ID: 1167603799

View in Genome Browser
Species Human (GRCh38)
Location 19:50469317-50469339
Sequence GTTCTCAGGGATGTCTCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 187}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167603790_1167603799 7 Left 1167603790 19:50469287-50469309 CCCCTCATCGCCCTGTGTTTCAG 0: 1
1: 0
2: 1
3: 9
4: 150
Right 1167603799 19:50469317-50469339 GTTCTCAGGGATGTCTCCCCTGG 0: 1
1: 0
2: 0
3: 12
4: 187
1167603793_1167603799 5 Left 1167603793 19:50469289-50469311 CCTCATCGCCCTGTGTTTCAGGA 0: 1
1: 0
2: 1
3: 8
4: 132
Right 1167603799 19:50469317-50469339 GTTCTCAGGGATGTCTCCCCTGG 0: 1
1: 0
2: 0
3: 12
4: 187
1167603784_1167603799 30 Left 1167603784 19:50469264-50469286 CCCTTTCTCCAGGCAAGACCCGC 0: 1
1: 0
2: 2
3: 13
4: 137
Right 1167603799 19:50469317-50469339 GTTCTCAGGGATGTCTCCCCTGG 0: 1
1: 0
2: 0
3: 12
4: 187
1167603785_1167603799 29 Left 1167603785 19:50469265-50469287 CCTTTCTCCAGGCAAGACCCGCC No data
Right 1167603799 19:50469317-50469339 GTTCTCAGGGATGTCTCCCCTGG 0: 1
1: 0
2: 0
3: 12
4: 187
1167603789_1167603799 8 Left 1167603789 19:50469286-50469308 CCCCCTCATCGCCCTGTGTTTCA No data
Right 1167603799 19:50469317-50469339 GTTCTCAGGGATGTCTCCCCTGG 0: 1
1: 0
2: 0
3: 12
4: 187
1167603787_1167603799 12 Left 1167603787 19:50469282-50469304 CCCGCCCCCTCATCGCCCTGTGT 0: 1
1: 0
2: 3
3: 26
4: 398
Right 1167603799 19:50469317-50469339 GTTCTCAGGGATGTCTCCCCTGG 0: 1
1: 0
2: 0
3: 12
4: 187
1167603788_1167603799 11 Left 1167603788 19:50469283-50469305 CCGCCCCCTCATCGCCCTGTGTT 0: 1
1: 0
2: 0
3: 18
4: 196
Right 1167603799 19:50469317-50469339 GTTCTCAGGGATGTCTCCCCTGG 0: 1
1: 0
2: 0
3: 12
4: 187
1167603791_1167603799 6 Left 1167603791 19:50469288-50469310 CCCTCATCGCCCTGTGTTTCAGG 0: 1
1: 0
2: 0
3: 12
4: 193
Right 1167603799 19:50469317-50469339 GTTCTCAGGGATGTCTCCCCTGG 0: 1
1: 0
2: 0
3: 12
4: 187
1167603796_1167603799 -4 Left 1167603796 19:50469298-50469320 CCTGTGTTTCAGGAGGCATGTTC 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1167603799 19:50469317-50469339 GTTCTCAGGGATGTCTCCCCTGG 0: 1
1: 0
2: 0
3: 12
4: 187
1167603786_1167603799 22 Left 1167603786 19:50469272-50469294 CCAGGCAAGACCCGCCCCCTCAT 0: 1
1: 0
2: 2
3: 10
4: 140
Right 1167603799 19:50469317-50469339 GTTCTCAGGGATGTCTCCCCTGG 0: 1
1: 0
2: 0
3: 12
4: 187
1167603795_1167603799 -3 Left 1167603795 19:50469297-50469319 CCCTGTGTTTCAGGAGGCATGTT 0: 1
1: 0
2: 0
3: 16
4: 175
Right 1167603799 19:50469317-50469339 GTTCTCAGGGATGTCTCCCCTGG 0: 1
1: 0
2: 0
3: 12
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167603799 Original CRISPR GTTCTCAGGGATGTCTCCCC TGG Intronic
900978871 1:6035046-6035068 CTTCTCATGGAGGTCTTCCCTGG - Intronic
901197879 1:7450342-7450364 ATTTTTAGGGAAGTCTCCCCAGG - Intronic
