1:13271516-13271538 CATGGGAGGGAGGCTGAGAGGGG - Intergenic
902018490 1:13327661-13327683 CATGAGAGGGAGAGGGAGACGGG - Intergenic
902655471 1:17865028-17865050 CATCACAGACAGACTGAGTGAGG - Intergenic
902701807 1:18177510-18177532 CATCAGAGAGAACCTGAGACTGG - Intronic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903638146 1:24834793-24834815 CATGAGAGGGAGAGGGAGACGGG + Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904016739 1:27427419-27427441 TCTCAGAGAGAGACAGAGAGAGG + Intronic
904286778 1:29458034-29458056 CAAGAGAGGGAGAATGGGAGGGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
904941862 1:34169339-34169361 GCTCACAGGGAGAATGAGAGGGG - Intronic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906724963 1:48037409-48037431 CAGGAGAGGGAGAATGAAAGGGG + Intergenic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
906948152 1:50313277-50313299 CCTCAGAGGCCAACTGAGAGTGG + Intergenic
907217275 1:52875086-52875108 CATTAGAAGGAAGCTGAGAGTGG + Intronic
907491005 1:54808750-54808772 CATCAGGAGGACACTGAGTGAGG + Intronic
907673157 1:56494355-56494377 CATCAAAGGAAGGCTGAGAATGG - Intergenic
907730775 1:57063122-57063144 CATCAGATGGGGACAGGGAGTGG + Intronic
908016378 1:59841858-59841880 AAACAGAGGGAGACAGAGACAGG + Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910602185 1:89043701-89043723 CACCAGAGGGAGGCTGAGGCCGG - Intergenic
910640897 1:89460820-89460842 GTACAGAGGGAGACAGAGAGAGG + Intergenic
910777688 1:90892511-90892533 CATCAGAGGGAGACGTGGAGAGG + Intergenic
911025908 1:93435277-93435299 CATGGGAGGGAGGCTGAGAGGGG - Intergenic
911129357 1:94373425-94373447 CATCAGAAGGGGAAGGAGAGGGG - Intergenic
911569616 1:99507593-99507615 CAACAGAGGGAGAGGGGGAGGGG - Intergenic
911845330 1:102745646-102745668 CATCAAAAGGAGAAGGAGAGGGG - Intergenic
912337976 1:108880466-108880488 CACCTGTGGGAGGCTGAGAGAGG + Intronic
912680330 1:111725274-111725296 AATCAGTGGGAGGCAGAGAGGGG + Exonic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
913341059 1:117758656-117758678 CTTCACAGGGAGACAGACAGGGG + Intergenic
913595546 1:120372519-120372541 CATCAGTGTAAGACTGAGGGAGG - Intergenic
913963239 1:143354783-143354805 CTTCAGAGAGAGAGAGAGAGAGG - Intergenic
914057595 1:144180369-144180391 CTTCAGAGAGAGAGAGAGAGAGG - Intergenic
914091731 1:144506456-144506478 CATCAGTGTAAGACTGAGGGAGG + Intergenic
914121551 1:144785997-144786019 CTTCAGAGAGAGAGAGAGAGAGG + Intergenic
914306812 1:146427408-146427430 CATCAGTGTAAGACTGAGGGAGG - Intergenic
914312601 1:146479866-146479888 CTTCAGAGAGAGAGAGAGAGAGG - Intergenic
914501747 1:148253472-148253494 CTTCAGAGAGAGAGAGAGAGAGG + Intergenic
914595238 1:149145394-149145416 CATCAGTGTAAGACTGAGGGAGG + Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915520055 1:156436683-156436705 GGACAGAGGGAGACAGAGAGGGG + Intergenic
915704445 1:157830522-157830544 CATCAGGGAAAGACAGAGAGTGG - Intergenic
916125723 1:161569208-161569230 CATCAGAGGGACACCAGGAGGGG + Intergenic
916135639 1:161651039-161651061 CATCAGAGGGACACCAGGAGGGG + Intronic
916415474 1:164588688-164588710 AATAAGAGGGAGAGAGAGAGAGG + Intronic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
917376264 1:174351052-174351074 CATGAGAGGGAGACCGTGGGGGG + Intronic
918428794 1:184437175-184437197 TACGAGAGGGAGACAGAGAGAGG - Intronic
919849890 1:201665546-201665568 CTCCAGAGAGAGACTGAGATGGG - Intronic
921131936 1:212227394-212227416 CAGAAGAGGGAGGATGAGAGAGG - Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922720858 1:227899618-227899640 AGACAGAGGGAGACAGAGAGTGG - Intergenic
924943591 1:248829775-248829797 CATCAGAGGGAGACCGTGCAGGG - Intergenic
1062788842 10:288376-288398 CATCAGGGGCAGACTATGAGGGG + Exonic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063946405 10:11180494-11180516 CATCAGGAGGAGACTGAGTACGG - Intronic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1065539680 10:26750245-26750267 CAGCACAGGGAGGCTGAGATGGG + Intronic
1066085156 10:31969107-31969129 CATGAGAGGGAGAGGGAGACGGG - Intergenic
1067151522 10:43738800-43738822 CAACAGTGGTAGACTGAGATTGG + Intergenic
1067251849 10:44593306-44593328 CAGGAGAGGGAGAAAGAGAGAGG + Intergenic
1067460063 10:46451611-46451633 CATGAGAGAGAGACAGAGAGAGG - Intergenic
1067533654 10:47092612-47092634 CATCAGAGGGCCACTGAGGGAGG - Intergenic
1067627127 10:47933002-47933024 CATGAGAGAGAGACAGAGAGAGG + Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069343197 10:67437314-67437336 CCTGAGAGGAAGACTGGGAGTGG + Intronic
1071370794 10:84949739-84949761 CATGTGAGGCAGACTGGGAGAGG + Intergenic
1072013623 10:91324260-91324282 AAAGAGAGGGAGACCGAGAGGGG + Intergenic
1072185361 10:93032695-93032717 CAACAAAGGGGGACTGTGAGAGG - Intronic
1072288351 10:93939043-93939065 CATGAGAGAGAGAGTGGGAGAGG + Intronic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1072706882 10:97687292-97687314 CATCGGTGGGAGACAGGGAGGGG + Exonic
1073118578 10:101107706-101107728 AGCCAGAGGGAGACTGAGATTGG - Intronic
1073538310 10:104297448-104297470 AACCAGAGGGAGAAGGAGAGAGG + Intronic
