ID: 1167603210

View in Genome Browser
Species Human (GRCh38)
Location 19:50466411-50466433
Sequence CGTCGACACAGGCCGCGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 53}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167603197_1167603210 25 Left 1167603197 19:50466363-50466385 CCTCCTGCAGGGGATTGGTCACC 0: 1
1: 0
2: 1
3: 6
4: 145
Right 1167603210 19:50466411-50466433 CGTCGACACAGGCCGCGGTGAGG 0: 1
1: 0
2: 0
3: 1
4: 53
1167603207_1167603210 2 Left 1167603207 19:50466386-50466408 CCGGGGTTGGCGACGGGAGCAGC 0: 1
1: 0
2: 0
3: 13
4: 113
Right 1167603210 19:50466411-50466433 CGTCGACACAGGCCGCGGTGAGG 0: 1
1: 0
2: 0
3: 1
4: 53
1167603206_1167603210 3 Left 1167603206 19:50466385-50466407 CCCGGGGTTGGCGACGGGAGCAG 0: 1
1: 0
2: 1
3: 18
4: 223
Right 1167603210 19:50466411-50466433 CGTCGACACAGGCCGCGGTGAGG 0: 1
1: 0
2: 0
3: 1
4: 53
1167603198_1167603210 22 Left 1167603198 19:50466366-50466388 CCTGCAGGGGATTGGTCACCCCG 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1167603210 19:50466411-50466433 CGTCGACACAGGCCGCGGTGAGG 0: 1
1: 0
2: 0
3: 1
4: 53
1167603205_1167603210 4 Left 1167603205 19:50466384-50466406 CCCCGGGGTTGGCGACGGGAGCA 0: 1
1: 0
2: 1
3: 4
4: 74
Right 1167603210 19:50466411-50466433 CGTCGACACAGGCCGCGGTGAGG 0: 1
1: 0
2: 0
3: 1
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167603210 Original CRISPR CGTCGACACAGGCCGCGGTG AGG Intergenic
900043592 1:490634-490656 CTTCGACACAGGCAGCGGGAGGG + Intergenic
900065030 1:725637-725659 CTTCGACACAGGCAGCGGGAGGG + Intergenic
906495746 1:46302900-46302922 CCCCGAGCCAGGCCGCGGTGCGG + Intronic
922099931 1:222471652-222471674 CTTCGACACAGGCAGCGGGAGGG + Intergenic
922261963 1:223951144-223951166 CTTCGACACAGGCAGCGGGAGGG + Intergenic
924343133 1:243053321-243053343 CTTCGACACAGGCAGCGGGAGGG + Intergenic
1066733355 10:38452253-38452275 CTTCGACACAGGCAGCGGGAGGG - Intergenic
1071893856 10:90042306-90042328 CGTGGGCACAGGCCCCAGTGTGG + Intergenic
1073836005 10:107443746-107443768 CGTGGGCACAGGCCCCGGGGTGG - Intergenic
1074130935 10:110574614-110574636 TGTGGACACAGGTCGAGGTGAGG - Intronic
1076969864 11:126865-126887 CTTCGACACAGGCAGCGGGAGGG + Intergenic
1078326723 11:10387310-10387332 GGTCGACACAGGGCACGGTGGGG + Intronic
1126172985 15:45709394-45709416 CTTCGTCACAGGCTGAGGTGAGG + Intergenic
1131985965 15:98043287-98043309 GGACGACTCAGGCCCCGGTGGGG - Intergenic
1142450815 16:90172267-90172289 CTTCGACACAGGCAGCGGGAGGG - Intergenic
1142456750 17:61424-61446 CTTCGACACAGGCAGCGGGAGGG + Intergenic
1161140520 19:2644777-2644799 CTTTGACACAGGCCACAGTGTGG - Intronic
