ID: 1167595885

View in Genome Browser
Species Human (GRCh38)
Location 19:50427931-50427953
Sequence CAGATCCAGGAGATGGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 519
Summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 470}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167595877_1167595885 -7 Left 1167595877 19:50427915-50427937 CCCTCACCCCACTTTTCAGATCC 0: 1
1: 0
2: 1
3: 19
4: 266
Right 1167595885 19:50427931-50427953 CAGATCCAGGAGATGGAGGCCGG 0: 1
1: 0
2: 5
3: 43
4: 470
1167595878_1167595885 -8 Left 1167595878 19:50427916-50427938 CCTCACCCCACTTTTCAGATCCA 0: 1
1: 0
2: 1
3: 32
4: 278
Right 1167595885 19:50427931-50427953 CAGATCCAGGAGATGGAGGCCGG 0: 1
1: 0
2: 5
3: 43
4: 470
1167595875_1167595885 16 Left 1167595875 19:50427892-50427914 CCAGGTGTATGTAACAGCCACTT 0: 1
1: 0
2: 1
3: 7
4: 99
Right 1167595885 19:50427931-50427953 CAGATCCAGGAGATGGAGGCCGG 0: 1
1: 0
2: 5
3: 43
4: 470
1167595876_1167595885 -1 Left 1167595876 19:50427909-50427931 CCACTTCCCTCACCCCACTTTTC 0: 1
1: 0
2: 8
3: 96
4: 1010
Right 1167595885 19:50427931-50427953 CAGATCCAGGAGATGGAGGCCGG 0: 1
1: 0
2: 5
3: 43
4: 470

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167595885 Original CRISPR CAGATCCAGGAGATGGAGGC CGG Intronic
900816474 1:4850838-4850860 CAAATCCAAGAGTTGGAGTCAGG + Intergenic
900987258 1:6080366-6080388 CACATCCGGGAGGAGGAGGCTGG + Intronic
901399779 1:9007846-9007868 CAGCTACAGGAGGCGGAGGCAGG - Intronic
902078652 1:13806235-13806257 CAGAGCCCAGGGATGGAGGCGGG - Intronic
902078664 1:13806268-13806290 CAGAGCCCAGGGATGGAGGCGGG - Intronic
902510739 1:16965775-16965797 CAGGTCCTGGAGATGGTGGCTGG - Exonic
903231818 1:21926973-21926995 CAGGACCAGGAGGTGGGGGCCGG + Intronic
903323080 1:22554085-22554107 CAGATCATGGAGAAGGAGCCAGG - Intergenic
903663705 1:24994339-24994361 CAGAACCAGGAGCTGGAATCAGG - Intergenic
903757604 1:25673383-25673405 CAGAGCCAGGATATGAATGCAGG - Intronic
903770669 1:25762204-25762226 TAAGTCCAGGAGATTGAGGCTGG - Intronic
903959885 1:27050227-27050249 CAGATACAGGAGAAGGTGGAGGG + Intergenic
904362990 1:29990568-29990590 CAGATTAAGGAGGTGGAGACAGG - Intergenic
904705880 1:32390365-32390387 AAGATACAGGAGATGGAAGAAGG + Intronic
905587374 1:39131273-39131295 CTTACTCAGGAGATGGAGGCAGG - Intronic
905793692 1:40803488-40803510 CAGGCCCAGCTGATGGAGGCAGG - Intronic
907542872 1:55232656-55232678 CAGATCCTGGAGAGGGACTCTGG + Intergenic
907547670 1:55276296-55276318 CTGATCCTGGAGGTGGAGTCAGG - Intergenic
909490024 1:76215849-76215871 CAGCTTCAGGAGATGGATGTAGG + Intronic
911061101 1:93748465-93748487 CTGATCCAAGGGATGGAGTCAGG - Intronic
912013416 1:105001061-105001083 CAGATCCATGAGACTGTGGCAGG + Intergenic
912417615 1:109520805-109520827 CAGACTCAGGAGATTGAAGCGGG - Intergenic
912863097 1:113232468-113232490 CAGATCCTGAAGCTGGAAGCAGG - Intergenic
913022951 1:114805230-114805252 CTGATGCAGGAGAAGCAGGCAGG + Intergenic
913152677 1:116060886-116060908 CAGCTCCAGAAGGTGGAGTCTGG + Intronic
913474946 1:119228098-119228120 CAGAGCCACGAATTGGAGGCTGG + Intergenic
914245289 1:145881171-145881193 CAGCTACAGGAGACTGAGGCAGG + Intronic
914950630 1:152110653-152110675 CAGCTCCAGGAGGAGGAGGACGG - Exonic
915037740 1:152942835-152942857 AGGATGCACGAGATGGAGGCAGG - Intergenic
915253171 1:154605080-154605102 GAGATCCAGGAGATGAGGCCAGG - Intronic
915594644 1:156889224-156889246 CAGGTAAAGGAGATGAAGGCAGG - Intergenic
916890014 1:169105813-169105835 CAGGTGCAGGAGCGGGAGGCGGG + Exonic
917049492 1:170903675-170903697 AAGATGCAGGAGATGAGGGCTGG - Intergenic
917119769 1:171635184-171635206 GAGCACCAGGAGATGGAGGTGGG + Intergenic
918038250 1:180896195-180896217 CAGATCAGGGATAAGGAGGCTGG + Intergenic
918094660 1:181324920-181324942 CAGATGCAGGAGATGGAAGGAGG - Intergenic
918105167 1:181410464-181410486 CAGATGCTGGAGATGGAGAAGGG + Intergenic
919906977 1:202085095-202085117 AAGATCCCGGAGATGGGGGGTGG + Intergenic
920951817 1:210579128-210579150 CAGACACGGGAGATGGAGGGTGG + Intronic
921823188 1:219640949-219640971 CAGATCCAGGGCCTGGAGTCAGG - Intergenic
922212096 1:223494254-223494276 AAGGTCCAGGAGAAGGAGACAGG - Intergenic
922469164 1:225865332-225865354 CAATTCCTGCAGATGGAGGCTGG - Intronic
923186322 1:231577013-231577035 AAGATCCAAAAGCTGGAGGCTGG - Intronic
923201551 1:231717471-231717493 CAGAGTCAGCAGAGGGAGGCGGG - Intronic
924621027 1:245660925-245660947 CAGCTACAGGAGGTTGAGGCAGG - Intronic
1062807792 10:437199-437221 CACATCCAGGAGGTGGAGCTTGG - Intronic
1063102568 10:2963257-2963279 CAGGCCCAGGAGATGGAGGGTGG - Intergenic
1063469458 10:6272764-6272786 CAGATCCAGGATATGGAACAGGG - Intergenic
1063847246 10:10144336-10144358 AAGATGAAGGAGATGGTGGCTGG - Intergenic
