ID: 1167593708

View in Genome Browser
Species Human (GRCh38)
Location 19:50417083-50417105
Sequence CTGTATCAGAAGGAGGTGAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 263}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167593698_1167593708 21 Left 1167593698 19:50417039-50417061 CCACAGGAGCCGTGTGTGAGTTC 0: 1
1: 0
2: 0
3: 11
4: 91
Right 1167593708 19:50417083-50417105 CTGTATCAGAAGGAGGTGAGAGG 0: 1
1: 0
2: 1
3: 31
4: 263
1167593695_1167593708 26 Left 1167593695 19:50417034-50417056 CCTCCCCACAGGAGCCGTGTGTG 0: 1
1: 1
2: 1
3: 26
4: 202
Right 1167593708 19:50417083-50417105 CTGTATCAGAAGGAGGTGAGAGG 0: 1
1: 0
2: 1
3: 31
4: 263
1167593702_1167593708 -4 Left 1167593702 19:50417064-50417086 CCAGCCCCGGGAGTCTGAGCTGT 0: 1
1: 0
2: 1
3: 15
4: 208
Right 1167593708 19:50417083-50417105 CTGTATCAGAAGGAGGTGAGAGG 0: 1
1: 0
2: 1
3: 31
4: 263
1167593705_1167593708 -10 Left 1167593705 19:50417070-50417092 CCGGGAGTCTGAGCTGTATCAGA 0: 1
1: 0
2: 1
3: 9
4: 184
Right 1167593708 19:50417083-50417105 CTGTATCAGAAGGAGGTGAGAGG 0: 1
1: 0
2: 1
3: 31
4: 263
1167593694_1167593708 29 Left 1167593694 19:50417031-50417053 CCGCCTCCCCACAGGAGCCGTGT 0: 1
1: 0
2: 0
3: 18
4: 247
Right 1167593708 19:50417083-50417105 CTGTATCAGAAGGAGGTGAGAGG 0: 1
1: 0
2: 1
3: 31
4: 263
1167593696_1167593708 23 Left 1167593696 19:50417037-50417059 CCCCACAGGAGCCGTGTGTGAGT 0: 1
1: 0
2: 2
3: 7
4: 152
Right 1167593708 19:50417083-50417105 CTGTATCAGAAGGAGGTGAGAGG 0: 1
1: 0
2: 1
3: 31
4: 263
1167593699_1167593708 12 Left 1167593699 19:50417048-50417070 CCGTGTGTGAGTTCTGCCAGCCC 0: 1
1: 0
2: 1
3: 20
4: 193
Right 1167593708 19:50417083-50417105 CTGTATCAGAAGGAGGTGAGAGG 0: 1
1: 0
2: 1
3: 31
4: 263
1167593697_1167593708 22 Left 1167593697 19:50417038-50417060 CCCACAGGAGCCGTGTGTGAGTT 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1167593708 19:50417083-50417105 CTGTATCAGAAGGAGGTGAGAGG 0: 1
1: 0
2: 1
3: 31
4: 263
1167593693_1167593708 30 Left 1167593693 19:50417030-50417052 CCCGCCTCCCCACAGGAGCCGTG 0: 1
1: 0
2: 1
3: 20
4: 250
Right 1167593708 19:50417083-50417105 CTGTATCAGAAGGAGGTGAGAGG 0: 1
1: 0
2: 1
3: 31
4: 263
1167593704_1167593708 -9 Left 1167593704 19:50417069-50417091 CCCGGGAGTCTGAGCTGTATCAG 0: 1
1: 0
2: 0
3: 14
4: 210
Right 1167593708 19:50417083-50417105 CTGTATCAGAAGGAGGTGAGAGG 0: 1
1: 0
2: 1
3: 31
4: 263
1167593703_1167593708 -8 Left 1167593703 19:50417068-50417090 CCCCGGGAGTCTGAGCTGTATCA 0: 1
1: 0
2: 0
3: 4
4: 89
Right 1167593708 19:50417083-50417105 CTGTATCAGAAGGAGGTGAGAGG 0: 1
1: 0
2: 1
3: 31
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167593708 Original CRISPR CTGTATCAGAAGGAGGTGAG AGG Exonic
901327461 1:8376584-8376606 CTGTATCAGAAGCTGGTGGGTGG - Intronic
901890726 1:12261339-12261361 CAGTTTCAGAAAGAGCTGAGAGG + Intronic
903496732 1:23773645-23773667 CTGTACTAGAAGGTGGTGAGAGG + Intergenic
904554329 1:31348441-31348463 GTTTAGCAGAAGGAGCTGAGTGG - Intronic