901254572 1:7811392-7811414 GTTCCCAGTGATGTCACCTCTGG - Intronic
902130457 1:14255904-14255926 GTTACCAGGGATGACTCACCAGG - Intergenic
903767718 1:25745553-25745575 GATCCCGTGGATGTCTCCCCAGG + Intronic
904118672 1:28180652-28180674 TTTCTCAGGTATGTCTGTCCTGG - Intronic
904280248 1:29413827-29413849 TTGCTCAGGGTTGTGTCCCCAGG + Intergenic
904965223 1:34366994-34367016 GTGCTCAGGGCTGGCTCACCAGG - Intergenic
905415247 1:37799559-37799581 CTTCTCAGGTATGGCTCCCATGG + Exonic
909997538 1:82299014-82299036 GGTCTCTGGGATGTCCCTCCAGG - Intergenic
914462789 1:147900156-147900178 TTTCAGAGGGATGTCTTCCCAGG - Intergenic
914843470 1:151266823-151266845 GTTCTCTAGGATGTCTTCCCAGG + Intronic
915664452 1:157431964-157431986 GTTGGCAGGGATGACTCTCCAGG - Intergenic
917835565 1:178939017-178939039 GCCCCCAGGGAAGTCTCCCCTGG + Intergenic
917974549 1:180230372-180230394 CTTCTCAGGGAGGACTCCACAGG - Exonic
918333559 1:183484554-183484576 GTTCTCAAGAATGTGTCACCAGG + Intronic
919288124 1:195592116-195592138 GTTCTAATGGAATTCTCCCCTGG - Intergenic
919900714 1:202042493-202042515 GCTGTCGGGGATGTCTACCCTGG + Intergenic
920851996 1:209634396-209634418 GACATCAGGGATTTCTCCCCAGG + Intronic
923527054 1:234780593-234780615 GCTCTCAGGTATGCATCCCCTGG - Intergenic
1063925680 10:10975021-10975043 GTTTTCAGGGATGTAGCCTCAGG + Intergenic
1064554747 10:16537244-16537266 TTTCTCAGAAATGTCTTCCCTGG + Intergenic
1066459890 10:35603802-35603824 CTTCTCAGGGTTGGCTCCTCTGG - Intergenic
1066802588 10:39207296-39207318 GGTCTCAGGCATGTCTCTTCAGG - Intergenic
1067762452 10:49058450-49058472 GCTCTCAGGGCTGTCCTCCCTGG + Intronic
1067784142 10:49230155-49230177 GTTCTCAGAGATACCTCACCTGG - Intergenic
1069238492 10:66108466-66108488 CTACTCAGAGAAGTCTCCCCTGG + Intronic
1070577324 10:77689024-77689046 GTTCTAAGGGGTCTCTCCCTGGG - Intergenic
1070729943 10:78819850-78819872 GCTCTCAGGGAAGTCTCCAGAGG + Intergenic
1071121034 10:82279231-82279253 GTGCTGAGGGAAGTATCCCCTGG + Intronic
1071296615 10:84225069-84225091 GTTCCCAGGGATCTTTCCCAAGG + Exonic
1073453840 10:103624845-103624867 GGGCTCAGGGATGGGTCCCCTGG - Intronic
1074882528 10:117669840-117669862 CTCCACTGGGATGTCTCCCCAGG - Intergenic
1076289781 10:129336267-129336289 GTTCTCAGGGCTTCCTCCCCTGG - Intergenic
1076687445 10:132204472-132204494 GTTCTCAGGGACCTGCCCCCAGG - Intronic
1077894924 11:6447095-6447117 GTTCTCGGGGAGGACTCCACTGG + Intergenic
1078365382 11:10702069-10702091 GTTTTCAGAGATGTGGCCCCAGG + Intergenic
1078403079 11:11044967-11044989 GTTCCAAGGGAGGACTCCCCAGG + Intergenic
1078640946 11:13095594-13095616 CTTCTCAAGAGTGTCTCCCCAGG + Intergenic
1080073968 11:28126192-28126214 CTTTTCAGGGATGCCTTCCCTGG + Intronic
1082189732 11:49228265-49228287 TTTCTCAGGGAGGTTTTCCCTGG + Intergenic
1083682748 11:64358921-64358943 GGGCTCAGGGATGGCTCCCACGG + Intergenic
