ID: 1167608575

View in Genome Browser
Species Human (GRCh38)
Location 19:50494906-50494928
Sequence GTGGAGGAGCAGAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167608566_1167608575 -4 Left 1167608566 19:50494887-50494909 CCAGGAGGCCTCCGTGGGGGTGG No data
Right 1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG No data
1167608565_1167608575 -3 Left 1167608565 19:50494886-50494908 CCCAGGAGGCCTCCGTGGGGGTG No data
Right 1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167608575 Original CRISPR GTGGAGGAGCAGAGGGAGGA GGG Intergenic
No off target data available for this crispr