904864326 1:33565131-33565153 CTGTATGAGAAAGAGAAGAGAGG + Intronic
905993780 1:42363369-42363391 CTGAATCAATAGGAAGTGAGAGG + Intergenic
906777505 1:48543203-48543225 CTGACTCAGGAGTAGGTGAGGGG + Intronic
908264109 1:62361571-62361593 CTGTTACAGAAGGTGGTGAGCGG - Intergenic
908288564 1:62637914-62637936 ATGTATCAGCAGGAAGTTAGAGG - Intronic
909332981 1:74437226-74437248 CTGAAGCAGCAGGAAGTGAGAGG - Intronic
909622736 1:77685388-77685410 TTGTACCAAATGGAGGTGAGAGG - Intergenic
913194465 1:116444342-116444364 CTTCATCACATGGAGGTGAGTGG - Intergenic
914194908 1:145442138-145442160 CGCTGTCAGGAGGAGGTGAGAGG + Intergenic
914476182 1:148024705-148024727 CGCTGTCAGGAGGAGGTGAGAGG + Intergenic
915850360 1:159314999-159315021 CTGGATCATATGGAGGTCAGAGG + Intergenic
918402636 1:184178729-184178751 CTGTACGAGAAGGAGATCAGAGG - Intergenic
918626363 1:186660301-186660323 CTGGAGCAGAAGGAAGAGAGAGG + Intergenic
918873331 1:190005998-190006020 ATGTATTAAATGGAGGTGAGAGG - Intergenic
919132116 1:193464618-193464640 CAGTACCAGAAGGGGGTGGGAGG - Intergenic
921291455 1:213661541-213661563 CTGAATCAGGAGGAAGTCAGAGG + Intergenic
922407086 1:225325750-225325772 TTATATCAAAATGAGGTGAGGGG - Intronic
923093829 1:230759428-230759450 CTGTGTCAGAAGGGGATGTGGGG - Intronic
923407344 1:233675564-233675586 CTGTAGCAGCAAGAGGTGTGGGG + Intergenic
923877213 1:238062421-238062443 ATGAGTCAGAAGGAGGTGAAAGG - Intergenic
924955045 1:248917947-248917969 CTGTATCAGGAGAAGGTGGGTGG + Exonic
1063159283 10:3408133-3408155 CTGGAGCAGGAGGAGGTAAGAGG + Intergenic
1064362607 10:14679563-14679585 CTTTACCAGAAGGGGGTGAAAGG - Intronic
1064449816 10:15431660-15431682 CTGGCACAGCAGGAGGTGAGTGG + Intergenic
1064573894 10:16724648-16724670 CTGTCCGAGAAGGAGGTGACAGG + Intronic
1065317445 10:24477196-24477218 ATGTATAGGAAGGAGGTGAATGG + Intronic
1066746167 10:38605190-38605212 CTGTAGAAAGAGGAGGTGAGGGG - Intergenic
1067267407 10:44757526-44757548 CAGGAGGAGAAGGAGGTGAGAGG - Intergenic
1067658980 10:48219437-48219459 GTGTATCAGTAGGAGCAGAGAGG - Intronic
1067697677 10:48547614-48547636 CTGGTGCAGAAGGAGGTGAAGGG - Intronic
1068487294 10:57676607-57676629 CTGTCTAAGAATGAGGTTAGGGG + Intergenic
1069802026 10:71087747-71087769 CTGTAGCTGAGGGAGGAGAGAGG + Intergenic
1070089910 10:73274425-73274447 CTGGAAGAGAAAGAGGTGAGGGG - Exonic
1071085127 10:81861420-81861442 CTATGTAAGCAGGAGGTGAGGGG - Intergenic
1071701047 10:87936653-87936675 GTGTATAAGAAGGAGGAAAGAGG - Intronic
1073097826 10:100990681-100990703 GTGTATCATATGGAGGTGTGGGG + Intronic
1075620011 10:123919782-123919804 CTGTACAAGAAGGATGTCAGTGG + Intronic
1078491566 11:11774085-11774107 CTGAAGCTCAAGGAGGTGAGGGG - Intergenic
1079048316 11:17129217-17129239 CTAGATGACAAGGAGGTGAGGGG - Intronic
1080156467 11:29117553-29117575 CAGCCTCAGAAGGAGGTGAGTGG + Intergenic
1080451624 11:32382950-32382972 CACTATCAAAAGGAGGTGAGTGG + Intergenic