1074014294 10:109518035-109518057 CAGCAGAGGGAAACGGGGAGAGG + Intergenic
1074975616 10:118578940-118578962 GATCTGAGGGAGACAGAGAGTGG + Intergenic
1075962894 10:126584682-126584704 AATCAGTGGGATTCTGAGAGGGG - Intronic
1076508283 10:130993419-130993441 CATCAGTGGGAGATGAAGAGGGG + Intergenic
1077133806 11:988437-988459 CATGTGAGGGAAACTCAGAGTGG + Intronic
1077837286 11:5936256-5936278 AGTGAGAGGGAGTCTGAGAGGGG - Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078605904 11:12775336-12775358 CATCAGAGGGAAGTAGAGAGTGG + Intronic
1078854096 11:15192183-15192205 CAACAGAGGGAGCCAGAGGGAGG - Intronic
1079297573 11:19246881-19246903 CAGAAGAGGGAGAAAGAGAGAGG - Intergenic
1080550969 11:33374001-33374023 CATCTGAAGGAGAGGGAGAGGGG - Intergenic
1081371388 11:42308599-42308621 CTTCAGAGGGAAATTGTGAGAGG - Intergenic
1081620942 11:44618894-44618916 CAGCAGAGGGAGGCCCAGAGCGG - Intronic
1082189261 11:49223001-49223023 CAGCAGAGAGAGACAGAGAAAGG - Intergenic
1082278651 11:50246994-50247016 CATCACAGGGCGGCTGGGAGGGG + Intergenic
1082283608 11:50298060-50298082 AATGAGAGGCAGCCTGAGAGGGG + Intergenic
1082812793 11:57488796-57488818 CATCAGAGGGTCTCAGAGAGAGG + Intronic
1082871168 11:57944618-57944640 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1083296463 11:61718078-61718100 CCTCCCAGGGTGACTGAGAGGGG + Intronic
1084518267 11:69647974-69647996 CATCTGAGGCAGAAGGAGAGAGG - Exonic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085608605 11:77925727-77925749 CATGAGATGAAGTCTGAGAGGGG - Intronic
1086677262 11:89623605-89623627 CAGCAGAGAGAGACAGAGAAAGG + Intergenic
1087211109 11:95447063-95447085 CATCAGAGGGAGGCCGAGGTGGG - Intergenic
1087230587 11:95657368-95657390 CTTCTGAGGCAGTCTGAGAGAGG - Intergenic
1087453462 11:98353589-98353611 CATGGGAGGGAGATTGAGGGAGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1088017690 11:105080873-105080895 GACCATAGGGAGACAGAGAGGGG - Intronic
1089500561 11:118929264-118929286 CAGGAAAGGGAGGCTGAGAGAGG + Intronic
1090134537 11:124183575-124183597 CAACAGAGTGAGACTCAGGGAGG - Intergenic
1090271809 11:125391382-125391404 CAAGAGAGGCACACTGAGAGAGG + Intronic
1090406905 11:126481607-126481629 CAAGACAGGGTGACTGAGAGTGG - Intronic
1090791338 11:130092683-130092705 CATGAGAGGGAGACCGTGGGGGG + Intronic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091378405 12:41281-41303 CATGAGAGGGAGAGGGAGACGGG - Intergenic
1092050724 12:5467994-5468016 CATCAGAGGGAAAATGTGGGGGG - Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092502944 12:9065557-9065579 CGTGGGAGGGAGGCTGAGAGGGG + Intergenic
1092778486 12:11964360-11964382 AATCAGAGGGAGTTTGACAGAGG - Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1092942990 12:13427880-13427902 CAGCAGAGAGAGAGAGAGAGAGG + Intergenic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094408345 12:30143394-30143416 CATGAGAGAGAGAAAGAGAGAGG - Intergenic
1094698678 12:32846970-32846992 GATCAGTGTGAGACTCAGAGGGG - Intronic
1096277502 12:50222651-50222673 CGGCAGAGGGAGAGGGAGAGGGG + Intronic
1096743287 12:53709990-53710012 CAAGAGAGGGAGAGGGAGAGGGG + Intronic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1098680766 12:73350709-73350731 AATCAGAGGAAAACTGAAAGTGG - Intergenic
1100570924 12:95842348-95842370 CATGAGAGGGAGAGGGAGACGGG + Intergenic
1100614411 12:96220012-96220034 CATCAGAGGATTACTCAGAGGGG - Intronic
1102136627 12:110581541-110581563 CATGAGAGGGAGACTTAGAAAGG - Intronic
1102427536 12:112855939-112855961 AATCAGAGAGAGACAGAGAGGGG + Intronic
1103567970 12:121826622-121826644 CAGCAGAGGGAGGTTGTGAGAGG + Intronic
1103767363 12:123290181-123290203 CGCCAGAGGGAGACTGAGCAAGG + Exonic
1104224170 12:126814774-126814796 CATTAGAGAGAGAGTGAGAGAGG - Intergenic
1104742480 12:131188630-131188652 CATGGGAGGGAGGCTGAGGGGGG + Intergenic
1104792255 12:131490990-131491012 CATCAGTGGGAGGCTGTGATTGG - Intergenic
1105360836 13:19714513-19714535 CAACAGAGTGAGACTGACAAAGG - Intronic
1106434264 13:29709832-29709854 CATCAGAAGGAGACTGCAGGAGG + Intergenic
1106579650 13:31006181-31006203 CCTAACAGGGAAACTGAGAGGGG + Intergenic
1106585286 13:31051865-31051887 CATGAGTGGGTGACTGAGAAAGG - Intergenic
1107355474 13:39561189-39561211 AAGCAGAGTGAGACAGAGAGGGG - Intronic
1107447802 13:40483894-40483916 CATCATAGGGAGACTAGGAAAGG - Intergenic
1108844396 13:54660145-54660167 CATGTGAGGGAGACTGAGGGAGG - Intergenic
1109988079 13:70016621-70016643 GATCGAAGGGAGGCTGAGAGTGG + Intronic
1110707715 13:78613771-78613793 GATCTGTGGGAGACTGAGTGGGG + Intergenic
1111508964 13:89235267-89235289 CAGCAAAGAGAGAATGAGAGAGG - Intergenic
1111795192 13:92910495-92910517 CCTCAGAGGAAGACTGAGGGAGG + Intergenic
1111985257 13:95059503-95059525 CATTAGAGGGGTACTGAGAGTGG + Intronic
1112213901 13:97410354-97410376 CATCACAGAGAGACAAAGAGGGG - Intergenic
1113405510 13:110035446-110035468 CCTCAGAGAGAGAGAGAGAGAGG - Intergenic
1113478092 13:110599627-110599649 AAGCAGAGGGAGGCTGAGAGGGG + Intergenic
1113652992 13:112050435-112050457 CATCAGAGAAAGGCGGAGAGGGG + Intergenic
