ID: 1167606655

View in Genome Browser
Species Human (GRCh38)
Location 19:50484864-50484886
Sequence CAGAGTGAGCATACAGTTTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167606655_1167606660 8 Left 1167606655 19:50484864-50484886 CCAGAAACTGTATGCTCACTCTG 0: 1
1: 0
2: 2
3: 5
4: 141
Right 1167606660 19:50484895-50484917 CACCCACTTCCCCTCCCTGGAGG 0: 1
1: 0
2: 3
3: 63
4: 482
1167606655_1167606659 5 Left 1167606655 19:50484864-50484886 CCAGAAACTGTATGCTCACTCTG 0: 1
1: 0
2: 2
3: 5
4: 141
Right 1167606659 19:50484892-50484914 CAGCACCCACTTCCCCTCCCTGG 0: 1
1: 0
2: 7
3: 67
4: 579

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167606655 Original CRISPR CAGAGTGAGCATACAGTTTC TGG (reversed) Exonic
900763081 1:4486091-4486113 CAGAGTGGGCATACAGCTGCAGG - Intergenic
904826599 1:33277351-33277373 CAGAGTGAAGATACAGGCTCTGG - Intronic
905517571 1:38573307-38573329 CAAAGTGACCATACAGTTGATGG - Intergenic
908135831 1:61131227-61131249 CAGAGTGAACTTCCAGTTGCTGG - Intronic
908784262 1:67719426-67719448 CAGATTTTGCATACAGTTTTAGG - Intronic
908792182 1:67793859-67793881 CAGTTTCAGCACACAGTTTCTGG + Intronic
909927443 1:81454919-81454941 CAGAGTGAACATCCTGTTTGTGG + Intronic
914712477 1:150227505-150227527 AAGAGTGAGCATGCAGTATTTGG - Intronic
914712512 1:150227895-150227917 TATTGTGAGCATACAGTTTTAGG - Intronic
915970940 1:160354682-160354704 CAGAGTATGAATACTGTTTCTGG - Intronic
917038075 1:170771425-170771447 AAGAGAGAACATACAGTTTTTGG - Intergenic
917746920 1:178018879-178018901 CAGACCCTGCATACAGTTTCTGG + Intergenic
918149923 1:181789552-181789574 CAGAGTGAGCTTCCAGATTATGG - Intronic
919590846 1:199500037-199500059 CAGAGTGAACAGACAGCTTAAGG + Intergenic
920646232 1:207806347-207806369 CAGAGGGAGCATGGAGTTACCGG + Intergenic
920844541 1:209583007-209583029 CAGAGGGAGCACAGAGTTTCCGG + Intergenic
924221359 1:241878788-241878810 CAAAGTGAGCATCCAGCCTCTGG + Exonic
1063133811 10:3199530-3199552 CAGAGTGAGAATTCAGGTTGTGG + Intergenic
1066248554 10:33609886-33609908 CAGAGAGAGCATACAGTCTGGGG + Intergenic
1078076467 11:8166567-8166589 TAGAGAGAACATACAGTTTTAGG + Intronic
1078730267 11:13967140-13967162 CAGAATCAGGATACAGTCTCAGG + Intronic
1079137162 11:17782043-17782065 CAGGGTAATCATACAGTTGCAGG - Exonic
1079678579 11:23263814-23263836 CAAAGTGAACAGAGAGTTTCAGG - Intergenic
1080272488 11:30465790-30465812 CAGACTGAGAATACATTTGCAGG + Intronic
1093307540 12:17539083-17539105 CCCAGTGACCATACAGTTTTGGG + Intergenic
1093965288 12:25317880-25317902 TAGAATGAACATATAGTTTCAGG + Intergenic
1094353505 12:29552747-29552769 CAGAATGAGCATTAAGTTCCAGG + Intronic
1099686130 12:85891680-85891702 CAAAGTGAGCATGCAATTGCTGG - Intergenic
1100227146 12:92570335-92570357 CAAAATGCACATACAGTTTCTGG - Intergenic
1100508806 12:95247826-95247848 CACAGTGTTCATACAGTATCTGG + Intronic