1161328321 19:3673809-3673831 CCACGACACAGGCTGGGGTGGGG + Intronic
1161973570 19:7596676-7596698 CGTCGGCCCTGGCCGCGCTGCGG + Intronic
1162400708 19:10444961-10444983 CTCAGACACAGGCCGGGGTGAGG - Intronic
1163442584 19:17329226-17329248 CACCGACAGAGCCCGCGGTGGGG - Intronic
1163822129 19:19502078-19502100 CGTGGTCACGGGCTGCGGTGGGG - Intronic
1167603210 19:50466411-50466433 CGTCGACACAGGCCGCGGTGAGG + Intergenic
926849695 2:17181556-17181578 CATGGACACAGGCAGCTGTGTGG + Intergenic
927506097 2:23615759-23615781 CGTGGACACAGACCGTGCTGAGG + Intronic
928116415 2:28548253-28548275 TGTGGACACAGGCTGCGGGGAGG + Intronic
934762044 2:96861756-96861778 CGTCAACACCAGCCGCTGTGTGG - Exonic
1176278839 20:64289439-64289461 CTTCGACACAGGCAGCGGGAGGG - Intergenic
1176583120 21:8549653-8549675 CGTCGGCAAAAGCCGCGGCGAGG - Intergenic
1180265924 22:10526583-10526605 CGTCGGCAAAAGCCGCGGCGAGG - Intergenic
1181134953 22:20758743-20758765 TGTAGACACAGGGCGGGGTGGGG - Intronic
1183708389 22:39488724-39488746 CGTCGAACCAGCCCCCGGTGCGG - Exonic
950014416 3:9745678-9745700 CGTGGGCACTGGCCGCGGCGTGG + Exonic
968371014 3:198222739-198222761 CTTCGACACAGGCAGCGGGAGGG - Intergenic
979259700 4:118635223-118635245 CTTCGACACAGGCAGCGGGAGGG - Intergenic
979328674 4:119405398-119405420 CTTCGACACAGGCAGCGGGAGGG + Intergenic
980286310 4:130782787-130782809 CGTGGACACAGGCCCAGGGGTGG - Intergenic
985571127 5:645889-645911 CGTCCACACAGGCCGCCGACGGG - Intronic
1002730251 5:181328295-181328317 CTTCGACACAGGCAGCGGGAGGG - Intergenic
1002754279 6:145809-145831 CTTCGACACAGGCAGCGGGAGGG + Intergenic
1016914567 6:149232927-149232949 CTTCCACACAGGTCGCTGTGAGG - Intronic
1017819651 6:158039935-158039957 CGTGCACACAGGCGGCTGTGCGG + Intronic
1018926357 6:168209568-168209590 CGTCTCCACTGGCCGTGGTGAGG - Intergenic
1024075406 7:45815489-45815511 CTTCGACACAGGCAGCGGGAGGG - Intergenic
1025129008 7:56365986-56366008 CTTCGACACAGGCAGCGGGAGGG + Intergenic
1025694404 7:63767514-63767536 CTTCGACACAGGCAGCGGGAGGG - Intergenic
1032051924 7:128655214-128655236 CTTCGACACAGGCAGCGGAAGGG - Intergenic
1034952287 7:155306973-155306995 GGTCGACAGAGGCCACAGTGAGG - Intronic
1035274116 7:157737276-157737298 CGTCCACACAGGCCCCAGTCTGG - Intronic
1036375277 8:8194430-8194452 CGTGGACACAGGCCCTGGGGTGG - Intergenic
1036854262 8:12228718-12228740 CGTGGACACAGGCCCTGGGGTGG + Intergenic
1061426576 9:130502237-130502259 CATGGACACAGGCAGCGGAGTGG - Intergenic
1062754663 9:138280809-138280831 CTTCGACACAGGCAGCGGGAGGG - Intergenic
1203578570 Un_KI270745v1:24969-24991 CTTCGACACAGGCAGCGGGAGGG - Intergenic
1201575206 Y:15455703-15455725 CCTCTACACAGAGCGCGGTGGGG - Intergenic