1064961995 10:20975701-20975723 GAGATGCTGGAGTTGGAGGCAGG - Intronic
1065022417 10:21510819-21510841 CAGATCTAGGAGGTGGGGGAGGG - Intergenic
1067232214 10:44419816-44419838 CAAATACAGGTCATGGAGGCTGG - Intergenic
1068850673 10:61736337-61736359 CATATGCAGAAGATTGAGGCTGG - Intronic
1069200902 10:65615276-65615298 CAGCTCCAGCCAATGGAGGCAGG - Intergenic
1069510368 10:69037658-69037680 CAGAGCCCGGAGATGCAGGCAGG + Intergenic
1069745106 10:70710050-70710072 CAGATGCTGGGGATGGGGGCCGG + Intronic
1069822744 10:71237685-71237707 CACAGGCTGGAGATGGAGGCAGG - Intronic
1069855626 10:71439484-71439506 TAGGCCCAGTAGATGGAGGCAGG - Intronic
1070701044 10:78601975-78601997 CAGTGCCAGGAGAGGCAGGCAGG - Intergenic
1070711665 10:78687432-78687454 CAGAGACTGGAGATGGAGGAAGG + Intergenic
1072594682 10:96860361-96860383 CAGACACGGAAGATGGAGGCAGG + Intronic
1073082965 10:100871459-100871481 CAGCTCCAGGAGTTGGATGAGGG - Intergenic
1073420686 10:103421499-103421521 CTGATTCAGGAGGAGGAGGCTGG - Exonic
1075194851 10:120347698-120347720 CACTGCCAGGGGATGGAGGCGGG - Intergenic
1076876759 10:133220045-133220067 CACATCCAGCAGCTGGAGACAGG + Exonic
1077090292 11:775316-775338 CACGTCCAGGAGAAGGAAGCTGG + Intronic
1077847300 11:6039524-6039546 CAGAACCAGGAGAAGGAAGGAGG - Intergenic
1078196051 11:9137994-9138016 CAGGCCCAGGGGATGGAGACAGG + Intronic
1078997827 11:16721983-16722005 CATATGCAGAAGATGGAAGCTGG + Intronic
1079414060 11:20216393-20216415 AAGATCCAGGAGATAGAGATTGG - Intergenic
1079451321 11:20601773-20601795 CAGTGCCAGGTGATGGATGCGGG + Intronic
1079939420 11:26659615-26659637 TAAGCCCAGGAGATGGAGGCTGG + Intronic
1080533283 11:33197578-33197600 CAGAGCCAGGAGATGGAATCAGG + Intergenic
1080617269 11:33955571-33955593 AAGAGCCAGCTGATGGAGGCAGG - Intergenic
1081563514 11:44241156-44241178 CGGATCCTGGAAATGGAAGCTGG - Intronic
1081579044 11:44339460-44339482 CAGTTCCAGGAGACGGGGCCTGG + Intergenic
1081686922 11:45049342-45049364 CACAGACAGGAGGTGGAGGCAGG + Intergenic
1081850608 11:46272755-46272777 AAGAGCGAGGAGATGGAGGGTGG + Intergenic
1081979963 11:47260014-47260036 CAGATCCAGGACCTGGAATCTGG - Intronic
1082785040 11:57312089-57312111 CAGAGCCAGGAGATGAACCCAGG + Intronic
1082917347 11:58451772-58451794 CACATCAAGGAGATGCAAGCTGG - Intergenic
1083220678 11:61250268-61250290 CAGACCCAGGACTTGGACGCAGG - Intronic
1083379648 11:62254891-62254913 CAGAACCAGGATATGAAGTCAGG - Intergenic
1084084730 11:66849797-66849819 CAGATCCAGGGGAGGGAGGGAGG + Exonic
1084334475 11:68448685-68448707 CAGCTCCAGAAGATGCAGGCCGG - Intronic
1084568995 11:69948504-69948526 AAGACCCAGGACCTGGAGGCCGG - Intergenic
1084652250 11:70496078-70496100 CAGACCCAGAAGATGCAGGACGG + Intronic
1085094960 11:73753002-73753024 CAGAGTCAGGAGCTTGAGGCGGG + Intronic
1085376896 11:76071882-76071904 AAGATCCAGGAGATGGGAGTGGG + Intronic
1085579783 11:77639911-77639933 CAGTCCCAGGAGATGGGGACGGG - Intergenic
1087555968 11:99721427-99721449 CATATGCAGAAGATGGAAGCTGG + Intronic
1088115678 11:106310131-106310153 CAGAGCCAGGAGATGGTTCCTGG + Intergenic
1088550775 11:111010324-111010346 CAGGGCCACGAGAGGGAGGCTGG + Intergenic
1088630774 11:111772019-111772041 CAGAGGTAGGAGATGGAGGAGGG - Intergenic
1088797288 11:113274450-113274472 CAGTTCCAGGAAAGGGAGTCGGG - Intronic
1089151987 11:116371491-116371513 CAGAGGCAGGGGATGGGGGCAGG + Intergenic
1089647328 11:119888917-119888939 TAGCTCAAGGAGATGGAGGTGGG + Intergenic
1089874632 11:121708150-121708172 CAGAGAGAGGAGATGGAGTCAGG - Intergenic
1089985304 11:122807415-122807437 CAAACCCAGGAAATGGACGCTGG - Intronic
1090096828 11:123750569-123750591 CAGATCCAAGAAAAGGAGGAAGG - Intergenic
1090323758 11:125867278-125867300 TAGTTTCGGGAGATGGAGGCTGG + Intergenic
1091391518 12:129039-129061 CAGATGCAGCAGATGGGGTCGGG - Intronic
1091524920 12:1290069-1290091 CAGAGCCAGAAGATGAATGCAGG - Intronic
1091837562 12:3596297-3596319 GAGATCAAGGAGATCAAGGCAGG - Intergenic
1092057959 12:5522899-5522921 CAGGCCCATGAGATGGAAGCAGG - Intergenic
1092233836 12:6793209-6793231 CAGAACAGGGAGCTGGAGGCAGG + Intronic
1092275886 12:7060728-7060750 CAGAACCAGGACAGGGAGGCTGG + Intronic
1096252917 12:50044796-50044818 TAGAGGTAGGAGATGGAGGCCGG - Intergenic
1098150906 12:67545352-67545374 AAGAGACAGGAGATGGAGACAGG - Intergenic
1098247183 12:68532131-68532153 CAGATTGGGGAGAGGGAGGCAGG + Intergenic
1100270855 12:93023176-93023198 CAGAGCCAGGAGTTGAAGCCAGG - Intergenic
1100315585 12:93441819-93441841 CAGAGCGAAGAGCTGGAGGCCGG + Intronic
1100371862 12:93975973-93975995 CAGATCCAGGAGACAGGGGAAGG - Intergenic
1100692973 12:97058568-97058590 AATATCAAGGAGATGGAGCCAGG + Intergenic
1101593161 12:106140052-106140074 CAGATCCTGGCGATGGTGACAGG + Intergenic
1101836062 12:108296190-108296212 CAGATCCAGGATGTGGATGCAGG - Intronic