1080830671 11:35890709-35890731 CTGGTACAGCAGGAGGTGAGTGG - Intergenic
1080997548 11:37622312-37622334 CTCTATTAGAAGGTCGTGAGTGG - Intergenic
1081061042 11:38477917-38477939 CTGAAACAGCTGGAGGTGAGTGG + Intergenic
1081340330 11:41919834-41919856 CTGTACCAAAAGGAGAAGAGAGG - Intergenic
1081531346 11:43961737-43961759 CTGCATCAGAAAGAGGAGAGAGG - Intergenic
1082067341 11:47911404-47911426 CTGTGGCAGAGGGAGGGGAGAGG - Intergenic
1084603136 11:70158459-70158481 CTGTATCAGCAGGAGGGGGATGG - Intronic
1084714610 11:70865688-70865710 CTACATCAGAAGGCGGTGCGAGG - Intronic
1084983545 11:72847324-72847346 CTCTATCAGAATGAGGTCAAGGG + Intronic
1085462390 11:76701990-76702012 CTGGATCAGAACGAGGAGAAGGG + Intergenic
1089407684 11:118212017-118212039 AAGTAGCAGAAGCAGGTGAGAGG - Intronic
1089632371 11:119791779-119791801 GAGTATCAGTAGGAGGGGAGGGG - Intergenic
1091690247 12:2591337-2591359 CTGTATAAGATGAAGGTGAAGGG - Intronic
1092178769 12:6430177-6430199 CTGAAGCAGAAGGAGTTTAGGGG + Intergenic
1092292075 12:7166207-7166229 CTGCCACAGAAGGAGGTGAGTGG + Intergenic
1093395785 12:18680426-18680448 CTGTCTCTGAAAGAGGTGTGAGG - Intergenic
1094247119 12:28311335-28311357 CTGTGTCAGAGGAAGCTGAGTGG - Intronic
1094420923 12:30270531-30270553 CAGGATCAGAAGGAAGTGAAGGG + Intergenic
1094784582 12:33831891-33831913 TTCTATCAGAAGGGGGAGAGAGG + Intergenic
1095624397 12:44297452-44297474 CTGGATAACAGGGAGGTGAGAGG + Intronic
1096080494 12:48829315-48829337 CTGTATCAGGCTGTGGTGAGAGG - Intergenic
1096317557 12:50581724-50581746 CTGAGTCAGCAGGAGTTGAGTGG - Intronic
1096802981 12:54123780-54123802 CTGTTTCAGCAGGAGTTGTGGGG - Intergenic
1096936041 12:55277614-55277636 TTGAATCAGAAGGAAGGGAGAGG + Intergenic
1097240558 12:57572253-57572275 CTGTCTCAGAAGGTGGTAAGTGG + Exonic
1100562078 12:95757276-95757298 CTGTATCTGAAAGAGGGGAATGG - Intronic
1101284724 12:103298986-103299008 CTATATAATCAGGAGGTGAGGGG + Intronic
1101941818 12:109104840-109104862 GTGTATCAGCAGGAGGTAACGGG + Intronic
1102205000 12:111084192-111084214 CTGAATCAGCAGGAGTGGAGTGG + Intronic
1102726652 12:115071418-115071440 TTGGAGCAGAAGGAGGTGATGGG - Intergenic
1105703174 13:22948963-22948985 CGGTGTCAGGAGCAGGTGAGGGG - Intergenic
1107163803 13:37262702-37262724 CAGAATCAGGAGGAGGTGAGAGG + Intergenic
1107922518 13:45224282-45224304 CTAAATCAGAAGGAAGAGAGAGG - Intronic
1110430697 13:75419694-75419716 ATGTACCAGATGGAGGTGACTGG - Intronic
1110597682 13:77337171-77337193 CTGTAAAAGAGGTAGGTGAGTGG + Intergenic
1112634154 13:101196607-101196629 CTGTTTCAGTATGAGGAGAGGGG + Intronic
1113582916 13:111441272-111441294 ATGTACCAGGAGGAGGTGAGGGG - Intergenic
1113582943 13:111441386-111441408 ATGTGCCAGGAGGAGGTGAGGGG - Intergenic
1116984653 14:51205828-51205850 CTGTGGCAAGAGGAGGTGAGGGG + Intergenic
1119019974 14:71101510-71101532 CTGTATCTTAACTAGGTGAGAGG + Intronic
1119628342 14:76203226-76203248 CTTTATCAAAGGGAGGTGGGTGG + Exonic
