ID: 1167612218

View in Genome Browser
Species Human (GRCh38)
Location 19:50513016-50513038
Sequence GAGAGGGGAAAGAGGGCGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1888
Summary {0: 1, 1: 0, 2: 13, 3: 162, 4: 1712}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167612209_1167612218 -5 Left 1167612209 19:50512998-50513020 CCAGATCAGGGCGCCTGGGAGAG 0: 1
1: 0
2: 0
3: 16
4: 162
Right 1167612218 19:50513016-50513038 GAGAGGGGAAAGAGGGCGGAGGG 0: 1
1: 0
2: 13
3: 162
4: 1712
1167612204_1167612218 7 Left 1167612204 19:50512986-50513008 CCACTTCCACAACCAGATCAGGG 0: 1
1: 0
2: 0
3: 14
4: 135
Right 1167612218 19:50513016-50513038 GAGAGGGGAAAGAGGGCGGAGGG 0: 1
1: 0
2: 13
3: 162
4: 1712
1167612206_1167612218 1 Left 1167612206 19:50512992-50513014 CCACAACCAGATCAGGGCGCCTG 0: 1
1: 0
2: 0
3: 4
4: 110
Right 1167612218 19:50513016-50513038 GAGAGGGGAAAGAGGGCGGAGGG 0: 1
1: 0
2: 13
3: 162
4: 1712

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167612218 Original CRISPR GAGAGGGGAAAGAGGGCGGA GGG Intronic
900149096 1:1170533-1170555 GAGAGGAGGAGGAGGGAGGAGGG - Intergenic
900370745 1:2331124-2331146 GGGAGGGGAGACAGGGTGGACGG - Intronic
900373753 1:2344038-2344060 CAGATGGGAAAGAAGGCCGATGG - Intronic
900384020 1:2401228-2401250 GAGGGAGGAAGGAGGGAGGAAGG - Intronic
900384024 1:2401239-2401261 GAGGGAGGAAGGAGGGAGGAAGG - Intronic
900384085 1:2401406-2401428 GAGAGAGGAAGGAGGAAGGAGGG - Intronic
900634020 1:3652935-3652957 GAGAGGGGACAGCAGGAGGAGGG - Intronic
900708050 1:4092948-4092970 GAGAGAGGAGAGAGAGGGGATGG - Intergenic
900774475 1:4571899-4571921 GAGAAGGGCAGGAGGGAGGAAGG + Intergenic
900932880 1:5747797-5747819 GAAAGGAGAAAGAGGGAGGAAGG + Intergenic
901125614 1:6926391-6926413 GAGAGAGGAGGGAGGGAGGAAGG - Intronic
901300452 1:8196565-8196587 GAGAGGGAGAAGAGGGAGGCAGG - Intergenic
901740317 1:11338017-11338039 AAGAGGGGGAGGAGGGGGGAAGG - Intergenic
901863202 1:12087849-12087871 GAGAGGGGAAGTGGGGAGGAGGG - Intronic
902051690 1:13568162-13568184 GAGAGGGGAAAGAGGCAGAGAGG + Intergenic
902051699 1:13568202-13568224 GAGAGGGGAAAGAGGCAGAGGGG + Intergenic
902051703 1:13568219-13568241 GAGGGGGGAAAGAGGCAGAAAGG + Intergenic
902567409 1:17321250-17321272 GAGATGGGAAAGTGGGGGGCAGG + Intronic
902677729 1:18020584-18020606 GAGAGGGAAAAGAGGGGGAGAGG - Intergenic
902677737 1:18020615-18020637 GAGAGGGGAGAGAGAGAGGGAGG - Intergenic
902688963 1:18097707-18097729 GAGAAGGGAAAGAGGGAGAGAGG - Intergenic
902690471 1:18107689-18107711 GGGAGGGCAAGGAGGGCGGGGGG + Intergenic
902779191 1:18693578-18693600 GAGTGAGGACAGGGGGCGGAGGG - Intronic
902813721 1:18904206-18904228 GGGAGGGGTAGGAGGACGGAAGG - Intronic
903018898 1:20379891-20379913 GGGTGGGGAAAGAGGGCAGGTGG - Intergenic
903331609 1:22599757-22599779 AAGAAGGGAGAGAGGGAGGAAGG + Intronic
903406772 1:23103900-23103922 GAGGGGGGAAGGAGGGAGGGAGG + Intronic
903679785 1:25089203-25089225 GGGAGGGGAAAACGGGAGGAAGG + Intergenic
903993089 1:27288036-27288058 AGGAGGGCAAAGAGGGAGGAAGG - Intronic
904163644 1:28538750-28538772 GGGTGGGGAGAGAGGGTGGAGGG + Intronic
904653654 1:32025738-32025760 GAGAGGGGAGAAAGGGAGGAAGG - Intronic
904683706 1:32246319-32246341 GAGAAGGGAGGGAGGGAGGAAGG - Intergenic
905313562 1:37066838-37066860 AAGAGGGGAATGAGGGAGGAAGG - Intergenic
905352120 1:37355093-37355115 GGGAGGGAAAAGAGGAAGGAGGG + Intergenic
905365022 1:37446213-37446235 GAGAGAGGAGAGAGGGAAGAGGG - Intergenic
905424630 1:37873213-37873235 GAAAGGGGAAAGAAGGCAGGAGG + Intronic
905481892 1:38267669-38267691 GAGGGAGGAAAGAGGGAGGGAGG - Intergenic
905495057 1:38378341-38378363 GAAAGGAGAAAGAGCGGGGAAGG + Intergenic
905665666 1:39761607-39761629 GTGAGTGGGAGGAGGGCGGAGGG - Intronic
905774124 1:40657291-40657313 CAGTGGGGAAAGAGGCAGGATGG + Intronic
905812637 1:40923721-40923743 GGGATGGGAATGGGGGCGGAAGG + Intergenic
906153416 1:43600713-43600735 GAGAGGGGAAAAAGGGAGGCAGG - Intronic
906359352 1:45139436-45139458 GAGAGGGGAGGGAGAGAGGAGGG - Intronic
906503213 1:46357420-46357442 GAGAGGCCAAGGCGGGCGGATGG - Intronic
906557721 1:46727816-46727838 GAGAGTGGAGAGTGGGAGGAGGG + Intergenic
906700110 1:47851464-47851486 GTGAGGAAAAAGAGGGAGGAAGG + Intronic
906750648 1:48256234-48256256 GAGAGTGGAAAGTGGGAGGAGGG + Intergenic
906816710 1:48887095-48887117 GAAAGGGGAAAGAGGGCTTGTGG + Intronic
906918021 1:50032563-50032585 GAGAAGGGAAAGAGGTCCCAAGG + Intergenic
906994206 1:50772699-50772721 GAGAGTGGAGAGTGGGAGGAGGG + Intronic
907019723 1:51055146-51055168 GGGAGGGGAGAGAGGGAGGGAGG - Intergenic
907390128 1:54152793-54152815 GAGAGGGGAAGGAGGTGGGCAGG - Intronic
907922844 1:58929522-58929544 GAGAGCATAAGGAGGGCGGAGGG - Intergenic
907938029 1:59060135-59060157 GAGAAGGAAAAGAGGGTGAAGGG + Intergenic
908080128 1:60568309-60568331 GAGAGGGGAGAGAGGGAGGAGGG - Intergenic
908131901 1:61082699-61082721 GAGAGGAGAAAGAGGGAGAGAGG - Intronic
908234593 1:62137565-62137587 GAGGGGGGACAGAGGCCTGAGGG + Intronic
908234613 1:62137619-62137641 GAGGGGGGACAGAGGCCTGAGGG + Intronic
908272708 1:62436665-62436687 GAGACGGGACAGAGAGCAGACGG - Exonic
908287310 1:62621136-62621158 GAGAGGAAGAAGAGGGAGGAAGG + Intronic
908446912 1:64207381-64207403 GGGAGGCCAAAGTGGGCGGATGG - Intronic
908567110 1:65368653-65368675 GAGAGAGGAAGGAAGGAGGAAGG - Intronic
909056441 1:70826494-70826516 GAGGTGGGAAAGTGGGTGGAAGG - Intergenic
909221663 1:72970768-72970790 GAGAAGGGAAAGAGGAGAGAAGG - Intergenic
909540785 1:76789229-76789251 GAGAAGAGAAAGAGGGAAGATGG + Intergenic
910159536 1:84258738-84258760 GAGAGAGGAAAGAAGCGGGAAGG - Intergenic
910654931 1:89609877-89609899 GAGAGAGGATAGAGAGAGGACGG - Intergenic
911016030 1:93333690-93333712 AAGAAGGGAAAGAGGGAGGGAGG + Intergenic
911090630 1:94014321-94014343 GACGGGGGAAGGAGGGAGGAGGG + Intronic
911201034 1:95043851-95043873 GAGAAGGGAATGAGGGAGGAAGG + Intronic
911866247 1:103026815-103026837 GAGACGGGAAAGAGGGGAGGAGG + Intronic
911964401 1:104348330-104348352 GAGAAGGGAAAGTGGGCTGGAGG + Intergenic
912374837 1:109201589-109201611 GAGGGCGGAAAGAGGGAGGAGGG + Intronic
912560813 1:110550318-110550340 GAGTGGGAAAAGAAGGCGGTTGG - Intergenic
912661907 1:111539242-111539264 GAGAGGGGAGAGAAGGAGGCAGG - Intronic
912727015 1:112067609-112067631 GAGAGTGGGAGGAGGGCAGAGGG - Intergenic
912997645 1:114547273-114547295 GAGTGGGGAAAGAGGGCTGAGGG + Intergenic
913026999 1:114854063-114854085 GAGAGGGGAGAGCGGGGGAAGGG - Intergenic
913183867 1:116348904-116348926 GGGAAGGGAAGGAGGGAGGAAGG + Intergenic
913208915 1:116567260-116567282 GGGAGGGGAGAGAGGAAGGATGG + Intronic
913385349 1:118252974-118252996 TTGAAGGGAAAGAGGGAGGAAGG - Intergenic
913697017 1:121336462-121336484 GAGAGGGAAGAGAAGGCAGAGGG - Intronic
914140542 1:144943582-144943604 GAGAGGGAAGAGAAGGCAGAGGG + Intronic
915334116 1:155130498-155130520 GAGAGGGGAGAGAGGGGAGAGGG + Intronic
915541677 1:156571198-156571220 GAGAGGGGAGAGAAGGGAGAAGG - Intronic
915650784 1:157308933-157308955 GAGAGAGGGAAGAGGGAGGGAGG - Intergenic
915732749 1:158065834-158065856 CTGAGGGGAAAGAGGGCAGGCGG - Intronic
916000535 1:160611056-160611078 GAGAGGGCAAAGAGGGAGACAGG - Intronic
916046677 1:161005278-161005300 GGGAGGGGAAGGAGGAAGGAGGG - Intronic
916203516 1:162294146-162294168 GAGAGGGGAAGAAGGAAGGAAGG + Intronic
916471111 1:165123646-165123668 GAGAGGGGAAGGAGAGCTGAAGG + Intergenic
916680520 1:167100485-167100507 GAAAGGGGAAACAGGACGCAGGG + Intronic
