ID: 1167599428

View in Genome Browser
Species Human (GRCh38)
Location 19:50445750-50445772
Sequence CTCATTATGTCTCCTCCCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 207}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167599420_1167599428 18 Left 1167599420 19:50445709-50445731 CCTGACCTGTGACCCGTCCACCA 0: 1
1: 0
2: 0
3: 18
4: 182
Right 1167599428 19:50445750-50445772 CTCATTATGTCTCCTCCCTCCGG 0: 1
1: 0
2: 2
3: 32
4: 207
1167599423_1167599428 5 Left 1167599423 19:50445722-50445744 CCGTCCACCACTCAAGATGCCTC 0: 1
1: 1
2: 0
3: 21
4: 221
Right 1167599428 19:50445750-50445772 CTCATTATGTCTCCTCCCTCCGG 0: 1
1: 0
2: 2
3: 32
4: 207
1167599424_1167599428 1 Left 1167599424 19:50445726-50445748 CCACCACTCAAGATGCCTCTGCC 0: 1
1: 0
2: 1
3: 21
4: 200
Right 1167599428 19:50445750-50445772 CTCATTATGTCTCCTCCCTCCGG 0: 1
1: 0
2: 2
3: 32
4: 207
1167599422_1167599428 6 Left 1167599422 19:50445721-50445743 CCCGTCCACCACTCAAGATGCCT 0: 1
1: 0
2: 1
3: 9
4: 128
Right 1167599428 19:50445750-50445772 CTCATTATGTCTCCTCCCTCCGG 0: 1
1: 0
2: 2
3: 32
4: 207
1167599421_1167599428 13 Left 1167599421 19:50445714-50445736 CCTGTGACCCGTCCACCACTCAA 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1167599428 19:50445750-50445772 CTCATTATGTCTCCTCCCTCCGG 0: 1
1: 0
2: 2
3: 32
4: 207
1167599425_1167599428 -2 Left 1167599425 19:50445729-50445751 CCACTCAAGATGCCTCTGCCACT 0: 1
1: 0
2: 2
3: 18
4: 217
Right 1167599428 19:50445750-50445772 CTCATTATGTCTCCTCCCTCCGG 0: 1
1: 0
2: 2
3: 32
4: 207
1167599417_1167599428 26 Left 1167599417 19:50445701-50445723 CCCCTTCACCTGACCTGTGACCC 0: 1
1: 0
2: 3
3: 26
4: 371
Right 1167599428 19:50445750-50445772 CTCATTATGTCTCCTCCCTCCGG 0: 1
1: 0
2: 2
3: 32
4: 207
1167599418_1167599428 25 Left 1167599418 19:50445702-50445724 CCCTTCACCTGACCTGTGACCCG 0: 1
1: 0
2: 0
3: 9
4: 123
Right 1167599428 19:50445750-50445772 CTCATTATGTCTCCTCCCTCCGG 0: 1
1: 0
2: 2
3: 32
4: 207
1167599419_1167599428 24 Left 1167599419 19:50445703-50445725 CCTTCACCTGACCTGTGACCCGT 0: 1
1: 0
2: 1
3: 5
4: 136
Right 1167599428 19:50445750-50445772 CTCATTATGTCTCCTCCCTCCGG 0: 1
1: 0
2: 2
3: 32
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167599428 Original CRISPR CTCATTATGTCTCCTCCCTC CGG Intronic
903141581 1:21342393-21342415 CTTTTTATGTCTCCTGCCTCCGG - Intronic
904914149 1:33957702-33957724 CCCCTTCTGTCTCCTCCCACTGG - Intronic
905097422 1:35485753-35485775 CACATTAAGTCTACCCCCTCTGG + Intronic
905327820 1:37170274-37170296 CTCCCTATTTATCCTCCCTCTGG + Intergenic
905469271 1:38179583-38179605 CACGTTCTGTCTCCTCCCTGGGG + Intergenic
905911684 1:41659399-41659421 TTCATTATTTCTCTTCCCACTGG + Intronic
906288213 1:44602295-44602317 CTCATTGCTTCTCCACCCTCTGG - Intronic