1113654612 13:112060087-112060109 CATCTGAGGGCTAATGAGAGAGG + Intergenic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114651306 14:24286327-24286349 CATCCCAGGGATACTGATAGCGG + Intergenic
1115219276 14:31043385-31043407 TTTGAGAGAGAGACTGAGAGGGG + Intronic
1115261313 14:31457185-31457207 TCTCAGAGGGAGACACAGAGCGG + Intronic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116592357 14:46794397-46794419 AGACAGAGGGAGACAGAGAGAGG + Intergenic
1116919532 14:50558337-50558359 CAACAGAGGGAGACTGTGTCTGG + Intronic
1117076568 14:52110898-52110920 CATCAGAGTGGAACTGAGAGAGG - Intergenic
1117133935 14:52714382-52714404 CTTCAGAGTGAGAATGAGATAGG + Intronic
1117413363 14:55470763-55470785 CATGAGAGTGAGATTGACAGAGG - Intergenic
1117733977 14:58751140-58751162 CATGGGAGGGAGCCTGAGTGGGG + Intergenic
1118200141 14:63663820-63663842 CATGGGAGGGAGGCTGAGTGGGG - Intergenic
1118341418 14:64896653-64896675 CATGAGAGGGAGAGGGAGACGGG + Intergenic
1118734579 14:68692146-68692168 GATGAGAGGGAGACTGGGGGCGG - Intronic
1119144251 14:72295501-72295523 CATAGGAGGGAGAGAGAGAGGGG + Intronic
1119257229 14:73208932-73208954 CATGGGAGGGAGACTGAGGAGGG - Intronic
1120894881 14:89520487-89520509 CAGAAAAGGGAGTCTGAGAGTGG + Intronic
1121315783 14:92960302-92960324 CATCAGGGGCATCCTGAGAGGGG + Intronic
1122089717 14:99330308-99330330 CATCTGAGTCAGACAGAGAGGGG + Intergenic
1122383741 14:101329842-101329864 AATGAGAGAGAGATTGAGAGAGG - Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122710253 14:103651575-103651597 CTTCAGAGGGAAACAGACAGCGG - Intronic
1123629789 15:22253701-22253723 CCTCAGAAGAAGACTCAGAGTGG - Intergenic
1124198001 15:27650149-27650171 GATCATAGGGAGGCTGAGTGAGG + Intergenic
1125691475 15:41599527-41599549 CAGCAGAAGGAGAGTGAGGGTGG + Intergenic
1125843442 15:42827718-42827740 TATTAGAGGGAGATTTAGAGTGG - Intronic
1126163580 15:45635145-45635167 CAGCGGAGGGAGACTGGGCGGGG + Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126911585 15:53422564-53422586 CATCACGGGGAGACTGTGTGTGG + Intergenic
1127287509 15:57544444-57544466 CAACACAGGGAGACTGTGAGGGG - Intronic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1127976706 15:64002871-64002893 CAGCAGAGGGAGGAGGAGAGAGG + Intronic
1128246448 15:66135881-66135903 CAGCAGAGTGAAACTCAGAGAGG - Intronic
1129118935 15:73383186-73383208 TATAAGAGGGAGACAGAGGGAGG + Intergenic
1129461388 15:75701716-75701738 CATCTGAGGGACACTGGCAGTGG - Intronic
1129723446 15:77890091-77890113 CATCTGAGGGACACTGGCAGTGG + Intergenic
1129852791 15:78804056-78804078 CAGCAAAGGGAGGCTCAGAGAGG + Intronic
1130485383 15:84395669-84395691 CTTCAGAGAGAGAGAGAGAGAGG - Intergenic
1130673245 15:85930966-85930988 CAACAGAGGGTGAAGGAGAGGGG - Intergenic
1131076856 15:89500786-89500808 CAGCAGAGGGAGACAGAAACTGG - Intergenic
1131662969 15:94538502-94538524 CATCAGAGGTAGGCTGGGTGTGG + Intergenic
1132738345 16:1398470-1398492 GCTCAGAGGGAGACTGAACGTGG + Exonic
1133368311 16:5228587-5228609 AATGAGAGGGAGAGGGAGAGGGG + Intergenic
1133878761 16:9761113-9761135 AATCATAGGGAGACAGAGGGAGG - Exonic
1134807525 16:17138562-17138584 CATCTGTGGGAGGCTGGGAGAGG - Intronic
1134846855 16:17447638-17447660 CATCCCAGGGAGAAGGAGAGAGG + Intronic
1134907643 16:17994505-17994527 AATCAGAGGGAGATTGATGGAGG + Intergenic
1136377936 16:29876544-29876566 GATGAGAGGGAGACCCAGAGGGG + Intronic
1136477326 16:30521627-30521649 CATGAGAAGGACTCTGAGAGTGG + Exonic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1137844580 16:51674641-51674663 AATCAGAAGGAGAGTGAGTGAGG + Intergenic
1138238979 16:55411298-55411320 CATCAGAGGCAGAGAGAAAGTGG + Intronic
1138909468 16:61379005-61379027 AAACAGAGGAAGACAGAGAGGGG - Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1140051377 16:71484420-71484442 CACCAGAGGGAGACCGGGACCGG + Intronic
1141776263 16:86124525-86124547 CTTCAGAGGGATCCTGAGATGGG + Intergenic
1141973353 16:87497055-87497077 CCTCAGAAGAAGACTCAGAGTGG + Intergenic
1142470598 17:161307-161329 CATGAGGGGCAGAGTGAGAGGGG - Intronic
1142639257 17:1276212-1276234 CATGCGAGGGATGCTGAGAGAGG - Intergenic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143770054 17:9162790-9162812 CTGCAGGGGGAGACAGAGAGAGG - Intronic
1143885473 17:10061782-10061804 CCTGAGAGGGAGGCTGGGAGTGG - Intronic
1143963288 17:10738298-10738320 AATCAGTGGTGGACTGAGAGAGG - Intergenic
1144465540 17:15493810-15493832 CTGCAGAGGGAGAGAGAGAGAGG - Intronic
1144887117 17:18470884-18470906 CATCAGAGGGAGGGTGCGGGAGG + Intergenic
1145145099 17:20473411-20473433 CATCAGAGGGAGGGTGCGGGAGG - Intergenic
1145733480 17:27211414-27211436 CATGAGAGGGAGAGGGAGACGGG - Intergenic
1145936602 17:28717980-28718002 CAAAAGAGGGAGCCTGAGCGGGG - Intronic
1146000424 17:29127410-29127432 CAACAGAGGAAGTCTGAGATGGG + Intronic
1146153041 17:30493315-30493337 CTACAGAGAGAGACTGAGACAGG + Intronic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146353836 17:32117959-32117981 CATCAGAGGGAGGGTGCGGGAGG + Intergenic
1146359119 17:32159733-32159755 CATGGGAGGGAGGCTGAGATGGG + Intronic