916802969 1:168231714-168231736 GAGAGGGGAATAAGGGAGGTGGG + Intronic
917073187 1:171175033-171175055 GGGAGGGGAGATAGGGAGGAAGG + Intergenic
917140306 1:171828523-171828545 GAGAGAAGCAAGAGGGTGGAGGG + Intergenic
917400384 1:174642743-174642765 GAGAGGGGAAGAAGGGGAGAGGG - Intronic
917462133 1:175241099-175241121 AAGAGTGGAAAGGGGGCCGAGGG + Intergenic
918522954 1:185434965-185434987 GAGAGGGAAGAGAGGGAAGAGGG - Intergenic
918539143 1:185608825-185608847 GAGAGGGGAGGGTGGGAGGAGGG + Intergenic
918595481 1:186287968-186287990 GAAAGGAGAGAGAGGGAGGAAGG - Intergenic
918668873 1:187187580-187187602 GAGGGGGGAAAGCAGGAGGAGGG + Intergenic
919058836 1:192605784-192605806 GAGAGAGGAGAGAGGGAGGGAGG + Intergenic
919176722 1:194028435-194028457 GAGAGGGGAAGGGGAGGGGAGGG - Intergenic
919638235 1:200024777-200024799 GAGAGGGGGAAGGGAGGGGAGGG + Intergenic
920484348 1:206354799-206354821 GAGAGGGAAGAGAAGGCAGAGGG - Intronic
920558008 1:206918353-206918375 GTGAGGGGAGAGAGGGAGGGAGG - Intronic
920820196 1:209373410-209373432 GAGAGAGGAATGAGAGAGGAAGG + Intergenic
920845609 1:209590726-209590748 GAGAGGGGAGAGAGCAAGGATGG + Intronic
920920625 1:210294697-210294719 GAGTGGAGATAGAGGGCTGATGG - Intergenic
921024771 1:211267830-211267852 GGGAGGCCAAGGAGGGCGGATGG - Intronic
921061892 1:211592212-211592234 GAAAGGTGAAAGAGCGAGGAGGG + Intergenic
921072152 1:211669867-211669889 GAGGGGTGATGGAGGGCGGACGG - Intronic
921183019 1:212646188-212646210 GAGTGGGAGAAGGGGGCGGAGGG - Intergenic
921847647 1:219901000-219901022 GAGAGGGGAGGGAGGGAGAAAGG + Intronic
922642899 1:227253208-227253230 GAGAGAGGAGAGAGAGAGGAGGG + Intronic
923012164 1:230096475-230096497 GAAAGGGGAAGGAAGGCGGGAGG - Intronic
923012167 1:230096482-230096504 GAGAGGGGAAAGGGGAAGGAAGG - Intronic
923109553 1:230879876-230879898 GAGAGGGGGAAGCCGGCAGAGGG - Intergenic
923285543 1:232491440-232491462 GAGATGGGAGAAAGGGAGGATGG - Intronic
923300444 1:232635440-232635462 GAGGGAGGAAGGAGGGAGGAAGG + Intergenic
923455813 1:234164350-234164372 GAGAGGGGAAAGAAGGAGGGAGG - Intronic
923482447 1:234397458-234397480 GGGAGGGGAAGGAGGGAGGATGG + Intronic
923482491 1:234397541-234397563 AGGAGGGGAAAGAGGGAGGGGGG + Intronic
923482570 1:234397715-234397737 GAGGGGGAAGAGAGGGAGGAGGG + Intronic
923521451 1:234738053-234738075 GAGAGAGGAGAGAGGGGAGAAGG + Intergenic
923688783 1:236173412-236173434 GAGAGAGGAAGGAGGGAGGGAGG + Intronic
923821444 1:237447828-237447850 GGGAGGGGAAAGAGGGAGGGAGG - Intronic
924118877 1:240776422-240776444 GGGAGGGGTAGGAGGGTGGAGGG - Intronic
924202618 1:241675225-241675247 GAGGGAGGAAGGAGGGAGGAAGG - Intronic
924461465 1:244263356-244263378 GAGAAGGAAGAGAGGGAGGAGGG + Intergenic
924486325 1:244487324-244487346 GAGAAGGGAAATATGGCGGCTGG - Intronic
924539890 1:244970737-244970759 AAGAGGGTGAAGAGGGCGGGAGG - Exonic
924576332 1:245284034-245284056 GAGAGGGAAAGGAGGGATGAGGG - Intronic
924581876 1:245330501-245330523 GAGTGGGGAAAGAGTGGGGGAGG + Intronic
924667033 1:246083520-246083542 GAGAAGGAAAAGTGGGCGCAGGG - Intronic
1062818212 10:516428-516450 GGGAGGGGAAAGGGGGGGAAGGG + Intronic
1062818223 10:516448-516470 GGGAGGGGAAAGGGGGGGAAGGG + Intronic
1062818234 10:516468-516490 GGGAGGGGAAAGGGGGGGAAGGG + Intronic
1062818255 10:516507-516529 GGGAGGGGAAAGGGGGGGAAGGG + Intronic
1062818266 10:516527-516549 GGGAGGGGAAAGGGGGGGAAGGG + Intronic
1062818287 10:516566-516588 GGGAGGGGAAAGGGGGGGAAGGG + Intronic
1062818298 10:516586-516608 GGGAGGGGAAAGGGGGGGAAGGG + Intronic
1062818309 10:516606-516628 GGGAGGGGAAAGGGGGGGAAGGG + Intronic
1062818320 10:516626-516648 GGGAGGGGAAAGGGGGGGAAGGG + Intronic
1062818341 10:516665-516687 GGGAGGGGAAAGGGGGGGAAGGG + Intronic
1062818352 10:516685-516707 GGGAGGGGAAAGGGGGGGAAGGG + Intronic
1062818363 10:516705-516727 GGGAGGGGAAAGGGGGGGAAGGG + Intronic
1063375352 10:5551296-5551318 GAGAGGTGAAGGAGGGCAGGAGG + Intergenic
1063378674 10:5570475-5570497 CAGATGGGGCAGAGGGCGGAGGG + Intergenic
1063570102 10:7207507-7207529 GAAAGGGGAAAGAGGGAGGGAGG + Intronic
1063917868 10:10902920-10902942 GGGAGGGAAAAGCGGGAGGAAGG + Intergenic
1063960357 10:11301387-11301409 GAGGGGGGGAAGCGGGGGGAGGG - Intronic
1064114816 10:12568449-12568471 GAGAGAGAAAAGAGGAAGGAAGG - Intronic
1064628528 10:17285732-17285754 GAGAAGGGAAAGGGGGAGGGAGG + Intergenic
1064989534 10:21243945-21243967 GGGAAGGGGAAGAGGACGGAAGG + Intergenic
1065169163 10:23010379-23010401 GGGAAGGGAAAGAGAGGGGAAGG - Intronic
1065220520 10:23491561-23491583 GAGAGGGAAGAGAGGGAGGGAGG - Intergenic
1065245116 10:23748547-23748569 GAGAGGGGAGAGGAGGGGGAGGG + Intronic
1065343260 10:24724781-24724803 GGGGCGGGGAAGAGGGCGGAGGG - Intergenic
1065688763 10:28311817-28311839 GACATGGGCAAGAGGGAGGACGG - Intronic
1065811504 10:29447723-29447745 GAGAGGGGAAGGAGGGAGAATGG - Intergenic
1066366109 10:34778263-34778285 GACAGGGGAAATAGGGAGGAAGG + Intronic
1066431126 10:35352804-35352826 GTGAGGGGAAAGAGTGGTGAAGG + Intronic
1067267420 10:44757579-44757601 GAGAGGGGGATGAGGGGAGATGG - Intergenic
1067359310 10:45563018-45563040 GGGAGGGGAAGGAGAGAGGAAGG - Intronic
1068526773 10:58139132-58139154 GAGAAAGGAGAGAGGGAGGAAGG + Intergenic
1068830719 10:61491580-61491602 GAGAGAGGGAAGAGGGAGGGAGG + Intergenic
1068850354 10:61731749-61731771 GAGGGAGGACAGAGGGAGGAAGG + Intronic
1069059177 10:63875932-63875954 GAGGGGGGAAGGTGGGAGGAGGG - Intergenic
1069060626 10:63891072-63891094 CAAAGGGGAAAGAAGGAGGAGGG - Intergenic
1069311544 10:67044087-67044109 TTGGGGGGAAAGAGGGAGGAGGG - Intronic
1069449256 10:68502829-68502851 GGGAGGGGAAAGGAGGGGGAGGG + Intronic
1069449278 10:68502872-68502894 GGGAGGGGAAAGGAGGGGGAGGG + Intronic
1069449309 10:68502935-68502957 GGGAGGGGAAAGGAGGGGGAGGG + Intronic
1069638583 10:69940702-69940724 GAGAGGAGAAGGGGGGCGGGAGG + Intronic
1069710955 10:70488481-70488503 GAGAGGGGAAGGAGGGGAAAGGG - Intronic
1069756569 10:70777378-70777400 GAGGGGAGGAAGAGGGCTGAGGG + Intronic
1069821156 10:71229556-71229578 GTGATGGGAAGGAGGGTGGATGG - Intronic
1069872134 10:71539701-71539723 GAGAGAGGAAAGAGAGAGAAGGG - Intronic
1069982306 10:72260967-72260989 GAGAGGGGGAACGGGGAGGAGGG - Intergenic
1070455997 10:76616215-76616237 GAGGGTGGAAGGTGGGCGGAGGG + Intergenic
1070610172 10:77927106-77927128 GGGAGGGGAGAGAGGAGGGACGG - Intergenic
1070637091 10:78137705-78137727 AAGAGGAGAAAGAGGAAGGAAGG - Intergenic
1071073973 10:81729588-81729610 GGGGGGGGAAAGAGAGAGGAAGG + Intergenic
1071160476 10:82740139-82740161 AGGAAGGGAAAGAGGGAGGAAGG - Intronic
1071160481 10:82740155-82740177 GGAAAGGGAAAGAGGGAGGAAGG - Intronic
1071182512 10:83003461-83003483 GAGATGGGAAAGAAGGCCAATGG + Intergenic
1071208901 10:83315532-83315554 GAGAGTGGAAGGGGGGCTGAGGG - Intergenic
1071820717 10:89277868-89277890 GAGAAAGGAAAGAGTGGGGAGGG - Intronic
1071863812 10:89703454-89703476 TAGAGGGGAAAGAGGGCAAGGGG + Intronic
1071998951 10:91175521-91175543 GGTAGGGGGAAGAGGGAGGAAGG - Intronic
1072581332 10:96742350-96742372 GAGAGAGGAAAGGGAGGGGAGGG + Intergenic
1073037492 10:100574584-100574606 GAGAGAGGGGAGAGGGAGGAAGG - Intergenic
1073048863 10:100655289-100655311 GAGAGGGGAGAGAGGGGGAGGGG - Intergenic
1073136700 10:101224375-101224397 GAGAGGGGGAAGGGAGGGGAGGG + Intergenic
1073156815 10:101354062-101354084 GAGAGGTAAGAGAGGGCGGGGGG + Exonic
1073374414 10:103020713-103020735 GAGAGGGGAAAGGGAGTTGAGGG + Intronic
1073441287 10:103554178-103554200 CAGAGGGGGAAGAGGGAGGCTGG - Intronic