1084203924 11:67579958-67579980 GTCCCCTGAGATGTCTCCCCTGG - Intergenic
1084402893 11:68955613-68955635 GTTCCCAGGAATTTCTCCCAGGG - Intergenic
1084742117 11:71146637-71146659 GTGCTCAGGGCTGTACCCCCTGG + Intronic
1085228338 11:74942931-74942953 TTTCTCAGGGATGGCTCTGCGGG - Intronic
1085278113 11:75312874-75312896 GTTGTCAGGGCTGTGTCCTCTGG - Intronic
1085808459 11:79658363-79658385 TTTCTCAGTGAGGCCTCCCCTGG + Intergenic
1085852784 11:80141087-80141109 CTTCTCAGTGAGGTCTCCCCTGG + Intergenic
1086218182 11:84408218-84408240 GGTCTCAGGTATGTCTCCTTTGG - Intronic
1088597408 11:111450579-111450601 GTTCTCAGGGAGCCCTCCCTAGG - Intronic
1089282522 11:117384492-117384514 GGTCAGAGGGATGTCTTCCCAGG + Intronic
1090070698 11:123542517-123542539 TTTATCAGGGAAGTCTCCCTGGG + Intronic
1090756618 11:129797629-129797651 ATACTCAGGGATGGCTTCCCTGG - Intergenic
1090838538 11:130471017-130471039 GTACTCCGGCGTGTCTCCCCGGG + Exonic
1091021865 11:132107128-132107150 GTTCTCATGGATGTTACCCCTGG + Intronic
1092172487 12:6382857-6382879 TGGCTCAGGGATGTCTCCCTTGG - Intronic
1096979212 12:55718784-55718806 TTCCTCAGGGATATCACCCCAGG + Intronic
1099526927 12:83727560-83727582 ATCATCAGGGATGTCTTCCCTGG - Intergenic
1106294273 13:28396097-28396119 CTACTCAGGGATATCTCCCATGG + Intronic
1108522540 13:51259096-51259118 GGACTCAGGGATGACTCCGCTGG - Intronic
1110036009 13:70685051-70685073 GATCTCAGGGATGGATACCCAGG - Intergenic
1112388542 13:98961893-98961915 GTTCTAAGGTATGTGGCCCCAGG + Intronic
1112525712 13:100144944-100144966 GTGCTCAAGGCTGTCTCCTCTGG - Intronic
1113100677 13:106714249-106714271 GTTTTCAGGAATCCCTCCCCAGG + Intergenic
1119177453 14:72579627-72579649 GTTCTAAGGGATGAGTCCCCAGG - Intergenic
1119197137 14:72725347-72725369 GTTCTCATGTAGGCCTCCCCTGG - Intronic
1122883971 14:104702407-104702429 GTCCTCCAGGAAGTCTCCCCAGG + Intronic
1127305991 15:57706351-57706373 CTTCTCAGAGATATCTTCCCAGG + Intronic
1127958117 15:63870784-63870806 GTTCTCAGTGCTGGCTCCCTAGG - Intergenic
1128496414 15:68200967-68200989 GCTCTCAGTGGTGTCTGCCCTGG - Intronic
1130898811 15:88191900-88191922 GCTCTCAGGTCTGGCTCCCCAGG - Intronic
1131109810 15:89758263-89758285 GGTCTCTGGGAAGTCGCCCCAGG + Intergenic
1133196206 16:4172557-4172579 GATAACAGGGATGTCTCCCCAGG + Intergenic
1133206189 16:4235194-4235216 CTTCTCAGGGACCTCGCCCCTGG - Intronic
1135177186 16:20240730-20240752 TTTCCCAGGGATGTCTGTCCAGG + Intergenic
1135623722 16:23977470-23977492 GTTCTCAGTCCTGGCTCCCCAGG - Intronic
1138827848 16:60342272-60342294 GTTCTCAGGGAGGTCTTCTTGGG - Intergenic
1140491076 16:75336348-75336370 CTTCTCAGAGAGGCCTCCCCAGG - Intronic
1142201681 16:88764062-88764084 GTCCTCAGGGAAGGCTTCCCCGG + Intronic
1143299332 17:5898166-5898188 CTTCTCAAGGACGTCTCCCTTGG - Intronic