906517008 1:46445565-46445587 CACCTTATGTCTCCTCCTTCTGG + Intergenic
906660307 1:47577296-47577318 CCCATTATTTTTCCTGCCTCTGG - Intergenic
906930300 1:50163111-50163133 CTCATTGTGTCCTCTCCTTCTGG + Intronic
907545736 1:55258461-55258483 CTCTTTCTCTTTCCTCCCTCTGG + Intergenic
910521535 1:88127385-88127407 CTCACTCAGTCTCCTGCCTCAGG + Intergenic
911063693 1:93769099-93769121 CTCCTTCTGTCTCCTCCCCCAGG - Intronic
912746047 1:112246259-112246281 CTCTTTGTATCTCCTCCTTCAGG - Intergenic
916474440 1:165155236-165155258 CTCACCAGGTCTCTTCCCTCTGG + Intergenic
916651053 1:166835043-166835065 CTCTTTCTGTCTTCTCCTTCTGG - Intergenic
917320008 1:173770800-173770822 TTCATTCTGTTTCCTCCCTTTGG - Intronic
917487606 1:175469017-175469039 GTCATTTTGACTCCTCCCTCAGG - Intronic
918811901 1:189132921-189132943 GTCATTATCTCTGCCCCCTCTGG - Intergenic
918961152 1:191279766-191279788 GTCATAAGGTCTTCTCCCTCAGG - Intergenic
920285219 1:204874213-204874235 CTCACTGTGTCTCCTGCCGCTGG + Intronic
922683647 1:227621819-227621841 CTCATTATAGCTTCTCCCTTTGG + Intronic
1063093285 10:2886930-2886952 CTGACTTTCTCTCCTCCCTCAGG + Intergenic
1064940466 10:20729003-20729025 CTCCTTATGTCTTCTTCTTCAGG - Intergenic
1065520143 10:26564432-26564454 CTCATTATGACTCGTGTCTCAGG - Intronic
1066499077 10:35972580-35972602 CTCAATACCTCTCCTTCCTCAGG + Intergenic
1068134413 10:52937442-52937464 CTCATTCTCTCTTCTCCTTCAGG - Intergenic
1069182306 10:65376846-65376868 TTCGTTATGTCTTCTCCCTGTGG + Intergenic
1070767112 10:79063160-79063182 CTCAGCATCTCTCCTCCTTCTGG - Intergenic
1073270041 10:102254956-102254978 CTGAGTATGTCCCCTCACTCAGG - Intronic
1075165328 10:120063072-120063094 CTGATGAAGTCTCCTCCTTCAGG - Intergenic
1079089488 11:17470754-17470776 CTGATTTTGTCTCCTCTCTCGGG + Intronic
1079467971 11:20750611-20750633 CTCATTCTGTCACGTCACTCAGG + Intronic
1079697955 11:23507502-23507524 CTCATCTTGTCTCCTGCTTCTGG - Intergenic
1080143437 11:28950304-28950326 CTCTATATGTCTTCTCCTTCTGG - Intergenic
1080574713 11:33587760-33587782 CACTTTCTCTCTCCTCCCTCTGG - Intronic
1081982502 11:47276905-47276927 AGCATTAAGCCTCCTCCCTCAGG - Intronic
1082809897 11:57473560-57473582 CTCCCTATCTCCCCTCCCTCTGG - Intronic
1083600730 11:63945997-63946019 CTTATTTTGTCTCCACCCTGTGG + Intronic
1083986717 11:66220447-66220469 CTCACCATGTCCCCGCCCTCAGG + Intronic
1084365455 11:68694587-68694609 CTCATTATGCCTCTTCCCCATGG + Intergenic
1085015555 11:73171740-73171762 GTCATCATGTCTCCTCACTGTGG - Intergenic
1086091349 11:83008116-83008138 CTTATTCAGTCTCCTCCCACCGG + Intronic
1086125989 11:83349187-83349209 TTCAGTAAGTCTCCTCTCTCTGG - Intergenic
1086751975 11:90507653-90507675 CTCATTACAACTCCTCCCTTTGG - Intergenic
1087400687 11:97663338-97663360 TTCATTATTTCTACTCCATCTGG + Intergenic