1101391970 12:104309436-104309458 CAGCATGAGGATACATTTTCTGG + Intronic
1105691359 13:22843078-22843100 CAGAGTGAGAACAGACTTTCGGG - Intergenic
1107096356 13:36541201-36541223 CAGAGTGAGGATACTGTGTGAGG + Intergenic
1109190722 13:59320080-59320102 CTGAGGGAACATACAGTGTCTGG - Intergenic
1109956215 13:69570095-69570117 CAGGGTGAGCCTGAAGTTTCTGG - Intergenic
1112123525 13:96439499-96439521 GAGGGTGAGAATACAGATTCTGG + Intronic
1112382728 13:98907836-98907858 CAGAGTCAGGAAACAGTATCTGG + Intronic
1113225505 13:108154929-108154951 CAGGGTGAGAATAAAGTTGCAGG + Intergenic
1115663475 14:35521076-35521098 CAAAGTTAACATACAGTTTAAGG + Intergenic
1115882870 14:37939767-37939789 CAGGGTGAGAAAACAGGTTCAGG + Intronic
1117474966 14:56084715-56084737 CAGAGTGAAGATACAATTTTGGG - Intergenic
1120392897 14:83930343-83930365 CAGAATGGGCATACAGTTATTGG - Intergenic
1121398965 14:93654902-93654924 AAGACTGAGCATAGAGTTACAGG - Intronic
1123893820 15:24808925-24808947 CAGAGGGAGAATACAGATGCTGG + Intergenic
1125216208 15:37278472-37278494 AAGAGAGAGCATGCAGTGTCTGG - Intergenic
1126310619 15:47312280-47312302 CAGAGTGAGAACACTGTTTTAGG - Intronic
1126538600 15:49796690-49796712 TAGAGTGAGCTTATAGTTTGAGG + Intergenic
1128442550 15:67725813-67725835 CAGAGTGTGCACACTGATTCAGG - Intronic
1130048818 15:80466562-80466584 CAGAGTGAGGAGACAATTTGGGG - Intronic
1134235903 16:12466320-12466342 CAAAGTCAGCATACAGAATCTGG + Intronic
1134813225 16:17185062-17185084 CAGAGTGAGCCTAGAGTTCTCGG - Intronic
1139797156 16:69492536-69492558 TAGACTGAGCATAGAGTTTGGGG - Intergenic
1143987296 17:10925953-10925975 CTGAGTGAGCAGGCTGTTTCAGG + Intergenic
1144084603 17:11797629-11797651 CAAAGTGACAATACAGGTTCGGG - Exonic
1145815462 17:27792238-27792260 CAGACTGTGTATACAGTTTAAGG - Intronic
1148404748 17:47401026-47401048 CAGAGAGAGAACACAGATTCAGG + Intronic
1151063769 17:71127304-71127326 AAGAGCAAGCACACAGTTTCAGG + Intergenic
1153827716 18:8891714-8891736 CAGAGTGAGGATAAACTTCCTGG - Intergenic
1154978053 18:21478319-21478341 TATATTTAGCATACAGTTTCAGG - Intronic
1156016693 18:32554421-32554443 CAGAGTGAGCATGAAGTTAGTGG + Intergenic
1165289732 19:34873641-34873663 AAGAGTGAGCAGAAAGTTGCTGG + Intergenic
1167606655 19:50484864-50484886 CAGAGTGAGCATACAGTTTCTGG - Exonic
930848266 2:55928921-55928943 CAGAATTAGCCCACAGTTTCTGG + Intergenic
931077208 2:58729029-58729051 CAGGTTAAGCATACAGGTTCTGG - Intergenic
933300115 2:80531468-80531490 TAGAGTGATCCTCCAGTTTCAGG + Intronic
933575352 2:84060966-84060988 GGGAATGAGCATAAAGTTTCAGG - Intergenic
936430770 2:112460558-112460580 CAGAGTCAGCTAACAGTTGCTGG - Intergenic
938104002 2:128517666-128517688 CCCAGTGTGCATACACTTTCTGG - Intergenic
940510153 2:154603698-154603720 CAATGTGAGCATCAAGTTTCTGG - Intergenic