1146369271 17:32254958-32254980 CAGCAGAGGGAGGCTGTGCGTGG - Intergenic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146849889 17:36212782-36212804 CAGCAGAGAAAGAGTGAGAGTGG - Exonic
1146933020 17:36791390-36791412 CCTGTGTGGGAGACTGAGAGGGG + Intergenic
1147122514 17:38343903-38343925 CGTGAGAGGGAGACGGAGAGAGG - Intergenic
1147875311 17:43616781-43616803 AATCAGAGAGAGAGAGAGAGGGG + Intergenic
1148444559 17:47729595-47729617 AATGGGAGGGAGCCTGAGAGTGG + Intergenic
1148470461 17:47889966-47889988 CTTCATTCGGAGACTGAGAGTGG - Intergenic
1149028866 17:52061941-52061963 TATCAAAGGGAGACTGAATGTGG + Intronic
1149379094 17:56074854-56074876 CAGCAAAGGGAGAGTCAGAGCGG + Intergenic
1149413961 17:56438900-56438922 CATCAAAGGGAGAAGGAGAAGGG + Intronic
1149664314 17:58355055-58355077 CAGCAGAGTGTGGCTGAGAGGGG + Intronic
1150518135 17:65836826-65836848 CATCAGAGGGGGAGGGGGAGGGG - Intronic
1150533798 17:66014195-66014217 CAGTAGAGGGAGAGTGTGAGTGG + Intronic
1150719188 17:67599766-67599788 GATCAGAAGGGGACTTAGAGTGG + Intronic
1151892510 17:76958998-76959020 CAGCACAGGGAGATTGGGAGAGG - Intergenic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152207031 17:78979769-78979791 AAAGAGAGAGAGACTGAGAGGGG + Intronic
1152530315 17:80914718-80914740 CATGGGAGGGAGGCTGAGGGTGG + Intronic
1153300389 18:3586914-3586936 CATAAGAGTGAGACTGAAGGAGG + Intronic
1154178202 18:12103176-12103198 CATCAGAGGGAGAGCAAGAAAGG + Exonic
1154357577 18:13633511-13633533 CATCAGTGGGAGGCTGAGGCAGG - Intronic
1155474431 18:26224028-26224050 CACCAGAGAGAGAGAGAGAGAGG + Intergenic
1156401618 18:36745040-36745062 CATGAGAGGAAGAGAGAGAGTGG + Intronic
1156544537 18:37950542-37950564 CATCAGGAGGAGAGTGAGATTGG - Intergenic
1157434214 18:47654781-47654803 CATCAGAAGGGGACTGAGTAGGG - Intergenic
1157695745 18:49722161-49722183 CATCAGATGTACACTCAGAGGGG + Intergenic
1158646549 18:59253801-59253823 CATCTGAGAGAGAGAGAGAGAGG + Intergenic
1159299871 18:66549241-66549263 AATCAGAGGGAAACTGAGAAAGG + Intronic
1160262767 18:77310550-77310572 CAGAACAGGGAGGCTGAGAGGGG + Intergenic
1161255238 19:3305176-3305198 GCTCGGAGGGAGACTGTGAGGGG + Intergenic
1161468383 19:4444554-4444576 AATCAGAGAGAGACTGGAAGAGG - Intronic
1162379801 19:10324701-10324723 GAACAGAGAGAGACTCAGAGGGG + Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1163071223 19:14843643-14843665 CCTCAGAGAAAGGCTGAGAGTGG - Intergenic
1163783460 19:19262258-19262280 AAGCAGAGGGAGAGAGAGAGAGG + Intronic
1164066272 19:21720372-21720394 CATGAGAGGGAGAGGGAGACGGG - Intergenic
1164475454 19:28572511-28572533 TATCAGAGGGAAAATGGGAGAGG - Intergenic
1164762559 19:30738834-30738856 TATCAGATGGAGATAGAGAGAGG + Intergenic
1164955174 19:32376894-32376916 CAGCAGAGGCAGAGAGAGAGAGG + Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166266087 19:41685385-41685407 CCCCAGTGGGAGACTGAGACAGG - Intronic
1166879483 19:45919013-45919035 GAGCAAAGGGAGACTTAGAGGGG + Intergenic
1167588871 19:50391669-50391691 CATCAGAGGGAGACTGAGAGGGG + Intronic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168185939 19:54699297-54699319 CCTCAGAGGGAGGGAGAGAGAGG + Intronic
1168356564 19:55703891-55703913 CAGCAGAGGGCGCCGGAGAGCGG + Intronic
1168673691 19:58260791-58260813 CATCAGAGGGGGAGGGGGAGGGG - Intronic
1202697078 1_KI270712v1_random:133042-133064 CTTCAGAGAGAGAGAGAGAGAGG - Intergenic
925042024 2:739862-739884 CGTCAGAGGGAGGCAGAGATCGG + Intergenic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925604231 2:5641874-5641896 CATCAGTGTAAGACTGAGGGAGG - Intergenic
926728014 2:16013628-16013650 ATTCAGACAGAGACTGAGAGAGG + Intergenic
927637773 2:24828556-24828578 CATCACGGGGAGGCTGTGAGTGG - Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928542368 2:32295039-32295061 CATCAGAGGGAGAGGGGGAGGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929555472 2:42923003-42923025 GATCAGAGGTGGTCTGAGAGCGG - Intergenic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
930309929 2:49727333-49727355 CACCAGAGAAAGAGTGAGAGAGG + Intergenic
930656547 2:54012931-54012953 GAGCAGAGGGAGAGGGAGAGTGG - Intronic
930903989 2:56543578-56543600 CATGAGAAGGAGACTTAGAAGGG + Intergenic
931733986 2:65177684-65177706 CATGGGAGGGAGGCTGAGTGGGG - Intergenic
933118475 2:78504021-78504043 CACCAGAGTGAGGTTGAGAGTGG + Intergenic
933559889 2:83876086-83876108 AGTGAGAGGGAGTCTGAGAGGGG + Intergenic
933730955 2:85455969-85455991 CAACAAAGGAAGCCTGAGAGTGG + Intergenic
934115845 2:88792442-88792464 CATCAGAGGGAGAGCAAAAGAGG + Intergenic
934627745 2:95876469-95876491 CATCAGAGGGAGAGCAAAAGAGG - Exonic
934805821 2:97224827-97224849 CATCAGAGGGAGAGCAAAAGAGG + Exonic
934831699 2:97532341-97532363 CATCAGAGGGAGAGCAAAAGAGG - Exonic
934914527 2:98290229-98290251 CATGAGAGAGAGAGTGAAAGGGG + Intronic
935504987 2:103889401-103889423 CATCACAGGGCCACTGAGAGGGG - Intergenic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
935736552 2:106111121-106111143 CAGGACAGGGAGAATGAGAGTGG + Intronic