1101994215 12:109513131-109513153 GAGGCCCAGGAGATGAAGGCTGG - Intronic
1102529152 12:113533250-113533272 CACAGCCGGGAGATGGAGGAAGG - Intergenic
1102922018 12:116798678-116798700 CAGATTCAGGAGGCTGAGGCGGG - Intronic
1103747715 12:123137279-123137301 CAGCTCCAGGAAAAGGTGGCAGG - Intronic
1104062489 12:125280548-125280570 TAGGTCCAGGGGAGGGAGGCAGG - Intronic
1104502434 12:129299141-129299163 CAGAGCCATGAGATGTTGGCTGG + Intronic
1104917882 12:132275354-132275376 CAGAGCCAGGAGAGGTTGGCTGG + Intronic
1106449317 13:29865471-29865493 CATACCCAGGAGCTGGAGGCAGG - Intergenic
1106701043 13:32228915-32228937 ATGATGCAGCAGATGGAGGCAGG + Intronic
1107649125 13:42526524-42526546 CAGATCAAAGAGAAAGAGGCAGG + Intergenic
1107718916 13:43227946-43227968 CAGATGCAGGAGTGGGAGGTGGG - Intronic
1107816661 13:44250575-44250597 CAGTTCAATGAGATGGTGGCTGG + Intergenic
1110966673 13:81708382-81708404 CAGATGCAGAAGATTGAAGCTGG - Intergenic
1112183223 13:97105235-97105257 CAGATGCTGGTGATGGAGACAGG - Intergenic
1112755317 13:102625786-102625808 GAGCTCCAGGAGAAGTAGGCAGG - Intronic
1112988594 13:105482619-105482641 CAGTTCCAGGAGGCTGAGGCAGG - Intronic
1112996918 13:105585693-105585715 CAGCCCCGGGAGATGGAGACAGG + Intergenic
1113952956 13:114081887-114081909 CAGCCCCAGGAGATGCAGCCTGG - Intronic
1114200664 14:20517053-20517075 AGGATACAGGAAATGGAGGCAGG - Intergenic
1114436076 14:22708894-22708916 CATATCCAGGAGAGAGAGGATGG - Intergenic
1116942984 14:50809336-50809358 CAGATCCTGGAGGAGAAGGCAGG - Intronic
1117740574 14:58815269-58815291 AGGACTCAGGAGATGGAGGCAGG - Intergenic
1117804311 14:59474611-59474633 CAGATCCAGGTCATGAAGGTGGG - Intronic
1118019899 14:61700645-61700667 CATATCCAGAAGAGGGATGCTGG + Intronic
1118299892 14:64605920-64605942 AAGATCCAGGAGAGGGAAGATGG + Intergenic
1118839765 14:69501530-69501552 CAGTTACAGTAGCTGGAGGCTGG - Intronic
1119400354 14:74358503-74358525 GAGAAGCAGGAGAAGGAGGCTGG + Exonic
1119535937 14:75402287-75402309 CAGAACCCGGAGGTGCAGGCTGG + Intergenic
1119806047 14:77483012-77483034 CAGGTCCAGCAGATGCATGCTGG - Intronic
1119924781 14:78482980-78483002 CAGATGCTGGGGATGGAGACAGG - Intronic
1120145969 14:80978663-80978685 CAGGTGCTGCAGATGGAGGCTGG + Intronic
1121039458 14:90733357-90733379 CAGATGAAGGAGAAGGAGCCGGG - Intronic
1121316538 14:92964340-92964362 CAGAGCCAGGACAAGGAGCCAGG + Intronic
1121922316 14:97893661-97893683 CAGATACAGGACCTGGAGCCAGG + Intergenic
1122024103 14:98862345-98862367 CAGATGCAGAACTTGGAGGCAGG + Intergenic
1123786079 15:23674963-23674985 CAGAACCAGGAGAGAGAGGAAGG - Intergenic
1123833059 15:24161562-24161584 CATATCAGGGAGATGGAGACTGG + Intergenic
1123839782 15:24236625-24236647 CATATCAGGGAGATGGAGACTGG + Intergenic
1123852845 15:24378323-24378345 CATATCAGGGAGATGGAGACTGG + Intergenic
1123868698 15:24549740-24549762 CATATCAGGGAGATGGAGACTGG + Intergenic
1126924729 15:53571380-53571402 TAGTTTCAGGAGCTGGAGGCAGG - Intronic
1127915578 15:63452272-63452294 CAGATTTAGGAGATGGGTGCTGG + Intergenic
1128310519 15:66629169-66629191 CAGACCCAGGGGAAGGAGGAGGG + Intronic
1128332185 15:66763145-66763167 CAGAACTAGGAGATGGAAGGTGG + Intronic
1129148409 15:73670755-73670777 CAGATTCAATAGATGAAGGCTGG - Intergenic
1129171340 15:73810014-73810036 CAGACTCAGGAGAGGGAGGAAGG + Intergenic
1131294925 15:91139452-91139474 CAGAGCTGGGAAATGGAGGCAGG + Intronic
1131430076 15:92380253-92380275 CAGACCCACCAGAAGGAGGCTGG - Intergenic
1132809637 16:1791351-1791373 CAGCTCCAGGAGGTCAAGGCGGG - Exonic
1133018629 16:2956158-2956180 CAGCTCCAGGGGCTGGGGGCGGG - Intergenic
1133050752 16:3115959-3115981 CAGAACCAGCAGATGCAGGAAGG - Intronic
1133548549 16:6831707-6831729 CAAACCCAAGAGATGGAGGAAGG - Intronic
1134123887 16:11603307-11603329 CCCATCCTGGGGATGGAGGCAGG - Intronic
1135122813 16:19781101-19781123 TAAATCCAGGAGAGGGAGACTGG + Intronic
1135190329 16:20349020-20349042 CAGACGCAGGAGAAGGAGCCTGG + Exonic
1135857998 16:26029760-26029782 CAGTTCCAGGAGAAGGGTGCTGG + Intronic
1135922274 16:26661967-26661989 CATATGCAGAAGATGGAAGCTGG - Intergenic
1136185683 16:28587555-28587577 CAGGGCCAGAAGATGGAGGTAGG - Intronic
1136234160 16:28904177-28904199 CAGATCCAGAAGATGAAAGAAGG + Exonic
1136347694 16:29686800-29686822 CAAGGCCAGGAGTTGGAGGCTGG - Intronic
1137904835 16:52310507-52310529 CTGAACCAGGAGCAGGAGGCTGG + Intergenic
1138551644 16:57751929-57751951 GAGATCCCAGAGCTGGAGGCAGG - Exonic
1138642558 16:58396982-58397004 CACCTCCAGGAGAGGGCGGCTGG + Intronic
1138961381 16:62034515-62034537 CAGATCCGAGGGATGGGGGCTGG - Intronic
1139381855 16:66537444-66537466 CAGAGGCAGGAAACGGAGGCAGG - Intronic
1140264753 16:73410693-73410715 GACATCCAGTAGATGGAGGAAGG + Intergenic