941301141 2:163802984-163803006 AACAGGGAGCAGACAGTTTCTGG - Intergenic
943188584 2:184646806-184646828 CAAAGGGAGAATACAGTGTCTGG - Intronic
944651816 2:201837978-201838000 CGGTGTGAGCTGACAGTTTCAGG - Intronic
944891742 2:204124613-204124635 CTGAGTGAGCATCCAGATTTAGG + Intergenic
947347059 2:229202981-229203003 CAGATTTAGAAAACAGTTTCAGG + Intronic
1168737194 20:151137-151159 CAGAGTGAGAAGGCAGTTTATGG - Intergenic
1173591593 20:44229069-44229091 CAGAGTGGGCAGACAGCTCCTGG + Intergenic
1177490768 21:21823229-21823251 CAGAGTAAACAGACAGTTTATGG - Intergenic
1181864627 22:25845662-25845684 CAGGCTGGGCACACAGTTTCTGG - Intronic
1183102118 22:35590693-35590715 CAGAGTGGCCAGACAGCTTCAGG + Intergenic
1183168091 22:36162695-36162717 GAGAGTGAGCAAACAATTGCAGG - Intronic
950497669 3:13343676-13343698 CAGAGTGAGGATGCAGTCCCAGG + Intronic
952993251 3:38851916-38851938 AAGACTGAGAATATAGTTTCCGG + Intronic
959633788 3:108538244-108538266 CAGACTGAGCTTCCAGTTTAAGG + Intergenic
959995759 3:112678510-112678532 CAGAGTCAGGATGCAGTTGCAGG + Intergenic
961402984 3:126660219-126660241 CAGAGTGAGAATGCAGTCCCAGG - Intergenic
964623581 3:158738545-158738567 CTGTGTGAGCATGCAGTTTCAGG - Intronic
966473713 3:180320934-180320956 CAGGTGGAGCATACAATTTCTGG + Intergenic
967631474 3:191747275-191747297 CAGAGTGAGCAGACAACTTAAGG - Intergenic
967758248 3:193195138-193195160 CAAAGTCAGAATAAAGTTTCAGG - Intergenic
969443929 4:7233496-7233518 CAGGGTGAGCAGACACTTGCTGG + Intronic
973237903 4:47925684-47925706 AAGTGTGAACATACAGTTTTTGG - Intronic
976704082 4:88003857-88003879 AAGGGTGAGGATATAGTTTCAGG + Intergenic
983265845 4:165507322-165507344 CAGAGTGAAGATACAGCTCCTGG + Intergenic
988792387 5:34620530-34620552 CAAAGTGTGGCTACAGTTTCAGG + Intergenic
991099361 5:62775752-62775774 CCCAGTGTGCATACACTTTCTGG - Intergenic
991199218 5:63971615-63971637 CAGAGTGATCAGGCAGTTTACGG - Intergenic
991439883 5:66635815-66635837 CAGACTTTGCATACAATTTCAGG - Intronic
992198522 5:74362837-74362859 CAGAATCAGCCTTCAGTTTCAGG - Intergenic
994447161 5:99891006-99891028 CAGGGTGAGCATGCTGTTGCAGG - Intergenic
996010425 5:118476306-118476328 CAGAATGAGGATACAAATTCTGG - Intergenic
998677982 5:144430974-144430996 CATATTTTGCATACAGTTTCAGG + Intronic
1001164021 5:169347142-169347164 CAGAGTGGGCACAGAATTTCAGG - Intergenic
1002432046 5:179209306-179209328 CAGACTGAACATGAAGTTTCAGG + Intronic
1003510652 6:6777177-6777199 CAGTTTGAGCATAGAGTTCCAGG + Intergenic
1005623232 6:27639099-27639121 CAGTGTGAAAATGCAGTTTCAGG - Intergenic
1006367638 6:33624833-33624855 CAGAGGCAGCATTCAGATTCTGG + Intronic
1007904896 6:45449691-45449713 CAGAGTGGGCATGCAGTTCATGG + Intronic
1008077578 6:47161364-47161386 CATAGTTGGCATACAGTTTGAGG + Intergenic
1009401676 6:63263617-63263639 CAGGGTGAGCATCCAGGGTCAGG + Intergenic