1073955807 10:108870030-108870052 GGGCGGGGAAAGAGGGAGGTGGG + Intergenic
1074110022 10:110416441-110416463 GGGAGGCCAAAGAGGGAGGATGG + Intergenic
1074123722 10:110512038-110512060 AAGAGTGGAAAGAGGGCGTCAGG - Intergenic
1074165763 10:110872349-110872371 CAGAGGGGGAGGAGGGCTGAGGG - Intronic
1074729698 10:116356373-116356395 AAGAGGGGAGGGAGGGAGGAAGG + Intronic
1074919476 10:117992981-117993003 GTGAGGGGAAGGAGCGGGGAGGG + Intergenic
1075017109 10:118917951-118917973 GAGAGGGGACAGAGGGAACAGGG + Intergenic
1075101567 10:119509948-119509970 GAGAGGGGGAAGGGGGGAGAGGG + Intronic
1075121248 10:119666489-119666511 GACAGGAGAGAGAGGGAGGAAGG - Intronic
1075329909 10:121566545-121566567 GACAGGGAAGAGAGGGAGGAAGG - Intronic
1075559523 10:123458459-123458481 AAGAAGGGAAAGAGGGAGGAAGG - Intergenic
1075575219 10:123572809-123572831 GAGAGGGGAGAGAAGGGGAAGGG + Intergenic
1075656242 10:124163005-124163027 GAAGGGGGAAGGAGGGAGGAAGG + Intergenic
1076328509 10:129646919-129646941 CAGAGGGGAAAGAGGACGGAGGG - Intronic
1076746266 10:132516238-132516260 GACAGAGGACAGAGGGTGGAAGG - Intergenic
1077163246 11:1123089-1123111 GAGAGAGGGAAGAGGGAGGAAGG - Intergenic
1077177734 11:1198215-1198237 GTGAGGGGAGAGTGGGCGGCGGG + Intronic
1077287740 11:1775306-1775328 GAGAGGGGATGGAGGGGGGATGG + Intergenic
1077287754 11:1775351-1775373 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287758 11:1775362-1775384 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287768 11:1775395-1775417 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287793 11:1775473-1775495 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287797 11:1775484-1775506 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287801 11:1775495-1775517 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287811 11:1775528-1775550 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287825 11:1775573-1775595 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287829 11:1775584-1775606 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287839 11:1775617-1775639 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287881 11:1775740-1775762 GAGAGGGGATGGAGGGGGGATGG + Intergenic
1077287889 11:1775762-1775784 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287893 11:1775773-1775795 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287897 11:1775784-1775806 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287910 11:1775818-1775840 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287914 11:1775829-1775851 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287926 11:1775863-1775885 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287936 11:1775896-1775918 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287940 11:1775907-1775929 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287959 11:1775963-1775985 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287963 11:1775974-1775996 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287967 11:1775985-1776007 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287977 11:1776018-1776040 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287992 11:1776063-1776085 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077287996 11:1776074-1776096 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077288000 11:1776085-1776107 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077288010 11:1776118-1776140 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077288036 11:1776197-1776219 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077288051 11:1776242-1776264 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077288066 11:1776287-1776309 GAGAGGGGATGGAGAGGGGATGG + Intergenic
1077317439 11:1925691-1925713 GTGAGGGGAGAGAAGGCGGCTGG + Intronic
1077332226 11:1988746-1988768 GAGAGGGGAAAGGCGGGGGCGGG - Intergenic
1077359043 11:2132468-2132490 GAGAAGAGAAAGAGGGGGGTGGG + Intronic
1077479334 11:2806295-2806317 GAGAGGGGAGGGAGAGAGGAAGG + Intronic
1077565054 11:3292364-3292386 GAGAGGCCAAAGTGGGCAGATGG + Intergenic
1077570938 11:3338181-3338203 GAGAGGCCAAAGTGGGCAGATGG + Intergenic
1077615191 11:3669156-3669178 GAGAGGGGTAAGAGAGAGGAGGG + Intronic
1077615645 11:3671690-3671712 GAGAGTGGAAAGAGGCAGGCAGG - Intronic
1077664821 11:4098369-4098391 GGGAGGGGAGGGAGGGAGGAGGG - Intronic
1077716729 11:4588608-4588630 GAGAAGGGAAAGAGGATGTAGGG - Intergenic
1077857080 11:6138483-6138505 GAGAGAGGAAAGGGGGCAAAGGG + Intergenic
1077893884 11:6439633-6439655 GAGAGAGAAAAGAGGCAGGAGGG + Intronic
1077958640 11:7049002-7049024 GTGAGGGGAGTGAGGGTGGAGGG + Intronic
1078195595 11:9134349-9134371 GGGAGAGGACAGAGGGAGGAAGG - Intronic
1078198515 11:9157474-9157496 GAGAGTGGAGAGTGGGAGGAGGG - Intronic
1078390605 11:10932278-10932300 GAGAGGAGGAAGAGAGCAGAGGG + Intergenic
1078453176 11:11455358-11455380 GTGAGGGGAAATGGGGCAGAGGG + Intronic
1078453188 11:11455410-11455432 GTGAGGGGAAATGGGGCAGAGGG + Intronic
1078569568 11:12445519-12445541 GAGAGGGGAACAAGGTGGGAAGG + Intronic
1078723654 11:13907813-13907835 GAGAAGGGGAAGTGGGCGCATGG - Intergenic
1079272592 11:19002778-19002800 GAGTGGGGAGAGTGGGAGGAGGG - Intergenic
1079372177 11:19861014-19861036 GACGGTGGAAAGAGGGCAGAGGG + Intronic
1079506253 11:21155670-21155692 GAGAGGGGACAGAAGTCAGAGGG + Intronic
1079608957 11:22406596-22406618 TAGAAGAGAAAGAGGGAGGAGGG - Intergenic
1079642004 11:22817129-22817151 GAGTGGGGAGAGAGGGAGGAGGG - Intronic
1079934471 11:26600320-26600342 GAGAGGGGAGAGAAGACGGGAGG - Intronic
1079995769 11:27293600-27293622 GAGAGGGGAGAGGAGGCAGAGGG + Intergenic
1080032862 11:27680277-27680299 GAGAATGAAAAGAGGGAGGAAGG + Intronic
1080268103 11:30422644-30422666 GAGGGGGGAAAGGAGGAGGAGGG + Intronic
1080571162 11:33558425-33558447 GATATGGGAGAGAGGGAGGAGGG - Intronic
1080858759 11:36135011-36135033 GAGAGGGGAAACAGGGAAAATGG - Intronic
1081574419 11:44310283-44310305 GAGAGAGGAAGGGGGGGGGAGGG - Intergenic
1081915997 11:46730536-46730558 GTGAGGGGAGAGAGGGGGGCAGG + Intronic
1082208507 11:49468442-49468464 GAGAGGGGAAAGAGGAGAGGGGG + Intergenic
1082221817 11:49647737-49647759 GAGAGTGGAGAGTGGGAGGAGGG + Intergenic
1082845342 11:57720635-57720657 GGGAGGCCAAAGCGGGCGGATGG - Intronic
1083052106 11:59786631-59786653 GAGAGGGGAAAAAGGAAGGAAGG - Intronic
1083305187 11:61758317-61758339 GAGAGGGGAGTGAGGGAGGCCGG - Intronic
1083641473 11:64148091-64148113 GGGAGGGGAAAGAGTGAGGGGGG + Intronic
1083836329 11:65270950-65270972 GAGCAGGGAAAGAGGACAGAAGG - Intronic
1083902034 11:65647852-65647874 GAGAGAGGAGAGAGAGAGGAAGG - Intronic
1083935954 11:65870249-65870271 GGCAGGAGAAGGAGGGCGGAGGG + Intronic
1084104887 11:66975003-66975025 GGGAGGGGAAGGAAGGGGGAGGG + Intergenic
1084165433 11:67373026-67373048 GGGAGGGGTAGGAGGGCGGGCGG - Intronic
1084440198 11:69168289-69168311 GAGAGGGTAGAGAGGGAGAAGGG + Intergenic
1084582543 11:70032894-70032916 GAGAAGGGAGAAAGGGAGGAAGG + Intergenic
1084607698 11:70182088-70182110 GAGAAGGGAATGAGGCAGGAAGG - Intronic
1084928680 11:72535938-72535960 GGGAAGGGAAGGAGGGTGGAAGG + Intergenic
1084949591 11:72657331-72657353 AGGAGGGGAAAGAGGAGGGATGG + Intronic
1085378943 11:76094989-76095011 GAGTTGGGAAAGAGGACTGAAGG + Intronic
1085563006 11:77489381-77489403 GAGAGAGGAGAGAGGAGGGAGGG - Intergenic
1086085342 11:82947448-82947470 GAGAGGGGAAAGGGGGAAGGAGG + Intronic