935933807 2:108159019-108159041 ATTCAGAAGGAGACTGACAGAGG + Intergenic
936152687 2:110030289-110030311 AGTCACAGGGAGCCTGAGAGAGG - Intergenic
936191993 2:110341123-110341145 AGTCACAGGGAGCCTGAGAGAGG + Intergenic
937288421 2:120767435-120767457 CACCAGCGGCAGACTGGGAGAGG - Intronic
937464298 2:122116809-122116831 TATCAGATGGAGGCAGAGAGTGG - Intergenic
937624069 2:124024596-124024618 CGTCTCAGGGAGACGGAGAGAGG - Intergenic
938099063 2:128485913-128485935 CCTCAGAGGGAGGCTCAGAGAGG - Intergenic
938253272 2:129833044-129833066 CATCAGAGGGAGACTGTGGGGGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938612912 2:132967896-132967918 CAACAGAGTGAGGCTGAGTGAGG + Intronic
939359844 2:141156378-141156400 CAACACAGGGAGGCTGAGACAGG + Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
940669577 2:156650721-156650743 CATGTCAGGGAGACTGGGAGGGG - Intergenic
941131015 2:161650792-161650814 CATGGGAGGGAGGCTGAGTGGGG + Intronic
941248519 2:163131915-163131937 TATGAGAGGGAGTGTGAGAGAGG - Intergenic
941576014 2:167231249-167231271 ACTCAGAGGGACACTGAAAGAGG + Intronic
941928231 2:170916657-170916679 CAGCCGAGGCAGACAGAGAGAGG - Intergenic
942821673 2:180122629-180122651 CATCTGAGGCATAGTGAGAGTGG - Intergenic
943041149 2:182807140-182807162 TATGAGAGGGAGAATGAGGGGGG - Intergenic
943234653 2:185301716-185301738 CATCAGAGACAGACTCAGATAGG - Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
943981675 2:194560165-194560187 CACAAGAGGGGGCCTGAGAGTGG + Intergenic
944389338 2:199201020-199201042 CAAGAGAGGGAGAAAGAGAGAGG - Intergenic
944599042 2:201284649-201284671 CATGAGAGGGAGAGGGAGACGGG + Intronic
944906301 2:204265222-204265244 AATCAGAGGGAGACAGAAAGGGG - Intergenic
945110817 2:206357710-206357732 GTTCAGAGGGAGACTGGGAGAGG + Intergenic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
945970609 2:216227528-216227550 CATGAGAGGGAGAGGGAGACGGG + Intergenic
946375348 2:219305189-219305211 CCTCTCAGGGAGACTGAGAAGGG - Intronic
946811112 2:223526768-223526790 CATCAGAGAAAGATTGAGAGAGG + Intergenic
946845948 2:223859212-223859234 CAAAAGAGGGAGAGAGAGAGAGG - Intronic
947618591 2:231574330-231574352 CAGCAGGTGGAGACAGAGAGTGG + Intergenic
947943167 2:234076300-234076322 CAGCAGAGGGGGCCTGAGAGTGG - Intronic
948033093 2:234835856-234835878 CTGCAGAGGGAGGCTGACAGGGG - Intergenic
948570459 2:238914225-238914247 CTTAAGAGGGAGACAGAGTGTGG - Intergenic
948572702 2:238927492-238927514 GAGCAGAGGGAGACACAGAGTGG + Intergenic
948861620 2:240755315-240755337 CAGCAGAGGCAGACAGAGCGAGG + Intronic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169782951 20:9328819-9328841 CATCAGAGTGAGGTTAAGAGTGG + Intronic
1170316935 20:15052628-15052650 CAGGAGAGGGAGACAGACAGGGG - Intronic
1172047320 20:32089692-32089714 CATCAGAGAGAGCATGAGAGAGG - Intronic
1172123086 20:32609860-32609882 CCTCAGATGGAGAGTGAGGGGGG - Intergenic
1172134846 20:32679986-32680008 CCTCAGAGGGCGAGTGAAAGAGG + Intergenic
1172777579 20:37416414-37416436 GCTCAGAGGGAGAGAGAGAGGGG - Intergenic
1173430994 20:42987113-42987135 CAACAGAGGGAGGCAGGGAGGGG - Intronic
1174361574 20:50032070-50032092 CATCAGGTGGAGAATGAGGGTGG + Intergenic
1174362054 20:50035054-50035076 CATCAGGTGGAGAATGAGGGTGG + Intergenic
1177650954 21:23961672-23961694 AATGAGAGAGAGAGTGAGAGGGG - Intergenic
1178027347 21:28483306-28483328 CATCAGAAGGAGACTCAGGATGG + Intergenic
1179008464 21:37534573-37534595 TATCAGAGGCAGTCTGACAGGGG + Intergenic
1179008530 21:37535005-37535027 CAGGAGAGGGAGACCCAGAGAGG + Intergenic
1179234386 21:39532134-39532156 CATCAAATGGAGACAGCGAGTGG + Intergenic
1180656197 22:17422994-17423016 CATCGGAAGCAGACTGAGAGAGG - Intronic
1180691830 22:17723181-17723203 CAGGAGAGGGAGAAAGAGAGAGG - Intronic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1182078853 22:27514740-27514762 CATCAGAAGGTGACTGAGTGAGG - Intergenic
1182164021 22:28154005-28154027 CATCAGAGAGAGAGAGAGAGAGG + Intronic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182757938 22:32695926-32695948 CATCAGAGGAAGACAAAAAGAGG - Intronic
1182830243 22:33299191-33299213 CAACAGAGTGAGAGAGAGAGAGG + Intronic
1182891845 22:33825745-33825767 TATCAGATGGTGACAGAGAGAGG + Intronic
1183270122 22:36856720-36856742 CAGCAGAGGGAGACAGAAAAGGG + Intergenic
1183871892 22:40746367-40746389 CATGAGAGGGAGAGGGAGACGGG + Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184757858 22:46526955-46526977 GATGAGAGTGAAACTGAGAGAGG - Intronic
1185175467 22:49324039-49324061 GAACAGAGGGAGACTTACAGAGG + Intergenic
1185233994 22:49700456-49700478 TATCAAAGAGAGACAGAGAGAGG - Intergenic
949928851 3:9062357-9062379 CAACATAGGGAGAAGGAGAGAGG - Intronic
950477549 3:13223518-13223540 CATCAGAGGGAAGCTGGGAATGG + Intergenic
950910980 3:16591539-16591561 CTTCAGAGGGAGGCTGAGGTAGG - Intronic
951782202 3:26376481-26376503 CATGAAAGGGAGACTGGAAGGGG + Intergenic
952426902 3:33184891-33184913 CATCAGAGCTAGACTCAGATAGG - Intronic
952590904 3:34952771-34952793 CGTCAGAGGAGGCCTGAGAGTGG + Intergenic
953137305 3:40192259-40192281 AATCAGAGGGAGAATTAGAAAGG - Intronic