1010021734 6:71168098-71168120 AAGAGTCAGAGTACAGTTTCAGG - Intergenic
1010127863 6:72454933-72454955 CAGAGTGAGGATGCAAATTCAGG - Intergenic
1011676843 6:89743064-89743086 CAGAGTGAGAACACTGTCTCAGG + Intronic
1011982786 6:93404006-93404028 CAGAGTGAGAGAACAGTATCAGG + Intronic
1012164992 6:95937913-95937935 CCCAGTAAGCATACAGCTTCAGG + Intergenic
1013747838 6:113366879-113366901 CAGAGGGACAATACAGTTTTGGG - Intergenic
1014478146 6:121900930-121900952 CAGAATGTGCACACAGTTTGGGG - Intergenic
1014641293 6:123914162-123914184 CATAGTGAGAAGACAGTTACTGG - Intronic
1018848760 6:167572885-167572907 CAGAGTGAGGACGCAGATTCAGG - Intergenic
1020287886 7:6699558-6699580 CAAAGTGTGCACAGAGTTTCTGG - Intronic
1021187448 7:17581430-17581452 AGGTGTGAGCATTCAGTTTCTGG - Intergenic
1021475635 7:21057722-21057744 CAGAGTGTGCAGGCAGTTGCAGG - Intergenic
1021945607 7:25723919-25723941 AAGAGGGAGCATACAGTTGGAGG - Intergenic
1022056899 7:26746010-26746032 CAGAATGAACATACATTTTCAGG + Intronic
1023623642 7:42096015-42096037 CAGAGGGAGGAGGCAGTTTCAGG + Intronic
1024744876 7:52394382-52394404 CAGTGAGAGCATACAGTGTTTGG + Intergenic
1028013684 7:85680267-85680289 CAGGCTGAGCATATAATTTCAGG + Intergenic
1028384051 7:90233701-90233723 CAGAGTGAGCATTCAAGTCCAGG + Exonic
1032645820 7:133823011-133823033 CAGGATGAGCCTACATTTTCTGG + Intronic
1033216103 7:139494860-139494882 AAGAGTGAGCATCCTTTTTCAGG - Intergenic
1033305358 7:140221561-140221583 CAGAGTGAGCAGGAAGTTGCTGG - Intergenic
1034306794 7:150049631-150049653 CAGAGGGAGCATGCAGTTTCAGG - Intergenic
1034800050 7:154051011-154051033 CAGAGGGAGCATGCAGTTTCAGG + Intronic
1037555738 8:20020441-20020463 CAGAGTGAGCATCATGCTTCTGG - Intergenic
1038831583 8:31067152-31067174 CAGTGGCTGCATACAGTTTCTGG - Exonic
1039462145 8:37754025-37754047 CAGTGTGAGCAAGCAGTTTGAGG + Exonic
1040704693 8:50111385-50111407 CAGAGAGAGGATATACTTTCTGG - Intronic
1044434985 8:92151242-92151264 CAGATTCAGGATACATTTTCAGG + Intergenic
1046465519 8:114597528-114597550 CACAGTGAGAATGTAGTTTCTGG + Intergenic
1047084615 8:121502708-121502730 CAGAGGGAGCATAGAGGTTTGGG - Intergenic
1049011039 8:139887559-139887581 CAGAGAGAGCACACAGTATTTGG - Intronic
1055828234 9:80352328-80352350 CAGAATAAGCATAAAGTTTATGG + Intergenic
1056404978 9:86264925-86264947 CCCAGTGTGCATACATTTTCTGG - Exonic
1057065775 9:92049573-92049595 CAGAGAAAGGATACTGTTTCTGG - Intronic
1193617184 X:83703564-83703586 AAGTGAGAACATACAGTTTCTGG + Intergenic
1195320359 X:103716833-103716855 AAGAGTGAGCAGACAGTCCCTGG + Intronic
1195366601 X:104132532-104132554 CACAGTGACCAGACAGATTCTGG + Intronic
1195429628 X:104774001-104774023 CAGAGTGAACAAACATATTCAGG + Intronic
1200979611 Y:9250362-9250384 TCGAGTGAGCATCAAGTTTCAGG - Intergenic
1202059904 Y:20875870-20875892 CACATTGAGCATACATTCTCAGG - Intergenic