1121329167 14:93039266-93039288 CTGTAGAACAAGGAGGTGGGGGG - Intronic
1124593787 15:31077347-31077369 CTGGAGCAGAAGGAGGTGGGAGG + Intronic
1124873459 15:33566860-33566882 CAGTATCAAAAGGAGGTGGGTGG - Intronic
1125587607 15:40832104-40832126 CTGGAACAGAGGGAGGAGAGAGG + Intergenic
1128483007 15:68055217-68055239 CTGTAGCTGATGGAGGTGAATGG + Intronic
1129112653 15:73346771-73346793 CTGCTTCTGGAGGAGGTGAGAGG + Intronic
1129709999 15:77816098-77816120 CTGTTTCAGAAGGAGGGGACTGG - Intronic
1130549111 15:84878524-84878546 CTGAAGCAGAAGGAGGTGGTTGG - Intergenic
1130923891 15:88370977-88370999 CTGGAGCAGGAGGAAGTGAGAGG - Intergenic
1131409195 15:92192091-92192113 TAGTATCAGAAGTAGATGAGTGG + Intergenic
1132227707 15:100155321-100155343 CTGTCCAAGAAGGAGGAGAGAGG + Intronic
1133691507 16:8220250-8220272 CTTTATCAGAAGGAGGGATGGGG - Intergenic
1134286004 16:12862590-12862612 GTGGGTCAGCAGGAGGTGAGCGG - Intergenic
1136019886 16:27433461-27433483 CTATCTCAAAAAGAGGTGAGCGG + Intronic
1136736893 16:32474451-32474473 CTGTAGAAAGAGGAGGTGAGGGG + Intergenic
1137453505 16:48599200-48599222 CTGTATCAGATGGGGATGAGGGG - Intronic
1137556679 16:49474682-49474704 CAGTAAGAGCAGGAGGTGAGTGG + Intergenic
1137675791 16:50303327-50303349 CTATCCCAAAAGGAGGTGAGAGG + Intronic
1138202744 16:55102118-55102140 CTGGATCAGCAGGAGGGAAGGGG - Intergenic
1138624297 16:58236930-58236952 TTGAATCTGAAGGAGGTGAAGGG + Intronic
1138845679 16:60562945-60562967 CTGTCTCAGAAGGATGAAAGGGG - Intergenic
1139247545 16:65460802-65460824 CTGAATCAGAAGGAGGTGCCAGG - Intergenic
1139949620 16:70662773-70662795 CTGGAGCAGTAGGAGGTGTGGGG - Exonic
1140121922 16:72091294-72091316 GTGTGGCAGAAAGAGGTGAGTGG + Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141350217 16:83287758-83287780 ATGGACCAGGAGGAGGTGAGGGG - Intronic
1141570571 16:84931183-84931205 CTTTCTAAGAGGGAGGTGAGGGG - Intergenic
1141777521 16:86134258-86134280 CTGTATCAGCAGGATGTGCCTGG - Intergenic
1141810448 16:86372191-86372213 CTGGTGCAGAAGGAGGTGGGTGG - Intergenic
1141873985 16:86809014-86809036 CCGGAGCAGCAGGAGGTGAGCGG - Intergenic
1203016176 16_KI270728v1_random:355126-355148 CTGTAGAAAGAGGAGGTGAGGGG - Intergenic
1203034511 16_KI270728v1_random:628284-628306 CTGTAGAAAGAGGAGGTGAGGGG - Intergenic
1143023679 17:3929208-3929230 CTGGAGGAGAGGGAGGTGAGAGG - Intronic
1143798257 17:9356024-9356046 CTGTAAAAGAAGGAACTGAGAGG - Intronic
1144531013 17:16039427-16039449 CTGTACCTGAATGAGGTGATGGG + Exonic
1144550894 17:16240038-16240060 TTGGATCAGTAGGAGGTGATTGG + Intronic
1145024043 17:19454208-19454230 CTTTGGCAGAAGGAGTTGAGTGG - Intergenic
1145239096 17:21229218-21229240 CTGTAGCCGAAGGATGTCAGAGG - Intergenic
1146994471 17:37306478-37306500 CTGTATCTTAATGAGGTGATTGG - Intronic
1147477353 17:40724789-40724811 CTTTATCAGCAGGATGAGAGTGG + Intergenic
1149923783 17:60682329-60682351 CTGAATCAGAATAAGGAGAGTGG + Intronic
1150821750 17:68440371-68440393 CTGTAACAGAAAGAGGAGACTGG - Intronic