1088735755 11:112726493-112726515 CTCAGTCTGTCTCCTTCCTTCGG + Intergenic
1088838013 11:113595213-113595235 CTCAATATGTTTAATCCCTCTGG + Intergenic
1089505800 11:118961309-118961331 CTCAGTAAGTCCCCACCCTCAGG - Intergenic
1092044141 12:5415286-5415308 CTCATGAGAGCTCCTCCCTCAGG - Intergenic
1092080745 12:5713954-5713976 CTCCTTCTGTCTCCTTTCTCTGG - Intronic
1093073828 12:14736340-14736362 CTCATTTTCTCACCTCCTTCAGG + Intergenic
1096783331 12:54003355-54003377 CTCGTTATTTCTCCTCCCTGTGG + Intronic
1098340341 12:69444568-69444590 CTCATTATGGTTTGTCCCTCTGG + Intergenic
1099315681 12:81079319-81079341 CTCCTTATGTGTCTGCCCTCTGG + Intronic
1099551118 12:84044057-84044079 CTCCTTCTGTCACCTCACTCGGG - Intergenic
1099619468 12:84983007-84983029 CTCAGTTTGTCTCCTCAATCTGG - Intergenic
1099970426 12:89494595-89494617 CTGTTTATTTCTCCTCCCTTTGG + Intronic
1101169552 12:102075799-102075821 CTAATTATGTCTCATCCCCTAGG - Intronic
1104427077 12:128686783-128686805 CGCTTTATGTGTCCTCCCTCAGG - Intronic
1105958021 13:25301953-25301975 CCCATCCTGTCTCTTCCCTCTGG + Intronic
1108152548 13:47551256-47551278 TTCATGAGGGCTCCTCCCTCGGG + Intergenic
1110057270 13:70988603-70988625 CTCTTTATGTATCCTCCCTCAGG - Intergenic
1112185950 13:97127912-97127934 CTCATTGTACCCCCTCCCTCTGG - Intergenic
1118489477 14:66245012-66245034 CTCACCTTGTCTCCTGCCTCAGG - Intergenic
1119288862 14:73478628-73478650 CCCATCATGTCTTCTCCCTCTGG - Exonic
1119777294 14:77257054-77257076 CTCCTTCTGTCTCCTCCCTTAGG - Exonic
1120206161 14:81589627-81589649 CTCAGTTTGGCTCCTCCCTCAGG - Intergenic
1120679027 14:87457161-87457183 CTCATTATGTGAACTCCCTTAGG + Intergenic
1122014541 14:98783216-98783238 TTCATTCATTCTCCTCCCTCTGG + Intergenic
1122462329 14:101905811-101905833 CTCAGGACCTCTCCTCCCTCTGG + Intronic
1202903717 14_GL000194v1_random:56914-56936 CTCAGGGCGTCTCCTCCCTCAGG - Intergenic
1123479185 15:20615512-20615534 CAGATAATGCCTCCTCCCTCTGG - Intergenic
1123638829 15:22384873-22384895 CAGATAATGCCTCCTCCCTCTGG + Intergenic
1128047962 15:64635917-64635939 CTCATTATTCCATCTCCCTCAGG + Intronic
1132694384 16:1195410-1195432 CTCCTGATGCCTCCTCCCGCAGG + Exonic
1132732816 16:1371248-1371270 CTCAGCATCTCTCCTGCCTCGGG - Intronic
1133983561 16:10651216-10651238 CTCATTCTCTCACCTCCTTCAGG + Intronic
1137246619 16:46711218-46711240 CTGATTCTCTATCCTCCCTCAGG - Intronic
1137706328 16:50538402-50538424 ATCATCATCTCTTCTCCCTCGGG + Intergenic
1138085775 16:54132487-54132509 CTCATCATGTGTCCTACCTAAGG - Intergenic
1138551563 16:57751619-57751641 CTCATGCCGTGTCCTCCCTCAGG + Exonic
1139302604 16:65958360-65958382 CTCATTGTACCTCCTCCCGCTGG - Intergenic
1139931146 16:70527558-70527580 CTCATTATGGCTCTTCCTGCGGG + Intronic
1140431117 16:74904181-74904203 CTCATTTTGTCTTCTCCTTTTGG - Intronic