1141079012 16:81034760-81034782 CTGATTCTGGAGATGGAGGAAGG + Intergenic
1141220585 16:82065733-82065755 CAGATGAAGGAGAAGGTGGCTGG + Intronic
1141895494 16:86956361-86956383 CAGCTGCATGAGATGGTGGCTGG - Intergenic
1142122942 16:88396278-88396300 CAGAGCCAGGAGATGAAGACAGG - Intergenic
1142691063 17:1606286-1606308 CAGATCCTGGAGAGGAGGGCAGG - Intronic
1143141525 17:4744225-4744247 AAGATCCACGTGGTGGAGGCCGG + Exonic
1143176384 17:4957600-4957622 CAGCTCCAGGAGAGGGGAGCAGG + Intergenic
1145931656 17:28690299-28690321 CAGTTCCAACAGATTGAGGCAGG + Intronic
1146268421 17:31468376-31468398 CAGAGCCAGGATTTGGATGCAGG - Intronic
1146977895 17:37131348-37131370 CTGACCCAGCAGATGGAAGCCGG + Intronic
1147202835 17:38814972-38814994 AAGATGGAGGAGAAGGAGGCAGG - Exonic
1147319839 17:39639553-39639575 GAGCTCCAGTAGATGGTGGCTGG + Intronic
1147320388 17:39642414-39642436 CAGCTCCAGGAGAGGCAGCCTGG + Intronic
1147513266 17:41091927-41091949 TAGATCCAGGAGTTAAAGGCCGG - Intronic
1147581948 17:41631984-41632006 CCGAGCAAGGAGATGGGGGCTGG - Intergenic
1147600219 17:41740523-41740545 CAGAGCCTGGACATGGACGCAGG - Intergenic
1147793859 17:43029009-43029031 CAGAACCAGGATATGGGGACTGG - Exonic
1148098900 17:45075093-45075115 TTGAGCCAGGAGTTGGAGGCAGG + Intronic
1148555166 17:48574445-48574467 CAGCTCCGGTAGTTGGAGGCTGG - Intronic
1148646127 17:49220388-49220410 CAGATCCAAGAGAGGTGGGCTGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149639489 17:58193598-58193620 GGAATCCAGGAGAGGGAGGCAGG + Intronic
1149648103 17:58255007-58255029 CAGAGCCAGGAGTGGGAGCCAGG - Intronic
1149648185 17:58255607-58255629 CAGAGCCAGGAGTGGGAGCCAGG + Intronic
1149684657 17:58528426-58528448 TAGAACCAGCAGATGGAGGCTGG + Intronic
1150437257 17:65163766-65163788 CAGAACCAGAGGCTGGAGGCAGG + Intronic
1151380748 17:73724214-73724236 CAGTGCTAGGAGAGGGAGGCTGG + Intergenic
1152929278 17:83101676-83101698 CGGGACCAGGACATGGAGGCCGG + Intergenic
1153577706 18:6539335-6539357 CAGAGCCAGGAGAGAGAGGAGGG + Intronic
1153868680 18:9296978-9297000 CAGATCCGGGAGAAGCCGGCAGG - Intergenic
1154297569 18:13163700-13163722 CAGATCCAGAAGAAGGAGAAAGG + Intergenic
1155630412 18:27886494-27886516 CAGATCCCAGAGATGGAGGCAGG + Intergenic
1156409581 18:36815056-36815078 CAGGTACACCAGATGGAGGCTGG + Intronic
1156461010 18:37321323-37321345 GAGATCCTGGAGATAGAGGCAGG - Intronic
1157408471 18:47443832-47443854 CAGCTCCAGAACATTGAGGCAGG - Intergenic
1157818489 18:50748504-50748526 GAGCCCCAGGAGAGGGAGGCAGG - Intergenic
1158330072 18:56352262-56352284 GAGATCCAGGAGACGCAGGGTGG + Intergenic
1158699873 18:59736097-59736119 GAAATACAGGAGCTGGAGGCAGG - Intergenic
1158790941 18:60779756-60779778 CACATGCAGGAGATTGAAGCTGG + Intergenic
1159814144 18:73052536-73052558 CAGAGCCAAGTGATGGAAGCAGG - Intergenic
1160116260 18:76082147-76082169 CAAATCCTGCAGATCGAGGCAGG + Intergenic
1160150066 18:76391885-76391907 CAGAGCCAGCAGGAGGAGGCCGG + Intronic
1160514338 18:79470201-79470223 CCGACCCTGGAGGTGGAGGCAGG + Intronic
1160723726 19:608564-608586 CAGAGCCTGGAGATGGACGTGGG + Intronic
1160724195 19:610451-610473 GGGCTCCAGGAGAGGGAGGCCGG - Intronic
1160906526 19:1454017-1454039 CAGGGCCAGCAGAGGGAGGCAGG + Intronic
1161216707 19:3098346-3098368 CAGATCCAAGAGCTGCTGGCAGG - Intronic
1161445409 19:4316010-4316032 CACATCTGGGAGGTGGAGGCAGG - Intronic
1161768310 19:6218620-6218642 CAGCTGCAGGAGGAGGAGGCGGG - Intronic
1161935375 19:7368625-7368647 CAGATGCAGGAGAAAGAGGGAGG + Intronic
1161943179 19:7418624-7418646 CAGATGGGGGAAATGGAGGCAGG + Intronic
1162662495 19:12181333-12181355 CAGATCAAGGAGAGTTAGGCCGG - Intronic
1162921588 19:13906372-13906394 CAGAGCCCGGGGAAGGAGGCAGG + Exonic
1163208562 19:15822632-15822654 TAAATCCAGGAGGTTGAGGCAGG - Intergenic
1163459754 19:17429965-17429987 GGGAGCCAGGAGATGCAGGCAGG - Intronic
1163689332 19:18730278-18730300 CAGATCCAGGGGAGGCAGGAGGG - Intronic
1163723435 19:18909251-18909273 CAGCTCCAGGACATTGAGACAGG - Intronic
1163929304 19:20373870-20373892 CAGATGTAGGAGGTGGAGGAGGG - Intergenic
1164515558 19:28932459-28932481 TAGAACCAGGAGATGGAGGGGGG - Intergenic
1164584414 19:29457526-29457548 CAGGTCTAGGAGATAGAGGATGG - Intergenic
1164587363 19:29484401-29484423 CAGATCCAGGAGAGGCCGGCTGG - Intergenic
1164654488 19:29910502-29910524 GAGATGCAGGAGAGGGAGGGAGG - Intergenic
1165191587 19:34068200-34068222 AAATTCCAGGAGGTGGAGGCAGG + Intergenic
1165896149 19:39142501-39142523 CAGATCCAGCAGAAGTAGGGTGG + Intronic
1165996596 19:39848331-39848353 CAGAAGCAGGAGATGGTGCCAGG - Intergenic
1166100648 19:40569685-40569707 CAGCTGCAGGAGAAAGAGGCAGG + Exonic
1166302753 19:41921689-41921711 CAGAGGCAGGAGAGGGATGCAGG + Intronic
1166329131 19:42068811-42068833 CATATCCAGGAGATAGAGACTGG + Intronic