1152378845 17:79931810-79931832 CCACATCAGCAGGAGGTGAGTGG + Intergenic
1156075315 18:33269437-33269459 CAAGATCAGCAGGAGGTGAGAGG - Intronic
1157774332 18:50379925-50379947 ATGGAACAGAAGGAGGCGAGAGG - Intronic
1158894601 18:61901173-61901195 CTGGAGCAGCAGGAGGGGAGGGG - Intergenic
1159166628 18:64710563-64710585 GTGTTGGAGAAGGAGGTGAGTGG - Intergenic
1161848757 19:6727780-6727802 CTTTATAAGAGGGAGGTGGGAGG - Intronic
1162809454 19:13155287-13155309 CAGTATCAGGTGGAGCTGAGCGG + Intergenic
1162853543 19:13450487-13450509 GTGTGTCAGATGGCGGTGAGGGG - Intronic
1164063541 19:21695167-21695189 CTCTCTCAGCAGGAGGAGAGGGG + Intergenic
1166357532 19:42235999-42236021 CTGCATTGGAAGGAGGTGGGTGG - Intronic
1167417864 19:49386678-49386700 CTGTCTCAGAAAGAGAGGAGGGG + Intergenic
1167593708 19:50417083-50417105 CTGTATCAGAAGGAGGTGAGAGG + Exonic
1167608040 19:50492286-50492308 CTGTGTCAGAAGGAGACAAGGGG - Intergenic
1167695372 19:51012552-51012574 CTGTAACAGAAGGGGGTATGGGG - Intergenic
1167860164 19:52276822-52276844 CTGATTCACAAAGAGGTGAGGGG + Intronic
924970479 2:122322-122344 CTGCATCAGACGGTGGTAAGGGG + Intergenic
926766989 2:16330541-16330563 CTAAAGCAGAAGGAGGTGGGTGG - Intergenic
927167037 2:20333937-20333959 CTGTAGCAGGAGGAAGAGAGGGG - Intronic
928331570 2:30361631-30361653 CTGTATCAGAAGTGGTTGTGGGG - Intergenic
928381428 2:30821844-30821866 TTGTATCTGAAGGAGAGGAGAGG - Intergenic
929011092 2:37445864-37445886 CTGTAACATGAGGAGGTTAGAGG + Intergenic
929073469 2:38057792-38057814 CTGGATCAGAAGGAAGAGGGAGG - Intronic
929865479 2:45713817-45713839 CTGTTTCAGAAGTAGGTCTGTGG + Intronic
930881324 2:56274030-56274052 CTGTATCTGGAGGATGGGAGAGG + Intronic
932454997 2:71843832-71843854 CTGCCTCAGAAGCAGGTAAGAGG - Intergenic
934779650 2:96961454-96961476 CAGAATCAGAGGGAGGGGAGAGG + Intronic
935271344 2:101436807-101436829 CCTTAGCAGAAGGAGGTCAGCGG - Intronic
937454307 2:122028017-122028039 CTGCATCAGAATCAGCTGAGGGG + Intergenic
940647156 2:156403665-156403687 TTGTACCAGAAGGAGTTGGGTGG - Intergenic
941654017 2:168124127-168124149 CATTATCAGAAGGAGGTAAAGGG - Intronic
944332620 2:198489418-198489440 CTGTATTGAAAGGAGGGGAGGGG - Intronic
945882512 2:215340996-215341018 CTGTAACAGAAGGAGATGAGGGG + Intronic
946139785 2:217680483-217680505 GTGTGTCAGGGGGAGGTGAGAGG + Intronic
947047276 2:226002140-226002162 CTGTTTCTGATAGAGGTGAGAGG - Intergenic
947061060 2:226166304-226166326 CTGTTTCATAAGTAGGTTAGTGG - Intergenic
1170242449 20:14183179-14183201 GCCTATCAGAAGGAGGAGAGTGG - Intronic
1170594297 20:17793717-17793739 CTGGATCAGAAGTGGGTGAGAGG + Intergenic
1170656604 20:18292645-18292667 CTGTATCAGAAAGTGATGAGTGG - Intronic
1170884541 20:20328938-20328960 CTTGATAAGAAGGAGTTGAGAGG - Intronic
1171266284 20:23774570-23774592 TTTTATCAGTAGGAGATGAGAGG + Intergenic
1171793774 20:29550808-29550830 CTGTTTCAGCAGGAGTTGTGGGG + Intergenic
1172882202 20:38209281-38209303 CTGTGTCACAAGGGTGTGAGGGG + Intergenic