1144282949 17:13745049-13745071 CTTCTCAGGGCTGCCTTCCCAGG + Intergenic
1146776743 17:35625798-35625820 CTTCTCAGTGAGGTCTTCCCTGG - Intronic
1150226383 17:63526874-63526896 GGTCTCTGAGATGTCTCCCGGGG - Intronic
1150804773 17:68310127-68310149 GATCTCTGGGGTTTCTCCCCAGG - Intronic
1150884444 17:69069350-69069372 GACCCCAGGAATGTCTCCCCCGG - Intergenic
1151283803 17:73095566-73095588 GTTCTCAAGTCTGTCTCCCAGGG + Intergenic
1151801253 17:76381274-76381296 GTTCTCAGGTGTGTCTCCCTGGG + Intronic
1154256904 18:12789643-12789665 GTTCTCAGTGATGTGTAGCCGGG - Intronic
1155245954 18:23909222-23909244 GTTGTCAGAGATGTTTCCCAAGG - Exonic
1156218900 18:35031004-35031026 CTTTTCAGGAATGTCTACCCTGG + Intronic
1157501425 18:48193623-48193645 TATCTCAGAGATGACTCCCCTGG + Intronic
1159519545 18:69500393-69500415 CTTCTCAGTGAGGTCTCTCCTGG + Intronic
1159750231 18:72291932-72291954 GTTCTCCAGGAAGTCTGCCCAGG + Intergenic
1159978140 18:74740978-74741000 GTTCTCAGCCAAGTTTCCCCAGG - Intronic
1160186208 18:76678617-76678639 GTCTCGAGGGATGTCTCCCCAGG - Intergenic
1167125194 19:47544607-47544629 GTTCCCAGAGAGGCCTCCCCCGG - Exonic
1167603799 19:50469317-50469339 GTTCTCAGGGATGTCTCCCCTGG + Intronic
1168492392 19:56821740-56821762 CTTCCCAGGGATGCCTCCGCGGG - Exonic
925833549 2:7919794-7919816 TTTATCAGGAATCTCTCCCCGGG + Intergenic
927194002 2:20535331-20535353 GTTCTCAGAGGAGTCTACCCAGG - Intergenic
931910722 2:66896993-66897015 TTTCTCAGTGATATCTCCCAAGG - Intergenic
931930670 2:67129914-67129936 GTTCTCAGGGTGGACTTCCCAGG + Intergenic
935207135 2:100905873-100905895 GTTCTCATGGCTGCCTCTCCAGG - Intronic
935723834 2:106005883-106005905 ATTCTGAAGGCTGTCTCCCCTGG + Intergenic
936072336 2:109379553-109379575 ATACTCAGGGATGTCTGCCAGGG + Intronic
937937929 2:127260952-127260974 TTTCTCAGGGATGCCTCTCTAGG - Intronic
938724649 2:134096703-134096725 GTTTTCATGTTTGTCTCCCCAGG - Intergenic
939097816 2:137855166-137855188 TTTCCCAGGGCTGCCTCCCCTGG + Intergenic
943356187 2:186858994-186859016 GTTCTCTGAGAAGTCTCCCTGGG + Intergenic
945991104 2:216396044-216396066 TTTCTCAGTGATGCCTTCCCTGG - Intergenic
947142060 2:227028494-227028516 TTTCTCAGGGAAGCCTTCCCTGG + Intronic
948377848 2:237533678-237533700 GTGCTGAGTGCTGTCTCCCCAGG + Intronic
1170613509 20:17932243-17932265 CTGCTCAGTGAGGTCTCCCCTGG + Intergenic
1172793064 20:37519565-37519587 GCTTCCTGGGATGTCTCCCCGGG + Intronic
1173164050 20:40673772-40673794 CTTATCAGTGGTGTCTCCCCAGG - Intergenic
1174337071 20:49870359-49870381 GCAGTCAGGGAGGTCTCCCCTGG + Intronic
1175688102 20:61045997-61046019 GTCCCCAGGTATGTCTCCACAGG + Intergenic
1176228597 20:64018382-64018404 GTTCTCTGTGGTGTCTCCTCCGG + Intronic
1176272854 20:64245479-64245501 GTGCTCAGGGATGGCTCTGCAGG - Intergenic
1176927552 21:14768419-14768441 TTTGTCAAGGATGTCTCCTCAGG - Intergenic