1166416087 19:42595786-42595808 GAGATCCAGGAGAGGGAGCCTGG + Intronic
1166921201 19:46230231-46230253 GAGATCCAGGAGGTAGTGGCAGG - Intronic
1167045506 19:47046667-47046689 CGGAACCAGGAGAGGAAGGCTGG + Exonic
1167595885 19:50427931-50427953 CAGATCCAGGAGATGGAGGCCGG + Intronic
925060249 2:885381-885403 CAGCCCCAGGACATGGAGCCTGG + Intergenic
925743974 2:7029411-7029433 CAGCTCCAGGAAATGGAGGTGGG + Intronic
925783264 2:7403315-7403337 CAGATACAGGTGATGTAGGATGG - Intergenic
925881710 2:8358123-8358145 GAGAGACAGGAGATGGAGGGTGG + Intergenic
926872739 2:17441156-17441178 AAGACCCAGAAGGTGGAGGCAGG + Intergenic
927041045 2:19230589-19230611 CAAAGCCGGGAGATGGAGGTTGG + Intergenic
927562810 2:24085301-24085323 CAGCCCCAGGAGAAGGATGCTGG + Intronic
927702436 2:25276847-25276869 CACAGCCAGGAGATGAAGTCGGG - Intronic
927998871 2:27506167-27506189 GAGACCCTGGAGAGGGAGGCAGG - Intronic
928139738 2:28718152-28718174 TAGATCCACCAGATGGAGGAAGG + Intergenic
929760749 2:44804342-44804364 CAGAGCGAGGAGATTTAGGCTGG - Intergenic
931764085 2:65439168-65439190 CAGATCCTGGAGGTGGAGATGGG + Intergenic
932007649 2:67943303-67943325 CATATACAGAAGATTGAGGCTGG + Intergenic
932321357 2:70824097-70824119 CAGAGCCAGGAGAGGGAGAGAGG + Intergenic
932356592 2:71072769-71072791 CAGATCCAGGACCTGGAGCTGGG - Intronic
932404637 2:71505003-71505025 GAGATCCAGGAGGTGGCGGATGG + Intronic
932420908 2:71600861-71600883 CAGATCCAGGAGGCCCAGGCAGG + Intronic
932421247 2:71602729-71602751 CACATCCAGGAGATGGTGAGAGG - Intronic
933401765 2:81807532-81807554 CATATGCAGAAGATTGAGGCTGG - Intergenic
933545607 2:83707401-83707423 CATATCCAGAAGATCGAGACTGG - Intergenic
933810263 2:86028700-86028722 CAGATCCAGGACCTGGAGAGAGG + Exonic
933849239 2:86352429-86352451 CAGCTCCAGGAGACAGAGGGAGG - Intergenic
934129275 2:88931877-88931899 GACCTGCAGGAGATGGAGGCCGG + Intergenic
934138430 2:89020219-89020241 GACCTGCAGGAGATGGAGGCTGG + Intergenic
934153475 2:89172466-89172488 GACCTGCAGGAGATGGAGGCCGG + Intergenic
934153899 2:89176554-89176576 GACCTGCAGGAGATGGAGGCCGG + Intergenic
934158104 2:89221924-89221946 GACCTGCAGGAGATGGAGGCCGG + Intergenic
934159437 2:89234411-89234433 GACTTGCAGGAGATGGAGGCCGG + Intergenic
934160521 2:89245007-89245029 GACCTGCAGGAGATGGAGGCCGG + Intergenic
934169713 2:89330345-89330367 GACCTGCAGGAGATGGAGGCCGG + Intergenic
934197579 2:89852240-89852262 GACCTGCAGGAGATGGAGGCCGG - Intergenic
934206756 2:89937431-89937453 GACCTGCAGGAGATGGAGGCCGG - Intergenic
934207839 2:89948021-89948043 GACTTGCAGGAGATGGAGGCCGG - Intergenic
934209160 2:89960500-89960522 GACCTGCAGGAGATGGAGGCCGG - Intergenic
934213760 2:90009465-90009487 GACCTGCAGGAGATGGAGGCCGG - Intergenic
934218130 2:90053110-90053132 GACCTGCAGGAGATGGAGGCCGG - Intergenic
934230825 2:90180406-90180428 GACCTGCAGGAGATGGAGGCTGG - Intergenic
934789490 2:97046639-97046661 GACCTGCAGGAGATGGAGGCCGG - Intergenic
934816982 2:97335901-97335923 GACCTGCAGGAGATGGAGGCCGG + Intergenic
934820714 2:97372583-97372605 GACCTGCAGGAGATGGAGGCCGG - Intergenic
936242206 2:110797608-110797630 AAGATCCATGTCATGGAGGCAGG + Intronic
936676615 2:114723042-114723064 CACATTCATGAGATGGAGGTGGG + Intronic
937440134 2:121908319-121908341 CAGATGCAGGTGCAGGAGGCTGG + Intergenic
937927613 2:127179228-127179250 CAGACTCTGGAGATGGAGGAAGG - Intergenic
938673890 2:133611271-133611293 CAGATGGAGGAGGTGGTGGCGGG - Intergenic
940226179 2:151403404-151403426 TAAACCCAGGAGATGGAGGTTGG - Intergenic
942648641 2:178143735-178143757 CTGATGCAGGAGATAGTGGCAGG + Intergenic
942737673 2:179134400-179134422 CAGATAGAAGAGATGGAGGCAGG - Intronic
942946751 2:181681471-181681493 AAGATCCTGGGGATGGAGGTGGG - Intergenic
944581208 2:201134194-201134216 CAGCTACAGGAGGTGAAGGCAGG + Intronic
947538131 2:230953869-230953891 CACGGCCAGGAGATGAAGGCTGG + Intronic
948061544 2:235046103-235046125 CATCTGCAGGAGCTGGAGGCCGG - Intronic
948467327 2:238158740-238158762 CAGAACCAGGAGTTGCAGGGGGG + Intergenic
948822921 2:240559102-240559124 CAAGTCCAGGAGACAGAGGCTGG + Intronic
948894002 2:240919865-240919887 CAGGTCCAGCAGCTGGAGCCTGG + Intronic
948977738 2:241473767-241473789 GAGAGCCAGGGGATGGGGGCAGG + Intronic
1168971228 20:1932288-1932310 CAGATCAAGGAGGTGGGGTCTGG + Intronic
1169216387 20:3796816-3796838 CGAATCCAGGAGGTGGAGTCCGG + Intronic
1169722384 20:8692840-8692862 CAGATTGAGGGGATGGAGGTGGG - Intronic
1170500278 20:16968504-16968526 CAGATGCAGGTGAGTGAGGCAGG - Intergenic
1170787143 20:19477363-19477385 CAAATCCAGGAGAAAGAGGCAGG + Intronic
1171002911 20:21433060-21433082 CAGATCCTGGAGATAAAGGGAGG - Intergenic
1171339920 20:24419817-24419839 CAGACCTAGTAGAAGGAGGCAGG + Intergenic