1173132223 20:40404983-40405005 CTGTCTCAGAGGCAGCTGAGAGG + Intergenic
1174186300 20:48708646-48708668 TTGTTTCACAAGGAGGTCAGGGG + Intronic
1175564027 20:59958632-59958654 CTGGCTGAGAAGGAGGTGTGTGG + Exonic
1176035063 20:63032122-63032144 CTGGATCAGAGGAGGGTGAGAGG + Intergenic
1176072075 20:63232493-63232515 CTTTCTCAGAAGGAAGTTAGTGG - Intergenic
1177600663 21:23308076-23308098 GTGTAAAAGAAGGAGGTGAAAGG + Intergenic
1178755629 21:35346916-35346938 CTGGAGCAGGAGGTGGTGAGAGG - Intronic
1180535654 22:16391461-16391483 CTGTAGAAAGAGGAGGTGAGGGG - Intergenic
1180693710 22:17738820-17738842 CTGTAGCGGTAGGAGCTGAGAGG - Intronic
1182041181 22:27240014-27240036 CTTAATCAGAAGAAGGTGAGAGG - Intergenic
1183232968 22:36594324-36594346 CTATATTAGAAGGAGGTATGAGG + Intronic
1184452163 22:44589714-44589736 CCTAATCAGAAGGAGGAGAGAGG + Intergenic
953033192 3:39191088-39191110 CTACCTCAGAAGGAGGAGAGAGG + Intronic
956488107 3:69742512-69742534 CTGTAGCAGAGGGAGGTAGGAGG - Intronic
957981014 3:87510459-87510481 AGGTATCAGGAGGTGGTGAGTGG - Intergenic
961058808 3:123811199-123811221 CTGTTTCAGAAAGGGTTGAGAGG - Intronic
964847515 3:161059839-161059861 CTGGAGCAGAAGGAAGTGGGTGG - Intronic
967331155 3:188290989-188291011 TAGCATCAGAAGGAGGTGGGTGG + Intronic
969344280 4:6561456-6561478 CTGGGTCGGAAGGAGGTGGGGGG + Intronic
971762983 4:30792705-30792727 CTATCTCAGTAGGAGCTGAGGGG + Intronic
974751967 4:66153828-66153850 GGGGGTCAGAAGGAGGTGAGTGG + Intergenic
976197761 4:82549931-82549953 CTGGACCCAAAGGAGGTGAGAGG + Intronic
977564246 4:98565699-98565721 CTTTATCACAAGCAGCTGAGAGG + Intronic
979055979 4:115995142-115995164 GTTGCTCAGAAGGAGGTGAGTGG - Intergenic
982155277 4:152514193-152514215 CTGTCTCAGAAGAAGCTAAGTGG + Intronic
984888851 4:184473853-184473875 CCGGATCCGAAGGAGGGGAGCGG - Intronic
985560192 5:581732-581754 GTGTGTTAGAAGGTGGTGAGGGG + Intergenic
985998362 5:3610524-3610546 CTGTTTCAGCAGGAGTGGAGTGG + Intergenic
986087751 5:4468612-4468634 CTGACTCAGCAGGAGGAGAGAGG - Intergenic
988501977 5:31791116-31791138 CTTTATCAGAAGCAGATAAGTGG - Intronic
988614934 5:32766060-32766082 TTGGATTAGCAGGAGGTGAGAGG - Intronic
990783223 5:59390716-59390738 TTGTATGAGAAGGAGGTAAGGGG + Intronic
991246734 5:64516623-64516645 CTGTATCAGAATCATGTGGGTGG + Intronic
992850146 5:80798715-80798737 TTGTTTCAGAAGCAGGAGAGAGG - Intronic
995785344 5:115821807-115821829 CTGTTTCAGAGGGAGTTCAGGGG + Intergenic
996368343 5:122726405-122726427 CAGTATGAGAATGAAGTGAGGGG + Intergenic
996381084 5:122863242-122863264 CGGGACCTGAAGGAGGTGAGGGG + Intronic
997729322 5:136154833-136154855 CTGTATCAAATGCAGTTGAGCGG - Intronic
997873944 5:137531696-137531718 TTGTATCAGGAGGTGGTGAAAGG + Intronic
998561008 5:143171493-143171515 TTGCATCACAAGGAGGAGAGGGG + Intronic
998822789 5:146071977-146071999 CTCTATCAGACAGAAGTGAGAGG + Intronic
998979986 5:147691356-147691378 CAGTAACAGAAGGAGCTGGGTGG - Intronic