1176971100 21:15266984-15267006 GTTCTCAGTGATTTCTCCTCTGG - Intergenic
1177962821 21:27689804-27689826 GTTCTCAGGGAGGCTTCCCGAGG - Intergenic
1178146305 21:29744241-29744263 GTTTCCAGGGATGCCTCCTCTGG - Intronic
1178301713 21:31458798-31458820 GTTCTCAGGGAAGCCTGTCCGGG + Intronic
1178664355 21:34533772-34533794 CTTCTCAAGGATGCCTTCCCTGG - Intronic
1183736920 22:39649424-39649446 GCACTCAGGGATGTGTCCCAGGG + Intronic
1184100636 22:42340219-42340241 GTTCCCAGGTCTGTTTCCCCAGG + Intronic
1184154146 22:42656127-42656149 GTTCTCAAGGAGCTCTGCCCAGG - Intergenic
1185271997 22:49934098-49934120 GTTCTCAAGGTTGTGCCCCCTGG + Intergenic
952244154 3:31567081-31567103 GGGCTCAGGGTTGTCTCCCATGG - Intronic
954397958 3:50302985-50303007 GTTCTCAGCTCTGCCTCCCCTGG - Exonic
956528242 3:70188017-70188039 CTTCTCTGTGATGCCTCCCCAGG - Intergenic
962461667 3:135620025-135620047 CTTCTCAGTGATGTCTCCTCTGG - Intergenic
963852689 3:150224113-150224135 GTTCTCAGGAACATCACCCCAGG - Intergenic
968478345 4:823278-823300 AATCTCAGGGATGTGGCCCCAGG + Intronic
968549951 4:1217033-1217055 CTTCTCAGGGAGGCCTGCCCTGG - Intronic
970317530 4:14844018-14844040 CTTCTCAGGGAAGACTTCCCTGG - Intergenic
973276586 4:48316398-48316420 ACTCTCAGAGATGTGTCCCCAGG - Intergenic
981042869 4:140238957-140238979 TTTCCCAGGGATGCCTGCCCTGG + Intergenic
981103812 4:140858210-140858232 GTGCCCAGTGATCTCTCCCCAGG + Intergenic
985712348 5:1436441-1436463 GTTCTCATGAATGTTTTCCCTGG - Intronic
988788347 5:34584608-34584630 GTTTTCAGTGATGTCTCCTGTGG + Intergenic
991214552 5:64147685-64147707 CATCTCAGGGAGGTCTTCCCTGG + Intergenic
995478347 5:112570369-112570391 ATTCTCAGGCTTGTCTCCCATGG - Intergenic
997677739 5:135725963-135725985 CTTGTCAGTGCTGTCTCCCCTGG - Intergenic
998604876 5:143623276-143623298 GTTCCCAGGGATTTGTCTCCAGG + Intergenic
999233731 5:150078255-150078277 GTGTTCAGGGGTCTCTCCCCCGG - Intronic
1000523021 5:162320343-162320365 CTTCTCAGGGTTTTCTGCCCTGG + Intergenic
1001581919 5:172804775-172804797 GTTCTCACTGACGTCTTCCCTGG - Intergenic
1002180967 5:177431019-177431041 GGTCTCAGGGGAGGCTCCCCCGG - Intronic
1004295449 6:14405987-14406009 TTCCTCAGCGAGGTCTCCCCTGG - Intergenic
1005500195 6:26422699-26422721 GTGCTCAGGGAGGGCTCCCCAGG + Intergenic
1005801974 6:29435286-29435308 GTGTTCAGGAATGTCTCCTCTGG - Intronic
1009028278 6:58025849-58025871 TTTCTCAGGGAGATCTCACCAGG + Intergenic
1009203811 6:60777233-60777255 TTTCTCAGGGAGATCTCACCAGG + Intergenic
1014473152 6:121840523-121840545 CTTCTCAGGGAGTTCTTCCCTGG - Intergenic
1016367147 6:143331787-143331809 GTTCTCAGGTATAGATCCCCAGG + Intronic
1018181247 6:161225541-161225563 GTTCTAAGGGGTGTATCTCCTGG - Intronic
1018198104 6:161372525-161372547 GTTTACTGGGATGTATCCCCAGG - Intronic