1172639262 20:36431224-36431246 CAGAGCTAGGAGATGTGGGCTGG + Intronic
1173248188 20:41350316-41350338 CAGCTCCATGACTTGGAGGCAGG - Exonic
1173307854 20:41867696-41867718 CATATGCAGAAGATTGAGGCTGG - Intergenic
1173482684 20:43415920-43415942 CAGATCCAGATGGGGGAGGCGGG - Intergenic
1173622298 20:44445831-44445853 TAGATCCAGAAGAGGCAGGCTGG + Intergenic
1173788573 20:45812878-45812900 CCGCTCCAGGAGGTGGCGGCGGG - Intronic
1174116063 20:48227074-48227096 CTTAAGCAGGAGATGGAGGCAGG - Intergenic
1174194080 20:48760631-48760653 CTGAGCCAGGAGAGGGAGGCTGG + Intronic
1174358804 20:50015371-50015393 GGGATCCAGGAGATGCCGGCGGG + Intergenic
1174384658 20:50179986-50180008 GACATTCAGGAGATTGAGGCAGG - Intergenic
1174404084 20:50292590-50292612 AAGAGGCAGGAGATGGAGGCTGG - Intergenic
1174657234 20:52181751-52181773 CAGATTCAGGAGGTGGAGCCCGG + Intronic
1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG + Intergenic
1175099092 20:56565413-56565435 CTGGTCCAGGTGGTGGAGGCTGG + Intergenic
1175163036 20:57022812-57022834 AAGAGCCAGGAGAGGGAGACAGG - Intergenic
1175871156 20:62210148-62210170 CGGATCCTGGAGCAGGAGGCAGG - Intergenic
1175883656 20:62275489-62275511 CATATCCAGGAGGTTAAGGCAGG - Intronic
1175889075 20:62308167-62308189 CAGTTCCAGCAGGTAGAGGCCGG + Exonic
1176099400 20:63358153-63358175 CAGCTCCAGGACACTGAGGCTGG + Intronic
1176287965 21:5028780-5028802 GAGAGGCAGAAGATGGAGGCAGG + Intronic
1177087100 21:16719201-16719223 GAGAGCTAGGACATGGAGGCAGG + Intergenic
1179213835 21:39349316-39349338 CAGACCCAGGCGAAGGGGGCGGG + Intronic
1179869216 21:44234695-44234717 GAGAGGCAGAAGATGGAGGCAGG - Intronic
1180588415 22:16914466-16914488 GATCTGCAGGAGATGGAGGCTGG + Intergenic
1181288033 22:21768630-21768652 TTCATCCAGGAGATGGAGGCTGG - Intronic
1182059161 22:27384626-27384648 CACATCCAGGAAATAGAGGCTGG - Intergenic
1182828068 22:33282861-33282883 CGGAGCCAGGAGATGGCAGCAGG + Intronic
1182964989 22:34512567-34512589 CAAACCCAAGAGATGGGGGCAGG + Intergenic
1183067678 22:35374477-35374499 GATACTCAGGAGATGGAGGCAGG + Intergenic
1183310257 22:37105747-37105769 CGAACCCAGGAGTTGGAGGCTGG - Intronic
1185023341 22:48393342-48393364 CAGAGCCAGGATCTGGAGCCTGG + Intergenic
949927757 3:9055548-9055570 CAGCTGCAGGGGAGGGAGGCTGG + Intronic
950448978 3:13055054-13055076 CAGAGCCAGGACAGGAAGGCCGG - Intronic
950540400 3:13609072-13609094 CAGAGCCAGGACAGGGCGGCGGG - Intronic
952991269 3:38832998-38833020 CAGAAGCAGGAGCTGCAGGCAGG + Intergenic
953958753 3:47251016-47251038 CAGATCCAGGATCTGGACACTGG - Intronic
954181117 3:48882041-48882063 CAGATCCAGGAGCTCAAGGGAGG - Intronic
954273509 3:49527408-49527430 CAGCTACAGGAGAATGAGGCAGG + Intronic
955909168 3:63842688-63842710 GAGATTAAGAAGATGGAGGCTGG + Intronic
959081713 3:101808976-101808998 CAGATCCAGTAGTGGGAGACAGG - Intronic
960092904 3:113659878-113659900 CAGAACCAGGAGGTGGAGCAGGG + Exonic
960463169 3:117961877-117961899 CAGATGAAGGTGATGGTGGCAGG - Intergenic
961402710 3:126658310-126658332 TGGAGCCAGCAGATGGAGGCCGG + Intergenic
961573954 3:127819929-127819951 CATCTCCAGGGGCTGGAGGCAGG + Intronic
962394299 3:135001393-135001415 CAGCCCTGGGAGATGGAGGCAGG - Intronic
962451638 3:135523310-135523332 CATATGCAGAAGATCGAGGCTGG + Intergenic
963767863 3:149356452-149356474 CAAGTCATGGAGATGGAGGCAGG + Intergenic
964778285 3:160305228-160305250 CAAATCCAGAAGATGAAGGAGGG + Intronic
966715177 3:183007241-183007263 CTGATGCAGGAGATGTAGGGTGG + Intergenic
966875640 3:184320239-184320261 CAGATCCAGTAGGTGGAGCCAGG - Intronic
967389665 3:188943223-188943245 CAGATCCAGGTGCAGGAGCCAGG - Intergenic
968432653 4:567818-567840 CAGACCCAGGAGGAGGAGTCAGG + Intergenic
968593813 4:1472446-1472468 GAGATCCGGGAGGTGGAGCCGGG - Intergenic
968651260 4:1761152-1761174 CAGTGACAGGAGATGGGGGCGGG - Intergenic
968707086 4:2084346-2084368 CAGCTCCATGAGATGGAGGCTGG + Intronic
968864490 4:3199108-3199130 CAGCTCCTGGAGAAGGAGTCAGG - Intronic
969091852 4:4700204-4700226 CAGGTAGAGGAGATGGTGGCTGG + Intergenic
969333210 4:6491964-6491986 CAGAGCCAGTGGATGGAGCCCGG - Intronic
969375920 4:6763092-6763114 CTCATCCAGGAGAAGGAGCCAGG - Intergenic
970168167 4:13261933-13261955 TAGCCCCAGGAGATGGAGGTGGG + Intergenic
970497152 4:16637916-16637938 CAGAGCCAGGATGTGGAGCCTGG - Intronic
970625107 4:17868653-17868675 TAGATCCAGGGGGTGGAGGATGG - Intronic
972155460 4:36155595-36155617 TAGATGCAGGAGATGAAGGGAGG + Intronic
972636297 4:40886867-40886889 CGGCCCCTGGAGATGGAGGCTGG - Intronic
973020928 4:45205772-45205794 CAGTTCCAGGAGAAAGAGACAGG - Intergenic
974528362 4:63075710-63075732 CAGATACAGAAGATTGAAGCTGG - Intergenic
974717715 4:65691859-65691881 CAGCTACAGGAGGTTGAGGCAGG + Intergenic
976137411 4:81953725-81953747 CAGATCCAGGAGCTGGAAGCAGG - Intronic