953449915 3:42997417-42997439 CATGAGAGAGAGACAGAGAGAGG + Intronic
953464733 3:43109675-43109697 AACCAGAGAGAGACAGAGAGAGG - Intergenic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
955231381 3:57102012-57102034 CATGAGAGGGAGGCTGAGGCAGG + Intronic
957787921 3:84905310-84905332 CATGGGAGGGAGCCCGAGAGGGG + Intergenic
958058914 3:88452055-88452077 CAACAGTGGGATACTGTGAGAGG + Intergenic
958780993 3:98542487-98542509 CTTTTGAGAGAGACTGAGAGTGG + Intronic
958797994 3:98726970-98726992 CATCATAAGGATACTTAGAGTGG - Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
959817748 3:110694898-110694920 CATCAGTGGGAATCCGAGAGTGG - Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961389880 3:126546157-126546179 GGTCAGAGGGAGACTGCGGGAGG - Intronic
962002767 3:131316691-131316713 CCTTAGATGGAAACTGAGAGAGG + Intronic
963021550 3:140876787-140876809 CATCAAAAGGAGAAGGAGAGGGG + Intergenic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
965056636 3:163725487-163725509 AATGAGAGTGAGAGTGAGAGAGG - Intergenic
965665499 3:171089526-171089548 TATCAAAGAGAGACTCAGAGAGG + Intronic
965953378 3:174337945-174337967 AATCAGAGAAAGACTGAGGGAGG - Intergenic
966169482 3:177062419-177062441 CATCAGAGTCACACTGAGTGGGG - Intronic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
966926920 3:184650569-184650591 CTTGAGAGGGACGCTGAGAGAGG + Intronic
967423970 3:189304889-189304911 AAACAGAGGGAGGCTGTGAGTGG - Intronic
967601371 3:191393227-191393249 CATGGGGGGGAGACAGAGAGAGG - Intronic
967684246 3:192400821-192400843 CATAAGAGGTAGACTATGAGTGG - Intronic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968736367 4:2298816-2298838 CATCAGAGTGGGACTGACGGAGG - Intronic
968852966 4:3095498-3095520 CATCAGAGGGAGACTGTGCGAGG + Intronic
969173735 4:5384002-5384024 CATCACAGGGAGAGAGGGAGGGG + Intronic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
970475323 4:16416338-16416360 CTTCAGAGGGAAACTGATATTGG - Intergenic
970641884 4:18075975-18075997 CACTAGAGGGAGACTGAGCGTGG + Intergenic
971496732 4:27274611-27274633 CTTCAGAGGCAGACTGCCAGTGG + Intergenic
971550351 4:27947423-27947445 CATCAGAGGGAGGCTGAATTGGG + Intergenic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973226752 4:47793784-47793806 GATCAGAAGGGGACTGATAGAGG + Intronic
973307024 4:48663950-48663972 AACCAGAGGGAGCCTGAGATAGG + Intronic
974179002 4:58360638-58360660 CATGGGAGGGAGACTGAGGTGGG - Intergenic
974282014 4:59807397-59807419 CTTCATAGGCAGACTGAGAGGGG + Intergenic
975389414 4:73799209-73799231 CATCATAGAAAGACAGAGAGAGG + Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
976753288 4:88472105-88472127 CCACAGAGGGAGGCTGAGACAGG - Intronic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978498427 4:109384459-109384481 CATGAGAGGGAGACTGAGTCAGG + Intergenic
979124175 4:116946602-116946624 CAAGAGAGAGAGAGTGAGAGGGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
980982883 4:139669262-139669284 TGTAAGAGGGAGACAGAGAGAGG + Intronic
981236214 4:142418854-142418876 CATCAGGTGGAGACTGAGCAGGG + Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
983084561 4:163427295-163427317 AGTCAGAGAGAGACAGAGAGAGG + Intergenic
983893292 4:173054180-173054202 GAAGAGAGGGAGAATGAGAGAGG + Intergenic
984206527 4:176793000-176793022 CTTCCGAGGGAGAGTGAGAGGGG - Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
984822955 4:183899206-183899228 GAGCAGAGGGAGAGAGAGAGGGG - Intronic
985245789 4:187978589-187978611 CACCTGAGGGAGGCTGTGAGTGG - Intergenic
985802035 5:2010812-2010834 CATCAGCGGGAGACCCAGGGAGG - Intergenic
985810310 5:2078275-2078297 CATGTGAGGCAGCCTGAGAGAGG + Intergenic
985972740 5:3391214-3391236 CCTCACTGGGAAACTGAGAGAGG + Intergenic
987031149 5:13977903-13977925 CATGAGAGGGAGAGAAAGAGAGG + Intergenic
987586570 5:19863788-19863810 CAACATAGGGAGGCTGTGAGAGG + Intronic
988525922 5:31987476-31987498 CATCAGAGGCAGCCTGAGGATGG + Intronic
988579419 5:32455884-32455906 GATCAGAGAGAGAGAGAGAGAGG - Intergenic
988998724 5:36739555-36739577 TATCAGAGAGAGAGAGAGAGAGG - Intergenic
989140187 5:38194273-38194295 CAGGAGAGGGAGACAGAGAGAGG + Intergenic
989425453 5:41290911-41290933 CATGGGAGGGAGACTGAGCAGGG - Intergenic
989496598 5:42116245-42116267 CATCAAAAGGAGAGCGAGAGGGG + Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
990981619 5:61607112-61607134 CCTCTGAGGGAGCCAGAGAGGGG + Intergenic
991086312 5:62651173-62651195 AATCAGAGGGACACTCAGTGTGG + Intergenic
991137427 5:63198499-63198521 CAGAAGGGGGAGAGTGAGAGAGG + Intergenic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
991435695 5:66596049-66596071 CGTCAGAGGGAGACGGCGAGCGG - Intergenic
991460604 5:66854591-66854613 CATCAGACGGAGCATGGGAGAGG + Intronic
991989819 5:72326494-72326516 CTGCAGAGGGGCACTGAGAGGGG - Intronic
992415980 5:76551856-76551878 CGGGAGAGGGAGACGGAGAGGGG + Intronic
992930967 5:81644721-81644743 CATAAGAGGGAGAACCAGAGTGG + Intronic
992977839 5:82138876-82138898 CATGAGAGGGAGAGGGAGAGGGG - Intronic
993703390 5:91143867-91143889 CATGGGAGGGAGGCTGAGGGGGG - Intronic