1018324777 6:162654676-162654698 AGTCTCAGGTATGTCTCCACTGG - Intronic
1018436766 6:163766801-163766823 TTTCTCAGGGACGCATCCCCTGG - Intergenic
1023951860 7:44852563-44852585 TTACTCAGGGATCTCTACCCAGG + Intergenic
1029621102 7:101690323-101690345 GTCCCCAGGGATGTGTCCACAGG - Intergenic
1030047817 7:105513089-105513111 CTCCACTGGGATGTCTCCCCAGG - Intronic
1031264279 7:119564775-119564797 GTAGTCAGGGATGGCTTCCCTGG - Intergenic
1033260767 7:139842334-139842356 GTGCTCAGCGATGCCTTCCCGGG + Intronic
1035528220 8:331291-331313 GTTGTTACGGATTTCTCCCCTGG + Intergenic
1036251287 8:7165086-7165108 GATTTCAGAGTTGTCTCCCCAGG + Intergenic
1036888519 8:12578762-12578784 GTTGTAAGGGATGGCTCACCTGG + Intergenic
1038414055 8:27380386-27380408 CTTCTCTGGCAAGTCTCCCCTGG - Intronic
1039000929 8:32979544-32979566 GTACTGAGGGTTGTCTGCCCAGG + Intergenic
1039886323 8:41656108-41656130 CTGCTGGGGGATGTCTCCCCAGG - Intronic
1043563647 8:81523676-81523698 GTCATCAGGGATGTCTTTCCTGG + Intergenic
1049183316 8:141234711-141234733 GTTATCAGGGAGGTCACCTCAGG - Intronic
1053147926 9:35724460-35724482 TTTCTCACTGATGTATCCCCAGG + Intronic
1056135316 9:83624561-83624583 GTGGTCAGGGATGTCTCCTCTGG + Intronic
1057179941 9:93024364-93024386 ACTGTCAGGGATGTCTGCCCTGG - Intronic
1057388986 9:94627523-94627545 GGGCTCAGGGCTGTCTCACCAGG - Intronic
1057801827 9:98195655-98195677 ATTCTTAGGGATGTTGCCCCAGG + Intergenic
1060184183 9:121553742-121553764 CTATTCAGGGAGGTCTCCCCTGG + Intergenic
1060230664 9:121822865-121822887 GTTCACAGGGATGTGTCTGCAGG - Exonic
1060936269 9:127517928-127517950 GTCCTCAGGGATTCCTGCCCAGG + Exonic
1061217383 9:129229627-129229649 GTGCTCAGGGCAGTGTCCCCTGG + Intergenic
1061287377 9:129631783-129631805 CTCCTCAGGGATGCCTTCCCTGG + Intronic
1062420105 9:136476581-136476603 GTTTTCTGGGCTATCTCCCCGGG + Exonic
1062723502 9:138057991-138058013 GTTCTTAGGGCTGTCTCCTTTGG + Intronic
1189913320 X:45832970-45832992 CTTCTCAGGCATGGCTCTCCTGG - Intergenic
1191141065 X:57117350-57117372 GTTCTCAGTGAGGCCTTCCCTGG + Intergenic
1191142665 X:57133066-57133088 GTTCTCAGTGAGGCCTTCCCTGG + Intergenic
1194620196 X:96161883-96161905 GATTTATGGGATGTCTCCCCAGG + Intergenic
1196749116 X:119098632-119098654 CTTTTCAGTGATGTCTTCCCTGG + Intronic
1196965815 X:121053736-121053758 ATTCTCAGGCAGATCTCCCCTGG - Intergenic
1197654980 X:129107017-129107039 GTTCTCAGGTCTATCTCCCCTGG - Intergenic
1198225872 X:134645477-134645499 ACTTTCTGGGATGTCTCCCCTGG + Intronic
1200276132 X:154734647-154734669 TTGCTCAGCGCTGTCTCCCCAGG - Intronic
1201466978 Y:14293108-14293130 ATTCTTAGGGATGTCTTCTCTGG - Intergenic
1201782580 Y:17739887-17739909 GTGATCAGTGATGTCTCCTCAGG + Intergenic
1201818973 Y:18166101-18166123 GTGATCAGTGATGTCTCCTCAGG - Intergenic
1202131867 Y:21620390-21620412 GGGCTCAGGGATGTCTCAGCGGG + Intergenic