999702329 5:154239378-154239400 CTGGCACAGCAGGAGGTGAGCGG + Intronic
1001751241 5:174133240-174133262 CTGAACCAGGAGGAGGAGAGGGG - Intronic
1002660061 5:180785725-180785747 CAGGATCAGGAGTAGGTGAGCGG - Intergenic
1003603500 6:7540426-7540448 CTGTATCAGAAGGTAATTAGCGG + Intergenic
1003644519 6:7903749-7903771 CTGTTTCTGAAGGAGGTGGAGGG - Intronic
1004578693 6:16925965-16925987 CTTTATCAGAAAGAGGAGAGAGG - Intergenic
1004595138 6:17092528-17092550 CTGTTACAGATGGAAGTGAGTGG - Intergenic
1007234618 6:40381627-40381649 CTGTGTCAGAAGGATGGGTGAGG + Intergenic
1007610927 6:43148246-43148268 CTGTCTCAAAGGGAGGGGAGGGG + Intronic
1008658981 6:53646031-53646053 AGGTATCAGAAGGAGGTCAGAGG - Intergenic
1008909432 6:56717345-56717367 CTGTTACAGCAGGAGGTGAGTGG - Intronic
1009901609 6:69813754-69813776 CTGTCTCAGAAGGAGGTTACTGG + Intergenic
1011231558 6:85167236-85167258 CTCTATCAGAAGATGGTGATTGG + Intergenic
1011571892 6:88746699-88746721 CTGCAACAGCAGGAGGTAAGTGG - Intronic
1011890569 6:92154180-92154202 CTGTATGAGAAAGAGTTTAGTGG + Intergenic
1012693804 6:102353103-102353125 CTGTATCAAAATGAAATGAGGGG + Intergenic
1012829259 6:104185733-104185755 CTATATGAGAAGGAGTTGACAGG + Intergenic
1013233608 6:108177297-108177319 CTGCCTCAGAAGTAGGTGAGGGG - Intronic
1015731548 6:136353378-136353400 CTGTATTAAAAAGAGGTTAGGGG + Intronic
1015816086 6:137212260-137212282 CTGTCTCAAAAGGAGGGGAGTGG - Intronic
1016817410 6:148316000-148316022 CTGTATCTCAAGGCTGTGAGGGG - Intronic
1017989316 6:159472396-159472418 CTGGATCAGGAGGAAGAGAGAGG + Intergenic
1018095611 6:160384843-160384865 CTGCATGGGAAAGAGGTGAGTGG - Intronic
1018789684 6:167137869-167137891 CTGTATCAAAGGGAAATGAGAGG - Exonic
1019816364 7:3204039-3204061 CTGGAGCAGGAGGAGGAGAGAGG + Intergenic
1020361516 7:7331579-7331601 CAGAATTAGAAGGAGGTGAGAGG + Intergenic
1021154146 7:17188783-17188805 TTGTAGCATTAGGAGGTGAGTGG - Intergenic
1022708457 7:32829438-32829460 CTGTCACAGCAGGAGTTGAGTGG + Intergenic
1022824481 7:33994822-33994844 CTGAATCCCAAAGAGGTGAGTGG - Intronic
1022914717 7:34936039-34936061 CTGTCACAGCAGGAGTTGAGTGG - Intronic
1023055578 7:36287299-36287321 CTATATAAGAAGGAGGTGGAAGG - Intronic
1023982671 7:45078925-45078947 GGATATCAGAAGGCGGTGAGGGG + Intergenic
1023982701 7:45079090-45079112 AGATATCAGAAGGCGGTGAGGGG + Intergenic
1026584660 7:71646625-71646647 CTGTAACAAAAGCAAGTGAGAGG + Intronic
1028270483 7:88782264-88782286 CTCTATCAGAAGGAGATCAGAGG + Intronic
1030561669 7:111094697-111094719 CTTTATCAGAAGGAGAGGAGAGG - Intronic
1033257215 7:139812586-139812608 CAGTATCAAAATGAGTTGAGGGG + Intronic
1033289027 7:140065701-140065723 CTGTACCAGAGGGAGGAGACAGG + Intergenic
1033680511 7:143590209-143590231 CTATATCAGAATGAGAGGAGAGG - Intergenic
1033704383 7:143871602-143871624 CTATATCAGAATGAGAGGAGAGG + Intronic
1035820207 8:2583466-2583488 CAGAAGCAGAAGGAGGTGTGTGG - Intergenic
1036611009 8:10349901-10349923 CTGTAACAAAAGGGGGTGACAGG - Intronic