993938369 5:94030091-94030113 CATCAGAGGGACCCGGTGAGAGG - Intronic
993968990 5:94393958-94393980 CAGCTGAGGGAGGCTGAGACAGG - Intronic
994050627 5:95358458-95358480 GAGCAGAGAGAGACTGTGAGAGG + Intergenic
994253014 5:97559081-97559103 CATTTGAGGGAGGCTGAGACTGG + Intergenic
994753266 5:103764514-103764536 CATGAGAGGGAGGCTGAGAGAGG - Intergenic
997241088 5:132308794-132308816 CATCAGAGGGGCAGGGAGAGGGG + Intronic
999523736 5:152380242-152380264 CAAGAGAGGGAGAGAGAGAGAGG + Intergenic
999973871 5:156891752-156891774 CATCATAGGGAGAATGAGGCTGG - Intergenic
1000040278 5:157480120-157480142 CATTAGAGGGAGAATGAGAGGGG + Exonic
1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1001197502 5:169686595-169686617 CTTCAGAGTGAGACTGACATTGG - Intronic
1001680258 5:173551784-173551806 CATCAGAGGAAGCATGAGAGAGG + Intergenic
1003102868 6:3190555-3190577 CATGAGGTGGAGACTAAGAGGGG - Intergenic
1003152222 6:3562610-3562632 CATTAGAGGGAAAGAGAGAGAGG + Intergenic
1003319629 6:5038849-5038871 CATCAGAGGGAGACCGCGGAAGG + Intergenic
1003382332 6:5636617-5636639 CTTCAGAGGGAGGCAGAGAAGGG + Intronic
1004056844 6:12147716-12147738 CATCTGGTGGAGAATGAGAGAGG - Intronic
1004241251 6:13924742-13924764 TTTGTGAGGGAGACTGAGAGAGG + Intronic
1005210495 6:23454949-23454971 AAACAGAGGAAAACTGAGAGTGG - Intergenic
1005837032 6:29717921-29717943 CATGAGAGGGAGAGGGAGACGGG - Intergenic
1006294597 6:33164522-33164544 CCTCAGAGGGAGACAGAGACGGG + Intronic
1006410330 6:33870041-33870063 CAGCAGAGGGAAAGGGAGAGGGG + Intergenic
1006674932 6:35755907-35755929 CATCAGAGGGAAACTCTGATTGG - Intergenic
1006829047 6:36957939-36957961 CAACAGTGGGAGACTGGGAGTGG - Intronic
1007376803 6:41462546-41462568 AATGAGATGGAGACAGAGAGAGG + Intergenic
1007949695 6:45860319-45860341 AACCAGAGGGAGACAGAAAGAGG - Intergenic
1008375024 6:50781720-50781742 CATCTGAGTGAGACTGGAAGTGG - Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1008523568 6:52385241-52385263 CAGTAGAGAGAGAATGAGAGGGG - Intronic
1008926785 6:56895989-56896011 CATGAGAGGGAGAGGGAGACGGG + Intronic
1009243410 6:61205162-61205184 CATGGGAGGGAGACTGAGGGGGG - Intergenic
1010162076 6:72868459-72868481 AACCAGAGGGAGTCTGGGAGTGG + Intronic
1011498418 6:87961664-87961686 CATCATAGGGAGACTGTGCCTGG - Intergenic
1011890161 6:92148873-92148895 CATGAAAGGGAGTATGAGAGAGG + Intergenic
1012192432 6:96297051-96297073 CAGAAGAGGGAGACTGTGAGGGG + Intergenic
1013431029 6:110054914-110054936 CATCAGCTGGAGACCCAGAGAGG + Intergenic
1014391632 6:120872248-120872270 CATGGGAGGGAGGCTGAGAAGGG + Intergenic
1014764408 6:125390099-125390121 CATGAGAGGGAGAGGGAGACGGG + Intergenic
1018026936 6:159814057-159814079 AATGAGAGGGAGACAGAAAGAGG - Intronic
1018373063 6:163186319-163186341 AATCTGAGGGTGTCTGAGAGTGG - Intronic
1018374213 6:163195686-163195708 CAGCACAGGGAGGCTGAGAGGGG - Intronic
1018650191 6:165986558-165986580 AAGGAGAGAGAGACTGAGAGAGG - Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019782226 7:2948422-2948444 GATTAGAGGGAAATTGAGAGTGG - Intronic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1021896030 7:25236920-25236942 CATCAGAGGAAGTTTGGGAGTGG - Intergenic
1022538639 7:31114808-31114830 GAGAAGAGGGTGACTGAGAGGGG - Intergenic
1022549969 7:31229001-31229023 CAACAGAGGTAGACTGGGCGGGG + Intergenic
1023104688 7:36751929-36751951 CATTGGATGGAGACTGGGAGAGG + Intergenic
1023301407 7:38776044-38776066 CTTCAAAGGGAGACTGGGTGTGG + Intronic
1025216558 7:57061031-57061053 CATCACAGGGCGGCTGGGAGGGG + Intergenic
1025627309 7:63233481-63233503 CATCACAGGGCGGCTGGGAGGGG + Intergenic
1025654822 7:63509699-63509721 CATCACAGGGCGGCTGGGAGGGG - Intergenic
1025806240 7:64836917-64836939 AGTGAGAGGGAGTCTGAGAGGGG + Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026316269 7:69230413-69230435 CCTCAGTGGGAGACTGAGGTGGG - Intergenic
1026579543 7:71602591-71602613 CTGCAGAGGGAGAGAGAGAGAGG - Intronic
1027225946 7:76243749-76243771 CCACAGAGGGAGACAGAGACTGG - Intronic
1029374680 7:100170523-100170545 AAGCAGAGGGAGACAGAGGGAGG + Intronic
1029454324 7:100660535-100660557 CATAGGAGGGATACTGAGATGGG + Intergenic
1029778260 7:102701965-102701987 CTTCAGAGAGAGAAAGAGAGAGG + Intergenic
1030420667 7:109302789-109302811 CATCAAAAGGGGAATGAGAGGGG + Intergenic
1030570240 7:111213325-111213347 CATGGGAGGGAGGCTGAGTGGGG + Intronic
1031003596 7:116446586-116446608 CATCAGAGGGAGACGTAAGGAGG - Intronic
1032775014 7:135103641-135103663 TCTCAGTAGGAGACTGAGAGGGG + Intronic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033369293 7:140694562-140694584 GGTCTGAGGGAGGCTGAGAGTGG + Intronic
1034630995 7:152530468-152530490 CACCAGCAGGAGACAGAGAGAGG - Intergenic
1034733763 7:153410908-153410930 AGTGAGAGGGAGTCTGAGAGGGG + Intergenic
1034947644 7:155273679-155273701 CATAAGAGAGAGATGGAGAGAGG + Intergenic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035635029 8:1138120-1138142 CAGCAGAGCGAGCCTGAGAATGG + Intergenic
1035931420 8:3784131-3784153 CATGAGAGAGAGAAAGAGAGAGG - Intronic