979800639 4:124904383-124904405 CACATCAAGAAGATGGTGGCAGG - Intergenic
980743971 4:136991402-136991424 CAGAACCAAGAGATGGAAGTAGG - Intergenic
981089412 4:140717212-140717234 CTGAACCAGGAGATGCAGACAGG + Intronic
981310710 4:143295381-143295403 GAGGTACAGGAGAGGGAGGCTGG - Intergenic
982322749 4:154096771-154096793 CCAATCCAGGAAATGGTGGCTGG - Intergenic
983509602 4:168593301-168593323 CAGATCCAGCAGAGAGAAGCTGG - Intronic
985362164 4:189187131-189187153 CAAATCCAGGAAGTGGAGGTTGG - Intergenic
985484403 5:140510-140532 CAGGTCCAGGAGCTGCAGGGCGG + Exonic
985865183 5:2508990-2509012 CTGATTCATGGGATGGAGGCTGG + Intergenic
985929110 5:3042261-3042283 CAGCTGGAGGACATGGAGGCAGG + Intergenic
985959330 5:3287808-3287830 CAGCTCCTGGAGCAGGAGGCTGG + Intergenic
987067390 5:14303264-14303286 ATGATCCTGGAGATGGAGGGTGG + Intronic
987067435 5:14303476-14303498 ATGATCCTGGAGATGGAGGGTGG + Intronic
987067465 5:14303617-14303639 ATGATCCTGGAGATGGAGGGTGG + Intronic
987067478 5:14303689-14303711 ATGATCCTGGAGATGGAGGGTGG + Intronic
988384260 5:30540301-30540323 CAGATCCAGGTCCTGGAGTCAGG - Intergenic
991947563 5:71914413-71914435 CTGATCCAGGAAATGGTGCCTGG + Intergenic
993430533 5:87827168-87827190 CAGTTCAAGGTGAGGGAGGCAGG + Intergenic
994353095 5:98769141-98769163 CTGATCCAGGACCTGGACGCGGG + Intronic
995876440 5:116795124-116795146 TTGAGCCAGGAGTTGGAGGCTGG + Intergenic
996731277 5:126719781-126719803 CAAACCCAGGAGACGGAGGTTGG + Intergenic
997422818 5:133782618-133782640 CAAATCTGGGAGATGGAAGCTGG + Intergenic
997447655 5:133953182-133953204 CAGATTCTGGAAATGGAGCCAGG - Intergenic
997633000 5:135384223-135384245 CACTTCTAGGAGATGGAGGCAGG + Intronic
997681096 5:135751232-135751254 CAGGCCCAGGAGAAGGAGGAGGG - Intergenic
998148484 5:139744062-139744084 CAGAGCCAGGAGGAGAAGGCAGG - Intergenic
998880299 5:146638437-146638459 AGGAACCAGGAGAAGGAGGCAGG + Intronic
998888039 5:146715177-146715199 CAGACCCAGGTGATGGTGCCAGG + Intronic
999512775 5:152270129-152270151 CAGAATCAAGAGATGGAGACAGG - Intergenic
1000606443 5:163332473-163332495 CATAGCCTGAAGATGGAGGCTGG - Intergenic
1001422660 5:171599385-171599407 CAGAGCCAGGAAATGGCAGCCGG + Intergenic
1001768408 5:174273338-174273360 CAGAGACTGGAGTTGGAGGCAGG - Intergenic
1002294740 5:178224076-178224098 CTGATCCTGGAGAGGCAGGCAGG - Intronic
1002302887 5:178267539-178267561 CAGATCCAGGACTTGAAGGCAGG + Intronic
1002363725 5:178694352-178694374 CACAGCCAGGAAATGAAGGCAGG + Intergenic
1002669746 5:180856980-180857002 CAAATACAGGACATGGAGGGTGG + Intronic
1006109849 6:31737902-31737924 GAAATTCAGGATATGGAGGCTGG - Intronic
1006339452 6:33438674-33438696 CAGAATCAGGTGTTGGAGGCTGG - Intronic
1007998047 6:46329605-46329627 TAGATCCAGGAGTTGCAGGGAGG + Intronic
1013395775 6:109737933-109737955 CAGAGCCAGGAGTTGGATCCAGG + Intronic
1014382738 6:120763855-120763877 CAGTTACAGGAAATGGAGGTTGG + Intergenic
1015846250 6:137523685-137523707 CAAGTGCAGGAGATGGGGGCGGG - Intergenic
1016272413 6:142303260-142303282 AAGATCCAGGAGTTGGGGGAAGG - Intronic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1018902209 6:168057320-168057342 CAGATCCAGGAAATGACAGCCGG - Exonic
1018964577 6:168474444-168474466 CAGACGCAGGAGCTGGAGCCTGG - Intronic
1019357910 7:590562-590584 CAGACGCAGGAGATGCAGGTGGG + Intronic
1019660734 7:2222690-2222712 CAGCTTCAGGAGCGGGAGGCCGG - Exonic
1020078746 7:5275322-5275344 CAGCTCCAGGAGCTGTCGGCTGG - Intronic
1021277195 7:18666429-18666451 CAGATCCAGGAAATGGAATCTGG + Exonic
1021446293 7:20737044-20737066 CAGCTTCAGGAGGTGGAGGCAGG + Intronic
1021994483 7:26166491-26166513 CAGAACCAGGATTTGGCGGCAGG - Intronic
1023333960 7:39149028-39149050 AAGATCCAGGAGAGGGAGGGAGG + Intronic
1023727786 7:43162422-43162444 CAGACCATGGAGATGGAGGTTGG - Intronic
1024839701 7:53571652-53571674 CAGACCCAGGAGAAGGAAGAGGG - Intergenic
1025200149 7:56956863-56956885 CAGCTCCAGGAGCTGTCGGCTGG + Intergenic
1025949248 7:66130603-66130625 CAAATCCAAGAGTTGGAAGCTGG + Intronic
1026217801 7:68365040-68365062 GAGAGCCAAGAGATGGAGGGAGG + Intergenic
1027604212 7:80280121-80280143 CAGATCAAGGAAAGGGAGGGTGG + Intergenic
1029149505 7:98470182-98470204 TAGATCCAGGGTATTGAGGCAGG + Intergenic
1029682330 7:102120105-102120127 CAGCTGCAGGAGACGGATGCAGG - Intronic
1030106746 7:105993885-105993907 CAGATCAAGGAGATCTGGGCAGG + Intronic
1030806073 7:113921013-113921035 CAGAGCCAGGAAATGGACCCAGG - Intronic
1031543367 7:123023322-123023344 CAGATAGAGGAGATGGGGGTTGG + Intergenic
1032059230 7:128709995-128710017 TGAACCCAGGAGATGGAGGCGGG - Intronic
1032122009 7:129163433-129163455 GAGACTTAGGAGATGGAGGCAGG - Intronic
1033576652 7:142691714-142691736 CAGTTCCATCAGATGGAGGCTGG + Intergenic