1086477833 11:87198538-87198560 GAGAGGGGAGGGAGGAGGGAAGG - Intronic
1086518747 11:87646060-87646082 GGGAGGGGAAGGAAGGGGGAAGG - Intergenic
1086627213 11:88971423-88971445 GAGAGTGGAGAGTGGGAGGAGGG - Intronic
1087353700 11:97066506-97066528 GAGTGGGGAGAGAGGGAGGATGG + Intergenic
1087471459 11:98580844-98580866 GGGAGGGGAAAGAGGGAGGGAGG + Intergenic
1087936140 11:104036689-104036711 GAGAGGTGAATGAGCCCGGACGG + Exonic
1088275599 11:108082203-108082225 AAGAAAGGAAAGAGGGAGGAAGG - Intronic
1088327657 11:108617283-108617305 GAGAGGATAAGGAGGGAGGATGG + Intergenic
1088356027 11:108944660-108944682 GTGGGGGGAAGGAGGGAGGATGG + Intergenic
1088616561 11:111635469-111635491 AAGGAGGGAGAGAGGGCGGAGGG + Intronic
1088692159 11:112337406-112337428 AAGAGGGAAAGGAGGGAGGAAGG - Intergenic
1088847159 11:113678228-113678250 GGGAGGAGAAAGAGGGAAGAGGG + Intergenic
1089184778 11:116607378-116607400 GAGAAGGAAAAGGGGGAGGAAGG - Intergenic
1089215010 11:116829954-116829976 GGGAGGGGAAAGAGGAGGGGAGG + Intronic
1089295919 11:117468064-117468086 GAGAGAGGAAGGAGGCAGGAAGG - Intronic
1089303299 11:117511652-117511674 CAGAGAGGAGAGAGGGTGGAGGG - Intronic
1089635299 11:119808023-119808045 GACAAGGGAAGGAGGGTGGAAGG - Intergenic
1090190018 11:124761395-124761417 AAGAGGGGAAATTGGGAGGAGGG - Intronic
1090412357 11:126518083-126518105 GAGGAGGGAAAGACGGGGGAAGG - Intronic
1090718296 11:129449941-129449963 GCCAGGAGAAGGAGGGCGGATGG + Intronic
1090756169 11:129793873-129793895 GAGAGGGGAAAGGGAGAAGATGG + Intergenic
1090982130 11:131732407-131732429 GAGAAGGGGTAGAGGGTGGAAGG - Intronic
1091206085 11:133822155-133822177 GGGAGGAGAAAGAGAGCTGAGGG - Intergenic
1091231116 11:133988618-133988640 CAGAGGGAAAAGAGGGCGAGTGG - Intergenic
1202815208 11_KI270721v1_random:43922-43944 GAGAGGGGAAAGGCGGGGGCGGG - Intergenic
1091394675 12:146685-146707 GAGAGAGGAGAGTGGGAGGAAGG + Intronic
1091749598 12:3014191-3014213 AAGAGGGGAAACAGGGAGCAGGG - Intronic
1091750956 12:3020943-3020965 GAGGAGGGAAAGAGGGAAGAGGG - Intronic
1091760865 12:3086387-3086409 GAGAGAAAACAGAGGGCGGAAGG - Intronic
1091888233 12:4031858-4031880 GAGAGGGGAGAAAGGGAGGCCGG - Intergenic
1092961453 12:13600208-13600230 ATGAGGGGAAAGAGGAAGGAAGG - Intronic
1093118942 12:15244845-15244867 GGGAGAGGAAAGAGAGGGGAGGG + Intronic
1093118953 12:15244866-15244888 GGGAGGGGAAAGGGAGGGGAGGG + Intronic
1093442421 12:19214384-19214406 GAGGAGGGAAAGAGGTGGGAGGG + Intronic
1093955638 12:25214863-25214885 CAGGGGGAAAAGAGGGCGGTAGG + Intronic
1094025919 12:25959229-25959251 GAGAGGGGCAACCGGGCGGAGGG - Intronic
1094155809 12:27335773-27335795 GAGAGGGGAAAGGAGGAGGAAGG + Intronic
1094165111 12:27435550-27435572 GAGAGGAGAGAGATGGGGGATGG - Intergenic
1094515171 12:31121525-31121547 GAGAGGGAAAAGATGGCAGCTGG + Intergenic
1094563653 12:31579744-31579766 GGGAAGGGAGAGAGGGAGGAAGG + Intronic
1094623996 12:32106306-32106328 GAGAGGGGGACGACGGAGGAGGG + Intergenic
1095269250 12:40197136-40197158 GTGTTGGGAAAGAGGGCAGAGGG - Intronic
1096204215 12:49707474-49707496 GGGAAGGGAAAGAGCGCGGGGGG - Intronic
1096357412 12:50952866-50952888 TTGAGGGGAAAGAGGGCACAGGG - Intergenic
1096439644 12:51629763-51629785 GAGAGGGCTAAGAGGTGGGAAGG + Intronic
1096462939 12:51832627-51832649 GAGAGGGAAAAGAAGGCTGCAGG - Intergenic
1096762400 12:53852994-53853016 GAAAGGGGAAAGAGGTGGTAGGG - Intergenic
1096764135 12:53869160-53869182 GAGAGGGGAAGGAGGGAGAGGGG - Intergenic
1096779335 12:53983148-53983170 GAGACGTGAAAGAGGGGGGAGGG + Intergenic
1096950014 12:55458646-55458668 GAGAGGGGAGGGTGGGTGGAGGG + Intergenic
1097013482 12:55969338-55969360 GGGAGGGGAAAGATGATGGAGGG + Intronic
1097263097 12:57730717-57730739 AAGAGGGGTAAGAGGGAAGAGGG - Intronic
1097386986 12:58962014-58962036 GAGTGGGGAGAGAGGGCAGCAGG - Intergenic
1097520352 12:60661304-60661326 GAGAGGGGAGGGAAGGAGGAGGG - Intergenic
1097638337 12:62148542-62148564 AAGAGGGGAAGGAGGAAGGAGGG + Intronic
1098073711 12:66703438-66703460 GAGAGGGCAAAGGGAGAGGAGGG + Intronic
1098165530 12:67693882-67693904 GAGAGAGCGGAGAGGGCGGAGGG - Intergenic
1098243199 12:68488738-68488760 GAGAGGGGTAGGAGGGGGAAAGG + Intergenic
1098249759 12:68557214-68557236 GAGAGAGGAAAGAAGTGGGAGGG - Intergenic
1098280083 12:68853815-68853837 GAGAGGGAAAGGAGGGAGGAAGG + Exonic
1098327138 12:69314991-69315013 GAGGGTGGAAAGTGGGAGGAGGG - Intergenic
1098460788 12:70730981-70731003 GAGAGAGGAAGGAAGGAGGAAGG + Intronic
1098460804 12:70731076-70731098 GAGAGAGGAAGGAAGGAGGAAGG + Intronic
1098460809 12:70731100-70731122 GAGAGAGGAAGGAAGGAGGAAGG + Intronic
1098460814 12:70731126-70731148 GAGAGAGGAAGGAAGGAGGAAGG + Intronic
1098512163 12:71329342-71329364 GAGAGGGGAGAAAGGGAGGTAGG + Intronic
1098562432 12:71889782-71889804 GAGGGTGGAAAGTGGGAGGAGGG - Intronic
1098802426 12:74978421-74978443 GGGAAGGGAAGGAGGGAGGAAGG + Intergenic
1099121884 12:78700661-78700683 GAGAGGGGAAAGGAGGGGAAGGG + Intergenic
1099147432 12:79064240-79064262 GAGAAAGGAAAGAGGGAGTAAGG + Intronic
1099904596 12:88757213-88757235 AAGAAGGGAGAGAGGGAGGAGGG - Intergenic
1100009102 12:89932401-89932423 GAGAGGTGAAAAGGGGCAGAAGG + Intergenic
1100209030 12:92381941-92381963 GAGGGGGGATGGAGGGAGGAAGG + Intergenic
1100877192 12:98975004-98975026 GGGAGGGGAGGGAGGGAGGAAGG - Intronic
1101209719 12:102523841-102523863 GAGAGGGGGAAGGAGGGGGAGGG + Intergenic
1101234676 12:102776462-102776484 TGGAGGGGAAAAAGGGAGGAAGG - Intergenic
1101293801 12:103400118-103400140 GAGAGAAGAAAGAGAGAGGAAGG + Intronic
1101489839 12:105200453-105200475 CACAGGGGTAAGTGGGCGGATGG + Intronic
1101584433 12:106072665-106072687 GGGAGGGAGAAGAGGGAGGAAGG - Intronic
1101861883 12:108489149-108489171 GAGAAGGGAAAGAGGGAAGGAGG + Intergenic
1102091711 12:110195535-110195557 GAAAGGGAAAAGAAGGTGGAAGG - Intronic
1102176939 12:110882965-110882987 GGGAGGGCAAAGTGGGAGGATGG - Intronic
1102194721 12:111016889-111016911 GAGAGAGGGAGGAGGGAGGAAGG - Intergenic
1102393944 12:112572590-112572612 GAGAGAGGAGAGAGAGAGGAAGG - Intronic
1102451512 12:113045113-113045135 GAAAGGGGAAAGAGGAAGAAAGG + Intergenic
1102513235 12:113429437-113429459 GAGGGGGGAATGAGGTGGGATGG + Intronic
1102556048 12:113727291-113727313 GAGAGAGGAAAGAGGAAGGAAGG - Intergenic
1102598670 12:114012669-114012691 GAGAGGGGAAGGAGAGGGGGAGG + Intergenic
1102598767 12:114012976-114012998 GAGGAGGGAGAGAGGGAGGAGGG + Intergenic
1102637558 12:114337344-114337366 GAGAGGGGAGGGAGGGAGGGAGG - Intergenic
1102749162 12:115277207-115277229 GAGAGGGGAAAGGGGAGGGGGGG + Intergenic
1102764761 12:115423062-115423084 GAGGGAGGAAAGAGGGAGAAAGG + Intergenic
1102796741 12:115695495-115695517 GAGGGTGGAAAGTGGGAGGAGGG - Intergenic
1102797135 12:115698306-115698328 GGGAGGGGAAAGGGAGGGGAGGG + Intergenic
1103023465 12:117555096-117555118 GTGAGGGGTAGGAGGGAGGAAGG - Intronic
1103111011 12:118278285-118278307 GAGGGTGGAAAGAAGGAGGAGGG - Intronic
1103206823 12:119136252-119136274 GATAGGGAAAATAGGGCTGAGGG + Intronic
1103295615 12:119884023-119884045 GAGAGAGGAAAGAGGAAGGAAGG + Intergenic
1103366802 12:120389672-120389694 GAGAGAGGAAGGAGGGAGGGAGG + Intergenic
1103366816 12:120389716-120389738 GAGAGAGGAAGGAGGGAGGGAGG + Intergenic
1103385453 12:120528915-120528937 GAAAGGGGCGAGAGGGCGGATGG - Intronic
1103397466 12:120619125-120619147 GAGGGGGAAGAGAGGGCTGAAGG - Intergenic
1103425518 12:120830405-120830427 GGGAGGGGGAAGAAGGGGGAGGG + Intronic
