ID: 1167599358

View in Genome Browser
Species Human (GRCh38)
Location 19:50445324-50445346
Sequence GTCTCAAGGTACCAAGGTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 67}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167599358_1167599361 -7 Left 1167599358 19:50445324-50445346 CCAATACCTTGGTACCTTGAGAC 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1167599361 19:50445340-50445362 TTGAGACAATTAACTGTGTGTGG 0: 1
1: 0
2: 2
3: 18
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167599358 Original CRISPR GTCTCAAGGTACCAAGGTAT TGG (reversed) Intronic
900174082 1:1284239-1284261 ACCTCAAGGTACCAAGGTGGTGG + Intronic
901200881 1:7466830-7466852 GTCTCAAGGCACCCAGTGATGGG - Intronic
906512085 1:46415791-46415813 GTCTGAAGGCACAAAGATATCGG - Intergenic
909938137 1:81578243-81578265 GTATCCAGGTACACAGGTATAGG + Intronic
912875653 1:113356195-113356217 GTCTCAAGGTAATAATGTAATGG + Intergenic
921079811 1:211730239-211730261 GGCTCAAGTAACCAAGGCATGGG + Intergenic
922336425 1:224622240-224622262 GTTTCAAAGTGCCAAGGCATGGG - Intronic
1063240939 10:4168596-4168618 GTCTCATGGAACCAAGGAATAGG - Intergenic
1069201242 10:65619181-65619203 GTCTGAAGGGACCAAGCTTTGGG - Intergenic
1071628715 10:87199950-87199972 GTCTCAGGCTCCCAAGGTACAGG - Intergenic
1073732254 10:106303195-106303217 GTCTCAAGGGATCAAGTTAATGG + Intergenic
1079291983 11:19196606-19196628 CTGGCAAGGTACCAAGGGATGGG + Intronic
1092271694 12:7029036-7029058 GCCTCAACCTCCCAAGGTATAGG + Intronic
1096691923 12:53326681-53326703 GTCTCAAGGCCCCAAGTTAAAGG - Exonic
1097366965 12:58726598-58726620 TTCTTAAGGTACCATTGTATTGG - Intronic
1101288772 12:103344549-103344571 GTCACATGGTACCAGGCTATGGG - Intronic
1102600603 12:114026922-114026944 GTCTCAAGTTACCAAGTTTTGGG - Intergenic
1107722676 13:43265433-43265455 GTTAAAAGGTACCAAGGAATTGG - Exonic
1115009375 14:28525680-28525702 GTCTGATGGTGCCATGGTATTGG + Intergenic
1117025887 14:51619966-51619988 CTCTGAAAGTAACAAGGTATGGG - Intronic
1125811062 15:42541737-42541759 ATCTGAAGGTACAAAGGTAGAGG - Exonic
1129267997 15:74404267-74404289 GTCTCTAGGGACCAAGGGCTGGG + Intergenic
1130451384 15:84056453-84056475 GTCTTGTGGTACCAAGGAATTGG + Intergenic
1132069097 15:98759902-98759924 GTCTCACGGTACCACGGGACAGG - Intronic
1134662985 16:15998122-15998144 GTCTCAAAGAAACAAAGTATCGG - Intronic
1139102459 16:63785192-63785214 GTCTGAAGTCAGCAAGGTATGGG + Intergenic
1149854011 17:60063304-60063326 TTCTCAAGGTACCAAGACAAAGG + Intronic
1167599358 19:50445324-50445346 GTCTCAAGGTACCAAGGTATTGG - Intronic
925006487 2:447134-447156 GTCACAAGGGACCAAGGGAGGGG - Intergenic
927734144 2:25503238-25503260 GTCTCAACCTACCAAAGTGTTGG - Intronic
933855286 2:86407790-86407812 GTCTCAAGCTCCCAAAGTGTTGG - Intergenic