1033610534 7:142960109-142960131 AAGTTCCTGCAGATGGAGGCTGG - Intronic
1033824099 7:145168645-145168667 CAGATCCTGGTGAACGAGGCGGG - Intergenic
1035112116 7:156491996-156492018 CAGATCCAAGGGACAGAGGCAGG + Intergenic
1036752450 8:11451838-11451860 CAGATCCAGAAGGCAGAGGCAGG - Intronic
1037515378 8:19625778-19625800 CAGAACAAGGAGTTTGAGGCTGG + Intronic
1037731317 8:21526112-21526134 AGGATCCAGGGGCTGGAGGCTGG + Intergenic
1037737902 8:21581649-21581671 CAGGTGGAGGAGACGGAGGCTGG + Intergenic
1039793971 8:40896855-40896877 CAGCTCTGGGAGGTGGAGGCTGG - Intronic
1040670580 8:49685393-49685415 CAAATCCAAGAGATAAAGGCTGG + Intergenic
1041279623 8:56197345-56197367 CACATCCAGAAGGTGGAGGTGGG - Intronic
1042295832 8:67216601-67216623 CACTTACAGGAGATGGAGGTGGG + Exonic
1043364016 8:79510485-79510507 CAGATCCAAGAGATGGTGGCTGG + Intergenic
1044821391 8:96158270-96158292 CCGATCCTGGAGATAGAGGAGGG - Intronic
1045109532 8:98927030-98927052 CAGAGCCAGGAGTTCTAGGCAGG + Intronic
1047222276 8:122928130-122928152 GAGATGGAGGAGATGGAGCCTGG - Intronic
1047577254 8:126170784-126170806 CTCATCCAGGAGATGGTGCCTGG - Intergenic
1048282313 8:133114417-133114439 CAGTACTAGGAGAGGGAGGCAGG - Intronic
1049206894 8:141367716-141367738 ACCATCCAGGAGATGGTGGCTGG + Intergenic
1049206932 8:141367898-141367920 ACCATCCAGGAGATGGTGGCTGG + Intergenic
1049790858 8:144472183-144472205 CTGTTCCGGGAGATGGGGGCCGG + Exonic
1051864105 9:21659622-21659644 CAGAGCCAGAAGCTGAAGGCTGG + Intergenic
1052542062 9:29824480-29824502 CACATCCAGGAGATGGAAAAAGG - Intergenic
1052813619 9:33083147-33083169 CAGTTCCAGGAGATGAAGGTAGG - Intergenic
1052824690 9:33166635-33166657 CTGATCCAGAAGAGGGAGGCTGG + Intronic
1053105833 9:35406796-35406818 CAGTTGCCGGAGTTGGAGGCCGG + Intergenic
1053402750 9:37841145-37841167 CAGATCCAGGGGCAGGAGGAAGG + Intronic
1055915910 9:81400008-81400030 CTGATCCATGAGATCCAGGCAGG + Intergenic
1057209783 9:93193461-93193483 CCGAGCCAGCAGGTGGAGGCTGG + Intronic
1057242731 9:93426515-93426537 TAGAAACAGGACATGGAGGCAGG - Intergenic
1057527559 9:95816289-95816311 CAGATTCAGGGAATGGTGGCTGG + Intergenic
1057838857 9:98468947-98468969 CAGATCCAGGACTTGAAGCCAGG - Intronic
1057857445 9:98612250-98612272 CAGAACTAGGATATGGGGGCTGG + Intronic
1057997293 9:99829563-99829585 CAGAGAAGGGAGATGGAGGCAGG + Intronic
1058552404 9:106128948-106128970 CAGAGCTACGAGATGGAGGAGGG + Intergenic
1060485251 9:124042343-124042365 CAGGGCCAGGAGGGGGAGGCAGG - Intergenic
1061054423 9:128214875-128214897 CCTAACCAGGAGCTGGAGGCTGG + Intronic
1061313962 9:129782515-129782537 CAGAGCCAGAAGATGGACTCAGG + Intergenic
1062287526 9:135779645-135779667 TGGAACCAGGAGATGGAGGCAGG + Intronic
1203780235 EBV:96626-96648 CAGGAGCAGGAGGTGGAGGCCGG + Intergenic
1203655445 Un_KI270752v1:19882-19904 CAATTCCAGCAGGTGGAGGCTGG + Intergenic
1185748317 X:2589785-2589807 CAGATCCAGGAGACAGAGCCAGG - Intergenic
1188179312 X:27034536-27034558 CTTATGCAGGAGATGGAGCCTGG - Intergenic
1188204166 X:27331806-27331828 CATATGCAGAAGATGGAAGCTGG + Intergenic
1189198068 X:39168285-39168307 CAGGTCCAGGACACTGAGGCAGG - Intergenic
1189206022 X:39239517-39239539 CAGATCCAGGAAATGAAACCAGG - Intergenic
1189353107 X:40291922-40291944 CAGATGGAAGACATGGAGGCTGG - Intergenic
1189487532 X:41444823-41444845 TGAATCCAGGAGGTGGAGGCTGG + Intergenic
1189611624 X:42742566-42742588 CAAATCCAGAAGCTGAAGGCAGG + Intergenic
1189874115 X:45417999-45418021 CATATGCAGAAGATGGAAGCTGG - Intergenic
1190570869 X:51779932-51779954 AAGATCCTGGAGAGGTAGGCAGG - Intergenic
1190681625 X:52831167-52831189 CAGACCCAGGAGCTGGGGACAGG + Intergenic
1190877260 X:54468787-54468809 CTGATCCAGGAGATGGAGCCTGG + Exonic
1192260120 X:69501145-69501167 TAAAGCCAGGGGATGGAGGCGGG - Intergenic
1193144156 X:78060026-78060048 CAGACCCAGGAGAGGGAGGAGGG + Intergenic
1193199977 X:78677557-78677579 CATATCCAGAAGATTGAAGCTGG + Intergenic
1193357487 X:80538130-80538152 CATATGCAGAAGATTGAGGCTGG + Intergenic
1197460780 X:126737937-126737959 CAGCTCCAGGAGAGGGAGGGAGG - Intergenic
1198497721 X:137209786-137209808 CAGGTCCAGAAGCAGGAGGCGGG + Intergenic
1199030985 X:142999969-142999991 CAGGTCCTGAATATGGAGGCAGG - Intergenic
1199644510 X:149893284-149893306 CAGATTCAGGAGGCTGAGGCAGG + Intergenic
1200073127 X:153538693-153538715 CAGGTCCAGGGCATGGGGGCAGG - Intronic
1200184929 X:154175985-154176007 CAGCTCCAGGAGCTGGAGGAAGG - Intergenic
1200190582 X:154213123-154213145 CAGCTCCAGGAGCTGGAGGAAGG - Intergenic
1200196333 X:154250925-154250947 CAGCTCCAGGAGCTGGAGGAAGG - Intergenic
1200201988 X:154288043-154288065 CAGCTCCAGGAGCTGGAGGAAGG - Exonic
1200243415 X:154509426-154509448 CAGTTCCAGGAAATGGATACAGG + Intronic
1200686456 Y:6263948-6263970 CAGATCAAGGAGAAAGAGGATGG + Intergenic