1103425533 12:120830433-120830455 GGGAGGGGGAAGAAGGGGGAGGG + Intronic
1103444351 12:120984480-120984502 GAGAAGGGAAGGAGGGAGGAAGG + Intronic
1103478028 12:121232814-121232836 GAGAAGGGAAGGTGGGAGGAGGG - Intronic
1103522846 12:121547931-121547953 GAAAGGGGAAAGAGGCCGGGCGG - Intronic
1103729545 12:123018043-123018065 GAGAGAGAAAAGAGGGAGGGAGG - Intronic
1104191095 12:126482487-126482509 GAGAGGGGAAGGAGGGAGGGAGG - Intergenic
1104191105 12:126482510-126482532 GAGGGGGGAAGGAGGGAGGGAGG - Intergenic
1104254331 12:127124607-127124629 GGGAGGGGATAGAGGGTGGGGGG + Intergenic
1104301726 12:127570603-127570625 AAGAGAGGAAAGAAGGAGGAAGG + Intergenic
1104415342 12:128593136-128593158 GAGAGAGGAGAGAGGGAAGAAGG - Intronic
1104415361 12:128593312-128593334 GAGAGAGGAGAGAGGGAAGAGGG - Intronic
1104463377 12:128971863-128971885 GAGAGAGGAGGGAGGGAGGAGGG - Intronic
1104582960 12:130024151-130024173 GAGAGGTGGAAGAGAGAGGAGGG + Intergenic
1104621237 12:130314316-130314338 GAAAGAAGAAAGAGGGAGGAAGG + Intergenic
1104745909 12:131210425-131210447 CAGAGGGGAATGTGGGCAGAGGG + Intergenic
1104849450 12:131864353-131864375 GAGAGGTGGAAGCGGGAGGATGG + Intergenic
1104939299 12:132387399-132387421 GAGTGGGGCGAGTGGGCGGAAGG + Intergenic
1105281413 13:18964867-18964889 TAGAGGAGAAAGTGGGGGGAGGG - Intergenic
1105629534 13:22148623-22148645 GAGAGGGGAAGGGGAGGGGATGG - Intergenic
1106037483 13:26057301-26057323 GAGAGGAGAAAGGGGAGGGAGGG - Intergenic
1106512291 13:30422029-30422051 GAGAGGGGAAAGCGGGGAAAGGG + Intergenic
1106679139 13:31992427-31992449 GGGAGGCTAAAGAGGGAGGATGG - Intergenic
1106811394 13:33361699-33361721 GAGAGGAGAAAGAGAGTGAAAGG + Intergenic
1106881441 13:34136115-34136137 GAGAGGGAAAAGAGGGCATGTGG - Intergenic
1107119746 13:36783171-36783193 GAGAAGGGAGAGAGGGAGGGAGG + Intergenic
1107145853 13:37059705-37059727 GGGCGGGGAAGGCGGGCGGAAGG + Intronic
1107169326 13:37321239-37321261 GAGAGTGGAGAGAGGGAGAAGGG + Intergenic
1107763663 13:43710145-43710167 GAGAGGAAAAAGAGGGCAGGAGG + Intronic
1107767849 13:43756501-43756523 GAGAGGGAAAGGAGAGGGGAGGG + Intronic
1107788483 13:43977786-43977808 GAGAGGGGAGAGAGGGAGGAAGG - Intergenic
1107946303 13:45420012-45420034 GAAAGGAGAAAGAGGGAGGAAGG + Intergenic
1108115572 13:47123926-47123948 GACAGAGGAAAGAGGGAGTAGGG + Intergenic
1108436469 13:50406010-50406032 GAGGGGGGGAAGAGGGAGGGAGG - Intronic
1108436575 13:50406776-50406798 GAGGGGGGAAAGAAGGAGGGAGG - Intronic
1108629292 13:52265535-52265557 GGGAGGGGAAAGAGGCCTGTCGG + Intergenic
1108640710 13:52380233-52380255 CAAAGGGGAAAGAGAGGGGAGGG - Intronic
1108656762 13:52540944-52540966 GGGAGGGGAAAGAGGCCTGTCGG - Intergenic
1108748954 13:53426602-53426624 TAGAGGGGAAAGAGAGAGGAGGG - Intergenic
1108802599 13:54117558-54117580 GAGATGGGAAAGAAGGATGAAGG - Intergenic
1109147706 13:58801852-58801874 GAAAGGGGAACGAGGGAGGTAGG + Intergenic
1109162941 13:58998973-58998995 GTGAAGGGAAAGAGGAGGGAGGG + Intergenic
1109909715 13:68893304-68893326 GAGAGGGTAAAGAGGGAGAAAGG - Intergenic
1110704874 13:78594050-78594072 GAGAAGGGAAAGATGGAGGTAGG + Intergenic
1110735265 13:78928766-78928788 GACAGGGGACAGAGGGCAGGGGG - Intergenic
1111093443 13:83477404-83477426 GAGAAGGGAGAGAGGGAGGCAGG + Intergenic
1111883678 13:93990896-93990918 GAGAGGGGAGAGAGAGAGAAAGG + Intronic
1112391592 13:98989846-98989868 GAGTGGGGGAAGAGGGGGAATGG - Intronic
1112498307 13:99922917-99922939 GAGGGTGGAAAGTGGGCAGATGG + Intergenic
1112532217 13:100216083-100216105 GAAAGGGGAAGGAGAGGGGAAGG - Intronic
1112813124 13:103242224-103242246 GAGTGGAGAAAGTGGGAGGAGGG - Intergenic
1113149987 13:107252481-107252503 GAGAGGAGAAGGAAGGAGGAGGG + Intronic
1113397109 13:109958133-109958155 GAGGGTGGAGAGAGGGAGGAAGG - Intergenic
1113673956 13:112195734-112195756 AGGAGGGGAGAGAGGGAGGAAGG - Intergenic
1113831135 13:113296905-113296927 GCGAGGGGAGAAAGGGCAGACGG - Intergenic
1113935177 13:113990113-113990135 GGGAGGGCAAAGAGGAAGGAAGG - Intronic
1113954369 13:114089298-114089320 GAGGGGGGGAGGAGGGGGGAGGG + Intronic
1113975642 13:114225556-114225578 GGGAGGGGAGGGAGGGGGGATGG + Intergenic
1114266947 14:21078282-21078304 GAGATGGGACAGTGGGGGGATGG + Intronic
1114483007 14:23047119-23047141 GGAAGGGGAAAGAGGGAGGAAGG - Exonic
1114639978 14:24213184-24213206 GAGTGGGGGAGGACGGCGGACGG + Intronic
1114655738 14:24314684-24314706 GAGAGAGGAAAGAGGGGTGTGGG - Exonic
1115360748 14:32498748-32498770 CAGAGGGGTAAGTGGGCGGGAGG + Intronic
1115399597 14:32941251-32941273 GGGAGGGGAAGGAGGGAGGAGGG - Intronic
1115496862 14:34013505-34013527 GTGTGGGGAAAGAGGACGGGTGG - Intronic
1115505562 14:34090649-34090671 CAGAGGGGAAACAGGGTGGCTGG - Intronic
1115901575 14:38156845-38156867 GAGAGAGGAGGGAGGGAGGAAGG + Intergenic
1116252937 14:42509987-42510009 GAGGGTGGAAGGAGGGAGGAGGG + Intergenic
1116297104 14:43126100-43126122 GAGGGTGGAAGGAGGACGGAGGG + Intergenic
1116319971 14:43448990-43449012 GAGAAGGAAAAGAGAGAGGATGG + Intergenic
1116558690 14:46347590-46347612 GAGGGTGGAGAGAGGGAGGAGGG + Intergenic
1116746776 14:48830155-48830177 GAGAGGGGGGAGAGGGGAGAGGG + Intergenic
1116757526 14:48966273-48966295 GAGAGGGGAAGGAAGGAAGAAGG - Intergenic
1116780568 14:49232981-49233003 GAAGGGGGAAAGAGGGAGGGGGG - Intergenic
1117162398 14:53002227-53002249 GAGATGAGAAGGAGGGAGGAGGG - Intergenic
1117214965 14:53541553-53541575 GAGAAGAGAAAGAGGGAAGAGGG + Intergenic
1117232711 14:53737546-53737568 GAGAGAGGAGAAAGGGAGGAAGG + Intergenic
1117378473 14:55137105-55137127 TAGTGGGGACAGAGGGCAGATGG + Intronic
1117401108 14:55358966-55358988 GGGATGGGAAGGAGGGAGGAAGG + Intronic
1117553733 14:56862883-56862905 GAGAGGGGAAATAGGACGGGAGG + Intergenic
1117646987 14:57863690-57863712 GAGAGGAGAAAGCTGGAGGAGGG - Intronic
1117819236 14:59630858-59630880 AGGAGGGGAAAAAGGGCTGACGG + Intronic
1117836981 14:59818018-59818040 GAGTGGGGAATGTGGGAGGAGGG - Intronic
1117989132 14:61416640-61416662 GGGAGAGGAAAGAGAGAGGAGGG - Intronic
1118059776 14:62122740-62122762 GAGAGAAGAAAGATGGCTGATGG + Intergenic
1118145849 14:63135749-63135771 GAGAAGGAAAGGAGGGGGGAAGG + Intergenic
1118171889 14:63396026-63396048 GGGAGGGGGAAGATGGGGGAGGG + Intronic
1118321828 14:64757892-64757914 GAGAGCAGGAAGAGGGCTGAGGG - Intronic
1118538891 14:66801619-66801641 GAGAGGGGGGAGAGAGCGGGGGG - Intronic
1118590320 14:67396039-67396061 GACACAGGAAAGAGGACGGAAGG - Intronic
1118639803 14:67781778-67781800 GAGAGGGAAAAGAGAAAGGAAGG + Intronic
1118725432 14:68625575-68625597 GGGAGGCCAAAGAGGGAGGATGG - Intronic
1118785749 14:69044146-69044168 AGGAGGGGAAAGAGGGCGTTTGG + Intergenic
1119048394 14:71341646-71341668 GAGAGGGGAGAGAGAGAGGGAGG - Intronic
1119551342 14:75516165-75516187 AGGAGGGGAAGGAGGGAGGAAGG - Intergenic
1119829381 14:77687549-77687571 GTGAGGGGAGAGAGTGAGGAAGG - Intronic
1119939684 14:78627086-78627108 GAGAAGGGAGGGAGGGAGGAAGG - Intronic
1120161590 14:81151405-81151427 GCTAGGGGGAAAAGGGCGGAGGG - Intergenic
1120602108 14:86523633-86523655 AAGTGAGGAAAGAGGGAGGAGGG - Intergenic
1120716200 14:87843510-87843532 GAGGGGAGAAGGAGGGAGGAAGG - Intronic
1120737570 14:88070407-88070429 GAGAGGGGAGACAGGGAGGGAGG + Intergenic
1121230681 14:92355322-92355344 GAGATTGGGAAGAGGGCAGATGG + Intronic
1121469226 14:94138994-94139016 GAGAGGGGGCAGAGGGCAAAGGG - Intergenic
1121592314 14:95125561-95125583 GAGAGGGGAAAGGTGGGGGAAGG + Intronic
1121623004 14:95363164-95363186 GAGGAGGGAAGGAGGGAGGAAGG - Intergenic