1141292121 16:82728041-82728063 CTTATTATGTCTGCTTCCTCTGG + Intronic
1143442678 17:6987590-6987612 CAGATTTTATCTCCTCCCTCGGG + Intronic
1145144042 17:20466455-20466477 CCCATTCTGTCTCCCCACTCAGG + Intronic
1147029643 17:37622051-37622073 CTCATTATTTATCCTAACTCTGG + Intronic
1151116611 17:71742814-71742836 CTTATTAGGTCTCCACTCTCTGG - Intergenic
1151736437 17:75943927-75943949 CTCATTAATTCTCCTCACTCTGG + Exonic
1152131412 17:78479046-78479068 TTCATTATGTCTTCAACCTCAGG - Exonic
1152449211 17:80365781-80365803 CTCATCATGTCTCGGCGCTCTGG + Intronic
1154000875 18:10481521-10481543 CTCATTCTCTCTCCTGCCCCTGG - Intronic
1155203663 18:23538593-23538615 CTCATGAAGTCTCCCCCCTGAGG + Exonic
1155523199 18:26689971-26689993 CTTTCTCTGTCTCCTCCCTCAGG - Intergenic
1157975825 18:52325621-52325643 CTAACTCTCTCTCCTCCCTCTGG - Intergenic
1158032426 18:52982478-52982500 CTCCTTATGTCTCCTGCTTAGGG + Intronic
1160412931 18:78687451-78687473 CCCATTCAGGCTCCTCCCTCCGG + Intergenic
1162558610 19:11402706-11402728 CTCAGTTTTTCTCTTCCCTCAGG - Exonic
1163387266 19:17007557-17007579 CTCCTTCTGTCTCCTGCCTTGGG - Intronic
1164499174 19:28799487-28799509 CTTATTCTCTCTCCTCTCTCAGG - Intergenic
1164713449 19:30375304-30375326 CTCATTATCTCCCCTCCGTAAGG - Intronic
1166236118 19:41458251-41458273 CTCATTATATTTCTTCCCTTTGG + Intergenic
1166664806 19:44672738-44672760 CTCCGTACGTCTCCTCCCCCAGG - Exonic
1167599428 19:50445750-50445772 CTCATTATGTCTCCTCCCTCCGG + Intronic
1168048787 19:53813247-53813269 CTCATAATTTCTCCTCTCCCTGG + Intronic
927367694 2:22318264-22318286 CTTTCTATGTCTCCTTCCTCAGG - Intergenic
927922682 2:26985575-26985597 CTGATTAGGTCTCCTCTCACTGG - Intronic
928039417 2:27859666-27859688 CTCTTTTTATCTGCTCCCTCTGG - Intronic
928432766 2:31234376-31234398 CAGATTATTTATCCTCCCTCCGG + Exonic
929604015 2:43223579-43223601 ACCATTTTGTCTGCTCCCTCTGG - Exonic
929626852 2:43418203-43418225 CATATTATGTCTACTCTCTCTGG + Intronic
930831283 2:55745857-55745879 CTCACTATGTTGCCTCTCTCTGG - Intergenic
932312912 2:70758555-70758577 CTCATCATTTCTCTACCCTCCGG - Intronic
932606664 2:73169995-73170017 CTCATTATGTTACCTCCCACTGG + Intergenic
933925762 2:87090440-87090462 CTCATTATGTTACCTCCCACTGG - Intergenic
934502941 2:94873498-94873520 CTCAGGGCGTCTCCTCCCTCAGG + Exonic
936864012 2:117056288-117056310 CTGGCTATGTCTCCACCCTCGGG - Intergenic
938753729 2:134360900-134360922 CTCATTCTGTCACCCCCATCAGG + Intronic
939880238 2:147623079-147623101 CTCCTTTTGTCTGCTCACTCTGG + Intergenic
942375149 2:175328977-175328999 TCCAACATGTCTCCTCCCTCTGG - Intergenic
943577021 2:189641797-189641819 CTCATTATGTTTCCTCTTCCAGG - Intergenic
944646225 2:201783341-201783363 CTCATTATATCCTCTCCCTTTGG - Intergenic