1036003869 8:4639284-4639306 CATCAGAGGCAGACTGTTACAGG - Intronic
1036208266 8:6821036-6821058 CTTCACAGGAACACTGAGAGGGG + Intronic
1038146395 8:24900584-24900606 TTTCAGAGGAAGACTAAGAGGGG - Intergenic
1038502206 8:28054607-28054629 GCTCAGAGGGAGAGTGTGAGAGG - Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1038941195 8:32307826-32307848 TGTCAGATGGAGACAGAGAGAGG - Intronic
1039159703 8:34603623-34603645 CAGCAGAGAGAGCCTTAGAGAGG + Intergenic
1039163066 8:34644179-34644201 CAGCAGAGGGAGACAGAAAGAGG - Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1041290028 8:56299940-56299962 CATCAGTGGGTGACTCTGAGAGG + Intergenic
1041694022 8:60716454-60716476 CAACTGTGGAAGACTGAGAGGGG - Intronic
1041956978 8:63566866-63566888 GATCAGAGGGAGCATCAGAGGGG - Intergenic
1042062059 8:64830202-64830224 AATGAGAGGGAGAGAGAGAGAGG - Intergenic
1043082590 8:75784774-75784796 CATGGGAAGGAGGCTGAGAGAGG - Intergenic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045511618 8:102816125-102816147 CATCAGGCTGAGGCTGAGAGAGG + Intergenic
1045842354 8:106594863-106594885 CATCAGAGGGAAATTGGCAGGGG + Intronic
1046040440 8:108897002-108897024 CAAGAGAGAGAGAGTGAGAGAGG - Intergenic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1046673844 8:117087403-117087425 CCTCAGATGAAGGCTGAGAGAGG - Intronic
1046839412 8:118840747-118840769 CAGGAGAGAGAGACCGAGAGTGG + Intergenic
1047723787 8:127667151-127667173 GATCTGATGGAGACTGAGATGGG + Intergenic
1048225676 8:132583031-132583053 AATCAAAGAGAGACAGAGAGAGG + Intronic
1048317697 8:133374527-133374549 GAGCAGAAGGAGAGTGAGAGCGG - Intergenic
1048317703 8:133374578-133374600 GAGCAGAAGGAGAGTGAGAGCGG - Intergenic
1048548003 8:135404939-135404961 CATGGGAGGGAGGCTGAGTGGGG - Intergenic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1050958420 9:11694632-11694654 CAGGAGAGAGAGAGTGAGAGAGG + Intergenic
1051126824 9:13814206-13814228 CATGAGAGGAAGAGTGAGATTGG - Intergenic
1051160025 9:14197266-14197288 CAGGAGAGTGAGACTGAGAAAGG - Intronic
1051595260 9:18818677-18818699 CAGCTGAGGGAGGCTGAGATGGG + Intronic
1052652424 9:31321517-31321539 CATGGGAGTGAGGCTGAGAGGGG - Intergenic
1053085293 9:35214586-35214608 TAACAGAGGGAGAAAGAGAGAGG + Intronic
1053290434 9:36876140-36876162 CACCACAGGGGGAGTGAGAGGGG - Intronic
1053514683 9:38720510-38720532 CATTACAGGAAGACTTAGAGAGG + Intergenic
1055588123 9:77778486-77778508 CATAAGAGGCAGAAAGAGAGTGG + Intronic
1056019275 9:82424417-82424439 CATCCCAGGGAGACAGGGAGTGG - Intergenic
1056221421 9:84453759-84453781 CAGGAAAGGGAGACTGAGACAGG - Intergenic
1056760864 9:89414199-89414221 CATCCCAGGGAAACTGAAAGGGG + Intronic
1056772842 9:89492239-89492261 CATGAGAGGGAGGGTGACAGCGG - Intronic
1057479686 9:95434740-95434762 CATGAGAAGCAGACTGTGAGAGG - Intergenic
1057521663 9:95765188-95765210 CATCAGAAGGAGACAGGTAGTGG - Intergenic
1061175566 9:128994293-128994315 CACCAAAGGGAGCTTGAGAGAGG + Intronic
1185990010 X:4883237-4883259 AATCAGAGGCAGACTTAGTGTGG - Intergenic
1186881749 X:13873311-13873333 CTTCAGAGAGCGACAGAGAGTGG + Intronic
1187492035 X:19761135-19761157 CAGGAGAGGGAGAAGGAGAGAGG + Intronic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190023767 X:46903665-46903687 CAGCAGAGTGAGACTGAGTAGGG + Intergenic
1190076075 X:47318087-47318109 CAACACAGGGAGGCTGAGACGGG + Intergenic
1190222330 X:48520511-48520533 CATCAGTGGCACCCTGAGAGGGG - Exonic
1191005188 X:55703398-55703420 CTTCAGATGGAGACTCTGAGTGG - Intergenic
1191899085 X:66022675-66022697 CCTCAGAAGGTGCCTGAGAGAGG + Intronic
1192201282 X:69068300-69068322 AATCAGAGAGATACTGAGACCGG + Intergenic
1195619605 X:106939751-106939773 CATCAGATGGGGGCTGTGAGTGG - Intronic
1195621192 X:106956712-106956734 CACCAGAGAGAGAGAGAGAGAGG + Intronic
1195875316 X:109534913-109534935 AATGAGAGGGGGAATGAGAGGGG + Intergenic
1196365098 X:114915006-114915028 CATGAGAGAGAGACAGACAGAGG + Intergenic
1196389727 X:115194900-115194922 CATCTGAGAGAGACTCAAAGAGG + Intronic
1196686727 X:118516459-118516481 CAACAGAGCGAGTGTGAGAGAGG - Intronic
1197862139 X:130982385-130982407 GATGAGAGGCAGAGTGAGAGGGG + Intergenic
1198236859 X:134743771-134743793 AATCAGCAAGAGACTGAGAGTGG + Intronic
1198479360 X:137026968-137026990 CAGCAGAGGGAGAGGGAGTGAGG + Intergenic
1198671087 X:139081723-139081745 CATAAGAGAGAGAGAGAGAGAGG - Intronic
1199777895 X:151031714-151031736 GATCAGAGGGAGGCAGAGAGTGG + Intergenic
1199777910 X:151031858-151031880 AACCAGAGGGAGGCAGAGAGTGG + Intergenic
1199891999 X:152094343-152094365 CAACAGCAGGAGATTGAGAGAGG + Intergenic
1201374753 Y:13306810-13306832 CATCGGAGGGAGACTGAGGCAGG - Intronic
1201629559 Y:16055099-16055121 CATGAGAGGGACACAGTGAGAGG - Intergenic
1201770436 Y:17612940-17612962 AGTGAGAGGGAGTCTGAGAGGGG - Intergenic
1201831118 Y:18293047-18293069 AGTGAGAGGGAGTCTGAGAGGGG + Intergenic
1202258283 Y:22942791-22942813 AGTCAGAGGGAGAGAGAGAGAGG + Intergenic
1202411273 Y:24576549-24576571 AGTCAGAGGGAGAGAGAGAGAGG + Intergenic
1202459508 Y:25093523-25093545 AGTCAGAGGGAGAGAGAGAGAGG - Intergenic