939244556 2:139607079-139607101 GTCTCTAGCTACCATTGTATAGG + Intergenic
940621083 2:156114784-156114806 GTCTTAAGCTACCAAGTTTTAGG - Intergenic
941152838 2:161936902-161936924 GTCTTAAGGTACAATGTTATAGG + Intronic
1170351433 20:15446342-15446364 TCCTCAGGGTACCAAGGCATAGG + Intronic
1174829262 20:53797763-53797785 GTATCAAGGAACCTAGGCATGGG - Intergenic
1175875506 20:62227585-62227607 GTCTCAAGGCACCCTGGCATGGG - Intergenic
950442892 3:13020097-13020119 GTCCCAAGGTTTCCAGGTATTGG - Intronic
951915112 3:27792371-27792393 GTTTCAAGCTACCAAGATTTAGG + Intergenic
961986528 3:131140528-131140550 GTTTTAAGGTACTAAGGTTTGGG + Intronic
963855105 3:150245284-150245306 GGCTCAGGGTGTCAAGGTATGGG - Intergenic
964000055 3:151760368-151760390 TTCTCTAGGTACCAAGGCAAGGG + Intronic
970637540 4:18025133-18025155 GTTTCAAGGTACTAAGTTGTGGG - Intergenic
977642579 4:99373839-99373861 GTCTCCAGCTACTAATGTATTGG + Intergenic
980518175 4:133892469-133892491 GTCTTAAGATAACAAGGTTTTGG + Intergenic
981091318 4:140735460-140735482 GCCTCAATGTCCCAAAGTATTGG - Intronic
982382864 4:154768326-154768348 ATCACAATGTATCAAGGTATAGG - Intergenic
984871449 4:184329091-184329113 GTGTCAAGGTACCACAGTTTGGG - Intergenic
986422725 5:7600465-7600487 GTCTCAAGGCACAAAGGCAAGGG + Intronic
989315914 5:40078431-40078453 GTTTCAAGCTACTAAGTTATGGG - Intergenic
992827961 5:80568972-80568994 GTCTCAGGGAACCAAGGTGATGG + Exonic
1003107948 6:3229514-3229536 CTCTCCCGGTACCAAGGTCTCGG + Intronic
1005009501 6:21322576-21322598 CTCTCAAGAGACCTAGGTATGGG - Intergenic
1005672601 6:28122424-28122446 GTCACAAGGTGCCAAGGTGCTGG + Intergenic
1009879518 6:69548520-69548542 TTCTAAAAGTATCAAGGTATTGG - Intergenic
1021861784 7:24913225-24913247 GTCTCAATTTACCAAGTTTTGGG + Intronic
1028898089 7:96064568-96064590 ATCTCAAGGTACCAAAGTGAGGG + Intronic
1033845137 7:145422517-145422539 CTCTCAAGGCACAAAGGGATAGG - Intergenic
1034902361 7:154915352-154915374 GTCTTAAGGTACCTAGGGACTGG - Intergenic
1035585696 8:771642-771664 GTCTCTGGGTAGCAAGGTAGGGG - Intergenic
1037784666 8:21895531-21895553 GTCTCAACCTCCCAAAGTATTGG + Intergenic
1039219619 8:35315236-35315258 GTCTTAAGTTACTAAGTTATGGG - Intronic
1039538172 8:38338604-38338626 GTCTCTAGGTGAAAAGGTATAGG + Exonic
1041862684 8:62532250-62532272 GCCTCATGGTACCAGGGTAGTGG + Intronic
1186530108 X:10286822-10286844 GTTTCAAGGTTCTAAGGTTTGGG - Intergenic
1188220716 X:27538353-27538375 GTCTCAAGCTACTAAGGCTTGGG - Intergenic
1189356035 X:40310563-40310585 GTCTCAACGTAGCAAGGAAATGG - Intergenic
1190118474 X:47641090-47641112 GTCTTAGGGTACCAATGGATGGG + Intronic
1190284936 X:48955666-48955688 GGCTCAAGTTCCCAAGGCATGGG + Intronic
1201325153 Y:12748446-12748468 GTCTCAGGGTCCCAAGTTGTGGG + Intronic