1121624611 14:95374969-95374991 AAGAGGGGAAGGAGGGAGGGAGG - Intergenic
1121624618 14:95374985-95375007 GAGAGAGGAAAGAAGGAAGAGGG - Intergenic
1121624642 14:95375072-95375094 AAGAGGGGAAGGAGGGAGGGAGG - Intergenic
1121624649 14:95375088-95375110 GAGAGAGGAAAGAAGGAAGAGGG - Intergenic
1121624671 14:95375186-95375208 AAGAGGGGAAGGAGGGAGGGAGG - Intergenic
1121624678 14:95375202-95375224 GAGAGAGGAAAGAAGGAAGAGGG - Intergenic
1121624709 14:95375311-95375333 AAGAGGGGAAGGAGGGAGGGAGG - Intergenic
1121624716 14:95375327-95375349 GAGAGAGGAAAGAAGGAAGAGGG - Intergenic
1121888061 14:97562642-97562664 GAAGGAGGAAAGAGGGAGGAAGG + Intergenic
1121952168 14:98181022-98181044 GAGAGAGGAAAGAAGGAAGAAGG - Intergenic
1122047486 14:99034417-99034439 GAAAGGGGAAAGAAAGGGGAGGG + Intergenic
1122253936 14:100463077-100463099 GAGAAGGGAAAAAGGAAGGAAGG - Intronic
1122316464 14:100828423-100828445 GGAAGAGGAAAGAGGGAGGAGGG - Intergenic
1122449919 14:101797473-101797495 GGGTGGAGAAAGAGGGCAGAGGG - Intronic
1122546533 14:102525909-102525931 GTCAGGGGAAAGAAGGAGGAAGG - Intergenic
1122642120 14:103166099-103166121 GAGATGGCAAAGAGGAGGGATGG - Intergenic
1123173635 14:106397959-106397981 GTGAGCGAAAAGAGGGAGGACGG - Intergenic
1123181891 14:106479231-106479253 GTGAGAGAAAAGAGGGAGGAAGG - Intergenic
1202847952 14_GL000009v2_random:199399-199421 GAGAGGGGAACGTGGGGAGAGGG - Intergenic
1202945014 14_KI270726v1_random:17498-17520 GTGAGAGAAAAGAGGGAGGAAGG + Intergenic
1123587521 15:21772872-21772894 AAGAGGGGAAAGGGGACAGAGGG + Intergenic
1123624159 15:22215437-22215459 AAGAGGGGAAAGGGGACAGAGGG + Intergenic
1123979260 15:25584590-25584612 GAGAGTGGAGGGAGGGAGGAGGG - Intergenic
1124012793 15:25852206-25852228 GAGGGAGGATAGAGGGAGGATGG - Intronic
1124377875 15:29140098-29140120 GAGAGTGGAATAAGTGCGGAGGG - Intronic
1124415919 15:29473226-29473248 GAGAGGGGAAAGGAGGGGGTGGG - Intronic
1124470370 15:29978900-29978922 GAGAGAGGAAAGGGGGAGGGGGG + Intergenic
1124710781 15:32008332-32008354 GAGAAGGGAGGGAGGGAGGAAGG - Intergenic
1124953653 15:34345818-34345840 GAGAGGGAAAAGTGGGGTGAGGG - Intronic
1124962441 15:34409055-34409077 GAGGGGGGAGAGAGGTGGGAGGG - Intronic
1124962449 15:34409073-34409095 GAGGGGGGAGAGAGGTGGGAGGG - Intronic
1124971833 15:34496079-34496101 GAGTAGGGAACCAGGGCGGAGGG - Intergenic
1124979065 15:34555277-34555299 GAGGGGGGAGAGAGGTGGGAGGG - Intronic
1124979073 15:34555295-34555317 GAGGGGGGAGAGAGGTGGGAGGG - Intronic
1125200851 15:37099768-37099790 GAGAAGAGAAAGAGGGGGAAAGG - Exonic
1125210728 15:37212316-37212338 GAGGGTGGAAAGTGGGAGGAGGG - Intergenic
1125585798 15:40818692-40818714 CACAGGGGTAAGAGGGAGGAGGG + Intronic
1125762740 15:42108390-42108412 GAGTGGGGAAAGAGGTCTGAAGG - Intergenic
1126370194 15:47937933-47937955 AAGGAGGGAAAGAGGGAGGAAGG + Intergenic
1126371952 15:47956641-47956663 GAGGGTGGAAAGTGGGAGGAAGG - Intergenic
1126592192 15:50351650-50351672 GAGAGAGGAAAGAGGGAGGGAGG + Intronic
1127330200 15:57931606-57931628 AAGAAGGGAAAGATGGAGGAAGG - Intergenic
1127375085 15:58376870-58376892 GAGAGGGGGATGAGAGGGGAAGG + Intronic
1127439085 15:58988069-58988091 GTGAGGGGAACGGGGGGGGAGGG + Intronic
1127537380 15:59902999-59903021 GAGGGCGGAAAGTGGGAGGAGGG - Intergenic
1127952502 15:63823145-63823167 GAGAGTGGAAAATGGGAGGAGGG - Intronic
1128608144 15:69053772-69053794 GAGAGGGGTAAGAGGAGAGAAGG - Intronic
1128651125 15:69414494-69414516 GAGCAGGGAGAGAGGGCGGACGG + Intronic
1128702922 15:69817132-69817154 GAGAGGGGAGGGAGGGAGGGGGG + Intergenic
1128768735 15:70266521-70266543 GAGACAGGGAGGAGGGCGGAAGG - Intergenic
1128826126 15:70719063-70719085 GAGGAAGGAAAGAGGGAGGAAGG + Intronic
1129151947 15:73694681-73694703 GGGAGGGGAAAGGGAGGGGAGGG + Intronic
1129177103 15:73848025-73848047 AAGAGGGGAAAGGGTGAGGATGG + Intergenic
1129521481 15:76189222-76189244 GAGAAAGGAGAGAGGGAGGAAGG + Intronic
1129665360 15:77576513-77576535 GAGAAAGGAAGGAGGGAGGATGG + Intergenic
1129933020 15:79428172-79428194 GGGAGGGGAGGGAGGGAGGAAGG - Intergenic
1129947437 15:79551565-79551587 GGGAGGGGAAAGAAGGAAGAAGG + Intergenic
1129949049 15:79570108-79570130 GAAAGGGAAAAGAGGAAGGAGGG + Intergenic
1129992039 15:79973865-79973887 GTGAGGGAAAAGAGGGAGGGAGG - Intergenic
1130017801 15:80201261-80201283 GAGGGGGGAAAGCGGGTTGAGGG - Intergenic
1130205071 15:81868284-81868306 GAGACAGGAAAGAGGAAGGAGGG - Intergenic
1130533552 15:84766539-84766561 GAGAGGGGAAGGAGAGAAGAGGG + Intronic
1130721006 15:86386056-86386078 GGGAGGGGAGAGAGGGAGGAGGG - Intronic
1130741180 15:86602038-86602060 GAGAAGGGAAAGAAGAAGGAAGG - Intronic
1130761530 15:86825654-86825676 GGGAAGGGAAAGAGGGAGGGAGG + Intronic
1130898358 15:88188222-88188244 GGGAGGAGAAAGAGGGCAAAGGG + Intronic
1131139841 15:89968151-89968173 GAGAAGGGAAAGGGGAAGGAAGG + Intergenic
1131169116 15:90164175-90164197 GAGAGGCCAAAGTGGGAGGATGG + Intronic
1131248016 15:90812735-90812757 GAGTGGGGAAAGAGAAAGGAAGG + Intronic
1131283251 15:91038010-91038032 TAGAGGGGAAGGAGGGAGGGAGG + Intergenic
1131333709 15:91526615-91526637 GAGAGGAGACAGAGGGCTGAGGG - Intergenic
1131366595 15:91846797-91846819 GAGAGGGGAAGCAGGTGGGAGGG + Intergenic
1132020413 15:98356541-98356563 GAGCGGGAAGAGAGGGAGGAAGG + Intergenic
1132061902 15:98699093-98699115 GAGAGGGAAAGGAAGGCAGAAGG + Intronic
1132144636 15:99421770-99421792 GAGAGTGGAGAGTGGGAGGAGGG - Intergenic
1132226997 15:100150571-100150593 GAGGAGGGACAGAGGGAGGAAGG - Intronic
1132513788 16:356753-356775 GAGCGGGGGAAGAGGACGGACGG + Intergenic
1132550957 16:553668-553690 GGGAGGGGAAGGAGGGGGGCGGG - Exonic
1132647356 16:1005120-1005142 GGGAGGGGACAGAGGGAGCAGGG + Intergenic
1132746213 16:1437358-1437380 GGGATGGGAATGAGTGCGGATGG + Intronic
1133069143 16:3234418-3234440 GAGAAAGGAAAGAAGGAGGAAGG + Intronic
1133392053 16:5418663-5418685 GAGGGAGGAAAGAAGGGGGAAGG - Intergenic
1133415845 16:5606437-5606459 GAGGGAGGAATGAGGGTGGAGGG - Intergenic
1133422117 16:5654775-5654797 GAGAGAGGAAAGAAGGAAGAAGG - Intergenic
1133526138 16:6607585-6607607 GAGAGGAGAGAGAGAGAGGAGGG - Intronic
1133570781 16:7038087-7038109 GAGGTGGGAAAGAGTGTGGAGGG - Intronic
1133756478 16:8766207-8766229 GAGCAAGGAAAGAGGGCAGAGGG + Exonic
1133883766 16:9807246-9807268 GGGAGGGGAGAGAGGGAGGGAGG + Intronic
1133883801 16:9807320-9807342 GTGGGGGGAGAGAGGGAGGAAGG + Intronic
1134258884 16:12634550-12634572 AAGATGGGAAAGAGGGAAGAGGG + Intergenic
1134315167 16:13112363-13112385 AAGAAGGGAAAGAGGGAGGCAGG + Intronic
1134523208 16:14927828-14927850 GAGAGGGGAGAGAAGGGGGAGGG - Intronic
1134523221 16:14927858-14927880 GGGAGGGGAGAGAAGGGGGAGGG - Intronic
1134692038 16:16197493-16197515 CAGAGGGAAGAGAGGGAGGACGG + Intronic
1134906572 16:17984669-17984691 GAGAGGGGAAAGAGGGAAGGGGG - Intergenic
1135122729 16:19780408-19780430 GAGAGGCCAAGGAGGGAGGATGG - Intronic
1135241915 16:20814844-20814866 TAGAGGGGAAATAGGGGAGAAGG - Intronic
1135250740 16:20899822-20899844 GGGAGGGAAATGAGGGCGGAGGG + Intronic
1135282591 16:21165557-21165579 GAGAGGGAAGAGAAGGGGGAGGG - Intronic
1135302874 16:21345845-21345867 GGGAGGGGCAAGAGAGGGGAGGG - Intergenic
1135521430 16:23181690-23181712 GAAAGAAGAAAGAGGGAGGAAGG + Intergenic
1135524179 16:23201261-23201283 AAAAGGGGGAAGAGGGCGAAAGG - Intronic
1135529079 16:23237231-23237253 GGGAAGGGAAGGAGGGAGGAAGG - Intergenic
1135531642 16:23259724-23259746 GAGAAGGGAAAGAGGGAAAAGGG + Intergenic