1037530112 8:19764847-19764869 CAGGAACAGCAGGAGGTGAGTGG - Intergenic
1038037645 8:23700082-23700104 CTGTGTTAGAAGAGGGTGAGAGG + Intergenic
1038916046 8:32024265-32024287 CTGTATTAAAGGGAAGTGAGTGG + Intronic
1040570683 8:48606516-48606538 CAATAGCAGAAGGAAGTGAGCGG + Intergenic
1040914990 8:52559637-52559659 CTGTTTCAGAACCAGCTGAGAGG - Intronic
1041748937 8:61238076-61238098 CTGTGTCAGGAAGAGGTGTGGGG - Intronic
1042339355 8:67662901-67662923 CTGAATCACACTGAGGTGAGGGG + Intronic
1044540216 8:93400218-93400240 CTATGTCAGAATGTGGTGAGAGG + Intergenic
1044588948 8:93895358-93895380 TGGTAGGAGAAGGAGGTGAGGGG - Intronic
1045192432 8:99896153-99896175 ATATATCTGAAGGAGGTAAGTGG + Intergenic
1046064477 8:109180589-109180611 CTGGATCTGAAGGAGGTGGTGGG - Intergenic
1047979688 8:130167528-130167550 CTGGATCAGAAAGAAGTAAGTGG - Exonic
1048972886 8:139655116-139655138 CAGTATCTGAGGGAGGGGAGTGG - Intronic
1049256984 8:141619418-141619440 CTGTATGAGAAGCAGCTGGGAGG - Intergenic
1049889428 9:54837-54859 CTGGAACAGAAGGAGGAGGGCGG - Intergenic
1050965694 9:11798753-11798775 CTTTATCTGAAAAAGGTGAGAGG - Intergenic
1053050168 9:34955115-34955137 CTTTATGAGAGCGAGGTGAGAGG - Intergenic
1054152655 9:61617957-61617979 CTGTTTCAGCAGGAGTTGTGGGG + Intergenic
1055105206 9:72504959-72504981 CTGTGGCAACAGGAGGTGAGAGG - Intergenic
1055928835 9:81539013-81539035 CTGAATCAGCAGAAGGTGGGAGG + Intergenic
1056120089 9:83479204-83479226 CTTTAGGAGAATGAGGTGAGAGG + Intronic
1057141464 9:92729016-92729038 CAGGAGCTGAAGGAGGTGAGGGG - Exonic
1059333065 9:113548670-113548692 CTGTATGAGGAGGGGGTGTGAGG - Intronic
1059786752 9:117594439-117594461 CTGTATCAGCAGGAGAAGAAAGG + Intergenic
1060230553 9:121822377-121822399 GTGTATCACCAGGAGGTGTGAGG + Exonic
1061256523 9:129456757-129456779 CTGTATGAGTGGGTGGTGAGTGG + Intergenic
1061377091 9:130233001-130233023 ATGGCACAGAAGGAGGTGAGTGG - Exonic
1061755751 9:132811325-132811347 CCTTATAAGAAGGAGGTAAGAGG + Intronic
1185985617 X:4829028-4829050 CTGGCACAGCAGGAGGTGAGCGG - Intergenic
1186079881 X:5919519-5919541 CTGGGCCAGCAGGAGGTGAGTGG + Intronic
1186397742 X:9226583-9226605 CTGAGTCACAGGGAGGTGAGAGG + Intergenic
1186672260 X:11779907-11779929 ATGGATTAGAAAGAGGTGAGAGG + Intergenic
1186808124 X:13160600-13160622 CTGTCTCAGAAAGAGGTATGAGG + Intergenic
1188546013 X:31308124-31308146 CTGGAACAGCAGGAGGTGAGTGG - Intronic
1188890951 X:35610719-35610741 CAGTCTGGGAAGGAGGTGAGAGG - Intergenic
1192420255 X:71023020-71023042 CTGTCTCAGAAGGACAGGAGGGG + Intergenic
1193328168 X:80206719-80206741 CTGTATCAGAATGAGTGAAGAGG - Intergenic
1196819594 X:119692604-119692626 CTGGGGCAGAAGGCGGTGAGTGG - Intronic
1198817675 X:140609456-140609478 CTGAAGCAGAAGGAAGAGAGTGG - Intergenic
1199761668 X:150909283-150909305 CAGGATGAGAAGGAGGTGAGGGG + Intergenic
1200228032 X:154430077-154430099 CTATATCAGAGGGCTGTGAGTGG + Intronic
1201115683 Y:10833555-10833577 CTGAATGGGAAGGAGTTGAGTGG - Intergenic