944896633 2:204172114-204172136 CTCATTTTCTCTCCTTCCTGGGG + Intergenic
944993029 2:205259645-205259667 CTCATTCTGTCTCCTCTTTGTGG + Intronic
948183926 2:236004157-236004179 CTCATTTTGTCTCCTGACTGTGG + Intronic
1170084269 20:12511724-12511746 CTCATTACTTCTCTTCACTCAGG + Intergenic
1171191660 20:23163389-23163411 CTCTTTATGTTCCCTCCCTGGGG - Intergenic
1171453802 20:25255287-25255309 CTCAACATCTCTCCTCCCACAGG + Intronic
1172832988 20:37852500-37852522 CTCATAGTGGCTCCTCTCTCTGG + Intronic
1172834161 20:37862213-37862235 CTCATTTTGCCTCCTCCCTAAGG + Intronic
1172995005 20:39064264-39064286 CTCAGTTTGGCTCTTCCCTCTGG - Intergenic
1173253892 20:41379506-41379528 CTCCCTGTTTCTCCTCCCTCAGG + Intergenic
1174543243 20:51306258-51306280 CTCATTATACCTCCGCCCTTTGG - Intergenic
1176623082 21:9071682-9071704 CTCAGGGCGTCTCCTCCCTCAGG - Intergenic
1180698291 22:17768292-17768314 CTCCTCATGTCTCCTCCTGCTGG - Intronic
1181647828 22:24243358-24243380 GTCTTTCTGTCTCCTCCCACAGG - Intronic
1182105480 22:27685993-27686015 TTCCTTATGTCTCCAGCCTCGGG - Intergenic
1182891066 22:33819234-33819256 CTCATTATGTCTTCTCCCAGTGG + Intronic
1182973805 22:34603467-34603489 CGCATTATATCTCCTCCTTTTGG + Intergenic
949162881 3:901845-901867 TTCTTTATATCTTCTCCCTCTGG - Intergenic
949328829 3:2898442-2898464 CTCATTCTGTCTCTTCCCACAGG - Intronic
949654483 3:6200966-6200988 TTCATTATTTTTCCTCACTCTGG - Intergenic
953072292 3:39532960-39532982 CACATTTTGTCTCCTGCCTTGGG - Intergenic
953960706 3:47263707-47263729 CTCTGAAGGTCTCCTCCCTCTGG + Intronic
955241049 3:57178558-57178580 TTAATTATGTCTGCTGCCTCAGG - Intergenic
955302044 3:57789468-57789490 CTCATTATCTACCATCCCTCAGG - Intronic
955469612 3:59273048-59273070 TTTGTTATGTCTCCTCCCACTGG - Intergenic
955514561 3:59713862-59713884 CTCATTATGACCCCTCCATCTGG - Intergenic
956466502 3:69525346-69525368 CCCACTCTGGCTCCTCCCTCTGG + Intronic
958615005 3:96482066-96482088 GTCATGAGGGCTCCTCCCTCAGG + Intergenic
958637168 3:96760457-96760479 CTCATAAACTCTCCTCCCTTTGG + Intergenic
959444294 3:106418856-106418878 CTGATTATATCTCCACACTCTGG - Intergenic
960472451 3:118083983-118084005 CACATTTTGTCTCCTCCCACTGG + Intergenic
963838258 3:150079009-150079031 CTCAAAATTTCTCCTGCCTCAGG + Intergenic
965428399 3:168556079-168556101 CTCACTATGTCTGCTTCCTCTGG - Intergenic
966100742 3:176266634-176266656 TTCTTTATTTCTTCTCCCTCTGG + Intergenic
966836510 3:184053505-184053527 CTCAGATTGTCCCCTCCCTCAGG - Intronic
968227105 3:196979670-196979692 CTCCTTGTGTCTCCTTTCTCAGG + Intergenic
968424843 4:516505-516527 TTCCTTTTCTCTCCTCCCTCTGG - Intronic
969661804 4:8534441-8534463 CTCATTATACCCCCTCCCTTTGG + Intergenic
969898840 4:10329818-10329840 CTCATTCTGTCTCTTCTCCCTGG + Intergenic
970200376 4:13598981-13599003 ACCATTATGTCTCCTTCCTCAGG + Exonic