1135694746 16:24575885-24575907 GAGAGGGAGGAGAGGGAGGAGGG + Intergenic
1135892642 16:26371450-26371472 GGGAAGGGAAGGAGGGAGGAAGG + Intergenic
1135936275 16:26782946-26782968 GAAAGGGGAAAGAGGGAGCGGGG - Intergenic
1136129742 16:28212044-28212066 GAGCGGGGGGAGCGGGCGGAGGG + Intergenic
1136268016 16:29132144-29132166 AAGAAGGGAGAGAGGGAGGATGG + Intergenic
1136402440 16:30025881-30025903 CAGAGGGGAAAGAGGAAGGGCGG - Intronic
1136619223 16:31416991-31417013 GAGGGGGGAGGGAGGGGGGAAGG - Intronic
1136932547 16:34432292-34432314 GAGAGAGGAGAGAGAGAGGAAGG - Intergenic
1136938473 16:34498944-34498966 GAGAAGGGAGGGAGGGAGGAAGG - Intergenic
1136961346 16:34849613-34849635 GAGAAGGGAGGGAGGGAGGAAGG + Intergenic
1136972025 16:34979522-34979544 GAGAGAGGAGAGAGAGAGGAAGG + Intergenic
1137218721 16:46426805-46426827 GAGAAGGGAGGGAGGGAGGAAGG - Intergenic
1137386517 16:48047553-48047575 GAAAGGGGAAGGAGGACGAAGGG + Intergenic
1137488890 16:48914217-48914239 GAGAGGAGAAAGAATGCAGAAGG + Intergenic
1137613170 16:49832561-49832583 GAGTGGGGCAAGAGGGGGAAGGG + Intronic
1137614613 16:49839052-49839074 GAGGCGGGGAAGAGGGGGGATGG - Intronic
1138213644 16:55184066-55184088 GAGAGGGGTCAGAGAGTGGATGG + Intergenic
1138486729 16:57349938-57349960 GAGAAGGAAGAGAGGGAGGAAGG - Intergenic
1138505335 16:57475697-57475719 GAGGGGGGAGAGAGGGAGGGAGG - Intronic
1138505357 16:57475760-57475782 GAGAGGGGAGAGAGGGAGAGAGG - Intronic
1138510551 16:57506271-57506293 GAGAGGGGACTGAGGGCAGGGGG + Intergenic
1138579401 16:57930539-57930561 GGGAGGGGAGAGAGAGGGGAAGG + Intronic
1138667730 16:58586329-58586351 GAGAGGGGAAGGGGAGGGGAGGG + Intronic
1139292416 16:65870723-65870745 GAGAGGGAAAGGAGGGAGGGAGG + Intergenic
1139579180 16:67862063-67862085 GAGATGGGGATGAGGGTGGATGG + Intronic
1139701551 16:68710959-68710981 GGGAGGGGAAGGAGGGGGGAGGG + Intronic
1139959077 16:70707406-70707428 GAAAGGGGATGGAGGGAGGAGGG + Intronic
1140309490 16:73835376-73835398 GAAAGGGGAAAGAAGAGGGACGG - Intergenic
1140337210 16:74118746-74118768 GAGAGGAGAAGGAGGGAGGGAGG + Intergenic
1140551175 16:75867575-75867597 GAGAGTGGAAGGTGGGAGGAGGG - Intergenic
1140584874 16:76277480-76277502 GAGAGAGAAGAGAGGGAGGAGGG + Intronic
1140655179 16:77132448-77132470 GGGAGGGGAGAGGGGGAGGAGGG - Intergenic
1140782573 16:78310053-78310075 GAGAGGGGGAAGGAGGGGGAAGG - Intronic
1140814010 16:78604669-78604691 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814018 16:78604684-78604706 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814026 16:78604699-78604721 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814034 16:78604714-78604736 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814042 16:78604729-78604751 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814050 16:78604744-78604766 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814058 16:78604759-78604781 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814066 16:78604774-78604796 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814090 16:78604824-78604846 GAGGGGGGAAGGAGGGAGGGAGG - Intronic
1140919959 16:79528254-79528276 GAGAGGGGACAAAGGGCTGCAGG - Intergenic
1141150498 16:81561538-81561560 GTGAGGGGGAAGAGGGTGGCAGG + Intronic
1141151249 16:81565921-81565943 GAAAGGTGAAGGAGGGCGCAGGG - Intronic
1141427126 16:83951837-83951859 AGGAAGGGAAAGAGGGAGGAAGG - Intronic
1141466371 16:84208435-84208457 GAGGGGAGGAAGAGGGCAGAGGG + Intergenic
1141540241 16:84714421-84714443 GGGAGGCTAAAGAGGGAGGATGG - Intronic
1141557581 16:84846206-84846228 GGGAAGGGAAGGAGGGAGGAAGG - Intronic
1141838975 16:86562151-86562173 GAGGGGAGAAGGAGGGCAGAAGG - Intergenic
1141856262 16:86683230-86683252 GAGAGAGGAAGGAGGGAGGGAGG + Intergenic
1142008223 16:87700511-87700533 GAGGGAGGAAAGAGGGTGGAGGG + Intronic
1142008249 16:87700604-87700626 GAGGGAGGAAACAGGGTGGAGGG + Intronic
1142061333 16:88031796-88031818 GGGAGGGGCAAGAGAGGGGAGGG - Intronic
1142071325 16:88092489-88092511 GAGAGAGGAAGGAGGGAGGGAGG + Intronic
1142251472 16:88993847-88993869 GGGAGGGGAAGAAGGGAGGAGGG - Intergenic
1142836879 17:2593910-2593932 GAGAGGGGAGGGAGGAAGGAGGG - Exonic
1142958222 17:3535383-3535405 GAGAGGAGGGAGAGGGAGGAGGG - Intronic
1143020680 17:3915897-3915919 GAGATGGGGACGAGGCCGGAGGG - Intronic
1143085597 17:4413635-4413657 GAGAAGGGAGGGAGGGGGGAGGG - Intergenic
1143104573 17:4522574-4522596 GAGAAGAGAAAGAGGGAGGGAGG - Intronic
1143214713 17:5215948-5215970 GGGAGGCGAAAGAGGGAGGATGG + Intronic
1143288490 17:5810380-5810402 GGGATGAGAAAGAGGGAGGACGG - Intronic
1143361865 17:6377533-6377555 GAGAGGGAGAAGAGGGCAGGGGG - Intergenic
1143534218 17:7526325-7526347 GAGGGGAGAAAGAGGGGAGATGG - Intergenic
1143539810 17:7562238-7562260 GAGCGGGGAAGCCGGGCGGACGG - Exonic
1143582962 17:7836961-7836983 GAGAGGGGAAAGAGATGGCACGG - Intergenic
1143704548 17:8687573-8687595 GAGAGTGGGAAGAGGAGGGAAGG - Intergenic
1144018971 17:11223053-11223075 GACAGGGGAAAGAGAGTGGAAGG + Intergenic
1144199429 17:12926123-12926145 GGGAGGCGAATGAGGGTGGATGG + Intronic
1144212309 17:13025855-13025877 GAGAGGGAAGAGAGGGAGCAAGG - Intergenic
1144534776 17:16077508-16077530 GAGAGGGGAGGGGGGGAGGAGGG + Intronic
1144561002 17:16320276-16320298 GGGAGGGGAGGGAGGGAGGAAGG + Intronic
1145193717 17:20868916-20868938 GAGGGGGAAAAGAGGGTGGCAGG + Intronic
1145231665 17:21177650-21177672 GAGATGGGACAGAAGGTGGAGGG - Intronic
1145265671 17:21378524-21378546 GAGCAGGGAGTGAGGGCGGAGGG + Intronic
1145351943 17:22091140-22091162 GAGGGGGAAAAGAGGGTGGCAGG + Intergenic
1146085916 17:29829503-29829525 GAGAGAGGAGAGAGGGAAGAAGG + Intronic
1146102921 17:30003338-30003360 GAGAGGCTAAAGTGGGAGGATGG - Intronic
1146135777 17:30319670-30319692 GTGAGGGAAGAGAGGGAGGAAGG + Intronic
1146441295 17:32897326-32897348 GAGAGGGGAGGGAGGGAAGAAGG - Intergenic
1146482828 17:33218800-33218822 GAGAGTGGAAGGAGTGAGGAGGG - Intronic
1146657851 17:34645524-34645546 GGAAGGGGAGAGAGGGCAGAAGG + Intergenic
1146969479 17:37061189-37061211 GATCTGGGAAAGAGGGCAGAGGG + Intergenic
1147122455 17:38343676-38343698 CAGAGGGGGCAGAGAGCGGATGG + Exonic
1147131379 17:38411545-38411567 GAGAGAGGAGAGAGAGAGGAAGG + Intergenic
1147132907 17:38419431-38419453 GAGAGGGGAGAGAGAGCTGCGGG + Intergenic
1147192472 17:38746157-38746179 GAGAGGTGGGAGAGGGAGGAAGG - Intronic
1147193081 17:38748363-38748385 GGGAGGGGACCGAGGGGGGAGGG + Intronic
1147498753 17:40942321-40942343 GAGGGGGAAGAGAGGGAGGAGGG - Intergenic
1147516361 17:41121773-41121795 GGGAGGGGAAAGGGAGGGGAGGG + Intergenic
1147527065 17:41235797-41235819 GGGAGGGAAAAGAGGGAGCAGGG + Intronic
1147754866 17:42761418-42761440 GAGAGGGGAGAGGGGCTGGATGG + Intronic
1147817600 17:43221323-43221345 GAGGGTGGAAAGAGAGTGGAAGG - Intergenic
1147878639 17:43639571-43639593 GTGAGGGGAGAGAGGGAGGCAGG - Intergenic
1147943658 17:44067763-44067785 GAGAGGGCAAAAAGGGAGAAGGG - Intergenic
1148070703 17:44907031-44907053 GAGAAGGGGAGGAGGGCGGGGGG - Intronic
1148146423 17:45367724-45367746 GAGAGGGGGGAGGGGGAGGAAGG + Intergenic
1148156094 17:45425915-45425937 GAGAGGGGATAGAGGGAGACGGG - Intronic
1148478719 17:47946129-47946151 GAGAAGGGAAAGTGGGGGTAGGG + Intronic
1148638259 17:49165627-49165649 GTGGGGGGAAAGAGAGAGGAAGG - Intronic
1148735187 17:49861172-49861194 GAGAAAGGCAAGAGGGAGGAAGG - Intergenic
1148761100 17:50001031-50001053 GAGAGGGGTCAGAGGGAGGTGGG + Intergenic
