ID: 1167595185

View in Genome Browser
Species Human (GRCh38)
Location 19:50423715-50423737
Sequence GGCCCTCGTGGCTGGCCCCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 185}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167595180_1167595185 7 Left 1167595180 19:50423685-50423707 CCTGGAGGTCTCGGACAGCGAGT 0: 1
1: 0
2: 0
3: 5
4: 39
Right 1167595185 19:50423715-50423737 GGCCCTCGTGGCTGGCCCCGAGG 0: 1
1: 0
2: 1
3: 15
4: 185
1167595177_1167595185 13 Left 1167595177 19:50423679-50423701 CCCTGCCCTGGAGGTCTCGGACA 0: 1
1: 0
2: 1
3: 19
4: 217
Right 1167595185 19:50423715-50423737 GGCCCTCGTGGCTGGCCCCGAGG 0: 1
1: 0
2: 1
3: 15
4: 185
1167595174_1167595185 24 Left 1167595174 19:50423668-50423690 CCGTTGGACAGCCCTGCCCTGGA 0: 1
1: 0
2: 4
3: 38
4: 328
Right 1167595185 19:50423715-50423737 GGCCCTCGTGGCTGGCCCCGAGG 0: 1
1: 0
2: 1
3: 15
4: 185
1167595178_1167595185 12 Left 1167595178 19:50423680-50423702 CCTGCCCTGGAGGTCTCGGACAG 0: 1
1: 0
2: 0
3: 9
4: 177
Right 1167595185 19:50423715-50423737 GGCCCTCGTGGCTGGCCCCGAGG 0: 1
1: 0
2: 1
3: 15
4: 185
1167595179_1167595185 8 Left 1167595179 19:50423684-50423706 CCCTGGAGGTCTCGGACAGCGAG 0: 1
1: 0
2: 0
3: 7
4: 59
Right 1167595185 19:50423715-50423737 GGCCCTCGTGGCTGGCCCCGAGG 0: 1
1: 0
2: 1
3: 15
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167595185 Original CRISPR GGCCCTCGTGGCTGGCCCCG AGG Exonic