971232109 4:24808405-24808427 CTCCTCATGCCTCCGCCCTCTGG + Exonic
971764894 4:30818114-30818136 CTCAATATGTTTCCTCCTTGAGG + Intronic
971796580 4:31236333-31236355 CACATGATTTCTCCTCCCCCTGG + Intergenic
975484998 4:74926170-74926192 CTCATTAATCCTCCTCCCTTTGG - Intergenic
977103301 4:92846315-92846337 CCCTTCATCTCTCCTCCCTCTGG + Intronic
979696042 4:123614217-123614239 CTCAACATTTCTCCTGCCTCTGG + Intergenic
980016823 4:127659365-127659387 TTCATTTTGTCTCTTCTCTCTGG - Intronic
981495915 4:145392187-145392209 CCAACTGTGTCTCCTCCCTCCGG - Intergenic
981578690 4:146230568-146230590 CTCATTATCTCTGCTCTGTCTGG - Intergenic
981587154 4:146316389-146316411 TTCATAAGGTCTCCACCCTCAGG - Intronic
981704863 4:147648270-147648292 TTCAGTGTGTCTCCTCTCTCTGG - Intronic
985688772 5:1295429-1295451 CACATCATGGCCCCTCCCTCGGG - Intergenic
985829401 5:2217024-2217046 CTCATTAGCTCACCTGCCTCTGG + Intergenic
987871691 5:23627179-23627201 CTCATTATATCCCCTCCCTTTGG + Intergenic
988578702 5:32450420-32450442 CTCAATATCTCTCTTCCCCCAGG + Intergenic
988854828 5:35217843-35217865 ATCAGTCTATCTCCTCCCTCAGG - Intronic
990492242 5:56313905-56313927 CTCATAATCCCTCCTGCCTCTGG - Intergenic
993299280 5:86186488-86186510 CTCATTATGTCTCATCTCCTGGG + Intergenic
997816082 5:137018451-137018473 CTCACCTTGTCCCCTCCCTCAGG + Intronic
1003360229 6:5418785-5418807 CTCCTTAGGTCTCACCCCTCTGG + Intronic
1004962794 6:20810695-20810717 TTCATTCTCTCTCCTCTCTCTGG + Intronic
1005743591 6:28815342-28815364 ATCATTTTCTCTCCACCCTCAGG - Intergenic
1009673213 6:66783835-66783857 CTCATTGGTTCACCTCCCTCAGG + Intergenic
1014317692 6:119887892-119887914 CTCATCATACCTCCTCTCTCAGG + Intergenic
1014852595 6:126360530-126360552 CTTATTCTCTCTCCTCTCTCAGG + Intergenic
1017677276 6:156827181-156827203 CTCATTATGTCTCTTCCTTCTGG + Intronic
1018227530 6:161643306-161643328 TTCAGCATTTCTCCTCCCTCCGG - Intronic
1018898425 6:168037568-168037590 CCCTTTCTCTCTCCTCCCTCTGG - Intronic
1020383423 7:7570230-7570252 ATCATCTTGTCTCCTCACTCAGG - Intronic
1021090834 7:16480784-16480806 CTCTTTTTCTCTTCTCCCTCTGG - Intronic
1024032279 7:45471588-45471610 CTCTTTCTGTCTTCTCCTTCTGG - Intergenic
1026976401 7:74501439-74501461 CTCCTTCCGTCTCTTCCCTCCGG + Intronic
1028625300 7:92870722-92870744 CTCATTTTTTCTCCTCCTTCAGG - Intergenic
1030401241 7:109053184-109053206 CTCATTGTGTCTCTCCTCTCTGG + Intergenic
1031861833 7:126989086-126989108 ATCATCATGTCTGGTCCCTCTGG - Intronic
1033362154 7:140645321-140645343 CTCACTGTGGCTCCCCCCTCTGG - Intronic
1034488911 7:151382453-151382475 CTCAGTCTGTCTCCTCCCCCAGG + Intronic
1035743150 8:1944140-1944162 CGCATCGTGTCGCCTCCCTCGGG + Intronic
1038808106 8:30812820-30812842 CTCTTTCTCTCCCCTCCCTCCGG + Exonic
1039840826 8:41291803-41291825 CTCATGGTGTTTCCTGCCTCGGG - Intronic
1041060246 8:54028338-54028360 CTCACTATGTTGCCTCCCTATGG - Intergenic
1043016792 8:74948659-74948681 GCCATTTTGGCTCCTCCCTCAGG + Intergenic
1043424043 8:80131108-80131130 CTCTTTAGGTCACCTTCCTCAGG - Intronic
1044517459 8:93155639-93155661 CTGATTATCTTTCCTCCATCAGG - Intronic
1044566249 8:93663634-93663656 CTCATTATCCCTCCTCCCTTTGG + Intergenic
1047590522 8:126322097-126322119 CTCATATTGTTTCCTCTCTCTGG + Intergenic
1049545776 8:143229842-143229864 CACATTCTGTCACCTTCCTCTGG - Intergenic
1050332876 9:4563168-4563190 CTCCTTCTGTCTTCCCCCTCTGG - Intronic
1052913424 9:33904939-33904961 CACATTTTGTTTCCTCCATCAGG - Intronic
1053618660 9:39794430-39794452 CTCACTAGGTCTCCTCTCTCAGG + Intergenic
1053876837 9:42553792-42553814 CTCACTAGGTCTCCTCTCTCAGG + Intergenic
1053895839 9:42740913-42740935 CTCACTAGGTCTCCTCTCTCAGG - Intergenic
1054234860 9:62547930-62547952 CTCACTAGGTCTCCTCTCTCAGG - Intergenic
1054265495 9:62912999-62913021 CTCACTAGGTCTCCTCTCTCAGG - Intergenic
1054892951 9:70271748-70271770 CTCATTACCTTTCCTCCTTCAGG - Intronic
1055111792 9:72567051-72567073 CTGCTTATGTCTCCTGCCTCAGG + Intronic
1055666651 9:78559832-78559854 CTCCTTGTGTCTCCACTCTCTGG + Intergenic
1055990484 9:82100918-82100940 CTTATTCTGTCTCCTCTCTCAGG + Intergenic
1057475235 9:95394343-95394365 CTCATTATGTCTTGTCTCTTTGG - Intergenic
1057599476 9:96444882-96444904 GTCCTTATTTCTCCTCCCTAAGG - Intergenic
1059476139 9:114549431-114549453 CTGGTTATGTATCCTCTCTCAGG - Intergenic
1060566843 9:124600351-124600373 CTCATTCTTTCTCCACTCTCAGG - Intronic
1203746271 Un_GL000218v1:42109-42131 CTCAGGGCGTCTCCTCCCTCAGG - Intergenic
1186148157 X:6646419-6646441 CTCTATATGTCTCTTCCATCTGG - Intergenic
1188389966 X:29608142-29608164 CACATGATGTCTCTTCCATCAGG + Intronic
1190093915 X:47463679-47463701 CACATTTTGGCTGCTCCCTCTGG + Intronic
1191150794 X:57219677-57219699 CTCCTTTTATCTTCTCCCTCCGG + Intergenic
1192092342 X:68173181-68173203 CTCATTATCTCTCCACCTGCTGG + Intronic
1192694155 X:73397161-73397183 CTCATTATCTCATCTCTCTCAGG + Intergenic
1192726597 X:73760502-73760524 CTCTTTTTTTTTCCTCCCTCAGG + Intergenic
1193258638 X:79379700-79379722 GCCATTTTGGCTCCTCCCTCTGG - Intergenic
1198262024 X:134973519-134973541 CTCATTCTGTCTCTTGCCGCTGG - Intergenic
1198402356 X:136280122-136280144 GGCATTGTGGCTCCTCCCTCTGG + Intergenic
1198410123 X:136358310-136358332 CTCATCCTGTCTCCTTCCTTTGG - Intronic
1199871438 X:151902134-151902156 CTCATCACTTCTCCTGCCTCTGG - Intergenic
1200337962 X:155372207-155372229 CTCATTCTGTCCCCACCCCCTGG + Intergenic
1200348507 X:155468487-155468509 CTCATTCTGTCCCCACCCCCTGG - Intergenic
1201159598 Y:11157123-11157145 CTCAGGGCGTCTCCTCCCTCAGG - Intergenic