1148796995 17:50201775-50201797 GAGAGGGGGAGGAGGAGGGAAGG + Intergenic
1148960068 17:51385361-51385383 GTGAGGGGAAGGATGGCGGATGG - Intergenic
1148997475 17:51723801-51723823 CAGATGGAAAAGAGGGCAGAGGG - Intronic
1149514717 17:57271851-57271873 AGGAGGGGAAAGAGTGAGGAGGG + Intronic
1149566529 17:57644374-57644396 GAGAGTGGAAAAAAGGTGGATGG - Intronic
1149588392 17:57809180-57809202 GAGTGGGGAGAGAGGGAGGCAGG + Intergenic
1149696637 17:58621449-58621471 GAGAGGAGAGAGAGGGCGAAAGG + Intronic
1149785794 17:59433886-59433908 GAGAGGGGAAAGGAGGAGGGAGG - Intergenic
1149885301 17:60333659-60333681 GAGAAGGGAAGGAGGGAGGGAGG + Intronic
1150542029 17:66111707-66111729 GAGAGGGGAGGGTGGGAGGAGGG + Intronic
1150543619 17:66129982-66130004 AAGAAGGGAAAGAGGGGGAAGGG + Intronic
1150552232 17:66221366-66221388 GGGAGGGGAGGGAGGGAGGAAGG + Intronic
1150820130 17:68428135-68428157 GGGAGGCCAAGGAGGGCGGATGG - Intronic
1150859455 17:68786345-68786367 GAGAGGGGTGAGAGGAAGGAAGG - Intergenic
1151065738 17:71147805-71147827 CAGAGAGGAAAAAGGGAGGAGGG - Intergenic
1151268924 17:72978217-72978239 AAGAAGGGAAAGAGGAAGGAAGG - Intronic
1151411447 17:73932982-73933004 GAGAGGGGGGAGAGGGAAGAGGG - Intergenic
1151467419 17:74296340-74296362 GAGAGAGGAGAGAGAGAGGAAGG + Intronic
1151563937 17:74886723-74886745 GAGAGGGGAAAGGGGGCGTATGG - Intronic
1151677977 17:75609628-75609650 GAGGAGGGAGAGAGGGAGGAAGG - Intergenic
1151714751 17:75825581-75825603 GGGAGGGCAGAGTGGGCGGAGGG + Exonic
1152018893 17:77770326-77770348 GAGAAGGGACAGAGGGAGGGAGG - Intergenic
1152069305 17:78127110-78127132 GGGAGGGGAGAGAGGAAGGAAGG + Intronic
1152241892 17:79165256-79165278 GAGAAGAGAAAGAGGGAGGGAGG + Intronic
1152261320 17:79268798-79268820 GAAAGAGGAAAGAGGGTGGCAGG - Intronic
1152707735 17:81853748-81853770 GTGAGGGGCAGGAGGGCGGCCGG - Intronic
1152913043 17:83016490-83016512 GAGAAGGGATGGAGGGAGGAGGG + Intronic
1153210743 18:2761261-2761283 AAGAGGGGAAAGAGGGAGGTGGG + Intronic
1153675308 18:7451794-7451816 GAGGGGGGAAGGAGGGAGGGAGG - Intergenic
1153870628 18:9316174-9316196 GAGGGGGGAAGGAGGGAGGGAGG + Intergenic
1153987791 18:10368595-10368617 GAGAGCAGAGAGAGGGAGGAAGG + Intergenic
1153997394 18:10454412-10454434 GAGAGGGGAAGGAGGGAAGCGGG + Intergenic
1154111728 18:11574828-11574850 GAGAAAGGAAGGAGGGCGGGAGG + Intergenic
1154183118 18:12154968-12154990 GAGAGTGGAAGGTGGGAGGAGGG + Intergenic
1154193840 18:12252057-12252079 GAGAGGTGGGAGAGGGCAGAGGG - Intergenic
1154475731 18:14755540-14755562 GTGAGGGGAAGGAAGGGGGAGGG - Intronic
1155008146 18:21748360-21748382 GAGGGGGGAGAGAGGGAGGGAGG - Intronic
1155008151 18:21748375-21748397 GAGGGGGGAGAGAGGGAGGGGGG - Intronic
1155041282 18:22067321-22067343 GAGAAGGGAGGGAGGGAGGAAGG + Intergenic
1155103547 18:22638500-22638522 GAGAGGGGAAGGAGGGAAGGAGG + Intergenic
1155195400 18:23469387-23469409 GAGAGGGGAGAGAGGAGAGAGGG - Intronic
1155922168 18:31614273-31614295 GAGAGAGGAAAGAGAAAGGAAGG + Intergenic
1156375716 18:36513700-36513722 AAGAGGGGAAAGAGGGATGAAGG - Intronic
1156450211 18:37262499-37262521 GAGAGGGGCAGGAGGGCCCATGG + Intronic
1156546100 18:37965194-37965216 GAAAGGGGAAAGGGGAGGGAGGG - Intergenic
1156637007 18:39043600-39043622 GAGGTGGGAAAGAGGGAGGGAGG + Intergenic
1156761803 18:40601049-40601071 AAGAAGGGAAGGAGGGAGGAAGG - Intergenic
1156772203 18:40742152-40742174 GAGAGGGGAGGAAGGGCAGAGGG + Intergenic
1157085192 18:44573384-44573406 GGGAGGGGAAGAAGGGAGGAAGG + Intergenic
1157191919 18:45588907-45588929 GAGAGGTGAAAGGGAGAGGAAGG + Intronic
1157279364 18:46335570-46335592 GAGTGGGGAGAGGGGGAGGAGGG - Intronic
1157340546 18:46774007-46774029 GGGAGGGTGAAGAGGGGGGAAGG - Intergenic
1157590566 18:48834020-48834042 GGGAGGGGAAAGGAGGGGGAAGG - Intronic
1157602450 18:48902320-48902342 GAAAGGGGAAGGAGGGCGGCTGG - Intergenic
1157680726 18:49603363-49603385 GAGTGTGGCCAGAGGGCGGATGG - Intergenic
1157801138 18:50622301-50622323 GAAAGGGGGAAGAGGGAAGAAGG + Intronic
1157960749 18:52151015-52151037 AATAGGGGAGAGAGGGAGGAGGG - Intergenic
1158078433 18:53560061-53560083 GAGGGGGAAAAGAGGGCGGGAGG + Intergenic
1158103786 18:53861387-53861409 GAGGGAGGAAGGAGGGAGGAAGG + Intergenic
1158103791 18:53861398-53861420 GAGGGAGGAAGGAGGGAGGAGGG + Intergenic
1158103817 18:53861462-53861484 GAGGGAGGAAGGAGGGAGGAGGG + Intergenic
1158560098 18:58506215-58506237 AAGAGGGGAGGGAGGGAGGAGGG + Intronic
1158575921 18:58637852-58637874 GAAAGGGGAAAGAGGGCAACTGG - Intergenic
1158760638 18:60381643-60381665 GAGAGGGAAGAAAGGGTGGAGGG + Intergenic
1158980106 18:62751742-62751764 GGGAGGGGAAAGATGAGGGAAGG + Intronic
1159134268 18:64318651-64318673 GGGAGGAGAAAGAGAGAGGAAGG - Intergenic
1159300053 18:66552056-66552078 GAGAGGGGAAGGAGGGAGTGGGG + Intronic
1159360737 18:67399093-67399115 GAGAGAGGAAAGAGATCTGAAGG - Intergenic
1159360833 18:67400445-67400467 GAGAGAGGAAAGAGATCTGAAGG - Intergenic
1159375312 18:67585366-67585388 GAGAGGGGAAAGAGGGAAATAGG - Intergenic
1160174230 18:76579700-76579722 GGGAGGGGATATAGGGCAGACGG + Intergenic
1160373016 18:78390331-78390353 GAGGAGGGAGAGAGGGAGGAGGG + Intergenic
1160409749 18:78667731-78667753 GAGAGGGGTGGGAGGGCGGATGG - Intergenic
1160566785 18:79790906-79790928 GAGAGAGGAGAGAGGGAGGGAGG - Intergenic
1160758618 19:771618-771640 GGGAGAGGAGAGAGGGAGGAGGG - Intergenic
1160779541 19:871778-871800 GAGAGGGGAGAGCGGGGAGAAGG + Intronic
1160779553 19:871810-871832 GAGAGGGGAGAGCGGGGAGAGGG + Intronic
1160779559 19:871826-871848 GAGAGGGGAGAGCGGGGAGAGGG + Intronic
1160783023 19:886207-886229 GAGAAGGGAGGGAGGGAGGAGGG + Intronic
1160872116 19:1282331-1282353 GAGAGTGGGAAGGGGGAGGAGGG + Intergenic
1160916844 19:1500815-1500837 GAGAAGGGGAGGAGGGAGGAGGG + Intergenic
1160919227 19:1512082-1512104 GCAGGGGGAAAGAGGGGGGAAGG + Intronic
1160951498 19:1669700-1669722 GAGAGAGGAGAGAGAGGGGAGGG - Intergenic
1161022284 19:2015889-2015911 GGGAGGGGAAAGGAGGGGGAAGG + Intronic
1161022301 19:2015927-2015949 GGGAGGGGAAAGGAGGGGGAAGG + Intronic
1161022318 19:2015965-2015987 GGGAGGGGAAAGGAGGGGGAAGG + Intronic
1161022335 19:2016003-2016025 GGGAGGGGAAAGGAGGGGGAAGG + Intronic
1161023823 19:2025508-2025530 GAGAGAGGAAGGAGGGAGGGAGG - Intronic
1161093872 19:2377548-2377570 GAGAGGGGAGAGAGGGGAGAGGG - Intergenic
1161139763 19:2640190-2640212 GAGAAGGGGGAGAGGGAGGAAGG + Intronic
1161207134 19:3047095-3047117 GAGAGGGGAAGGAGGAGGGGAGG - Intronic
1161349593 19:3784516-3784538 GGGAGGGGAAAGAGGACAGGAGG + Intronic
1161458292 19:4381070-4381092 GAGAGGGGACAGAGAGAGGCAGG - Intronic
1161582885 19:5090515-5090537 GAGCGGGGAAAGAGGGGGAGAGG - Intronic
1161845607 19:6710290-6710312 GAGAGGGGAGAGAGAGGGAAAGG + Intronic
1162080071 19:8212496-8212518 GACAGCAGAAAGAGGGCAGAAGG + Intronic
1162474526 19:10892005-10892027 GGGAAGGGACAGAGGGAGGAGGG - Intronic
1162524003 19:11197168-11197190 GACAGGGGAGAGCGGGCAGAGGG + Intronic
1162531453 19:11238473-11238495 GAGATAGGACAGAGGGCAGAGGG + Intronic
1162569266 19:11461523-11461545 GAGGGAGGAAAGAGGGAGGGAGG - Intronic
1162637550 19:11981909-11981931 TAGAGTGGAAAGAGGGCAGCAGG + Intergenic
1162717043 19:12640726-12640748 GAGGGTGGAAGGAGGGAGGAAGG + Intergenic
1162818384 19:13209180-13209202 GAGAGGGGACAGAGGGGGCCAGG - Intronic
1162861253 19:13506984-13507006 GGGAAGGGAAAGAGGAGGGAAGG + Intronic
1163010209 19:14420494-14420516 GTGGAGGGAAAGAGGGAGGAAGG - Intergenic
1163023958 19:14498789-14498811 GGGAGGCCAAAGAGGGAGGATGG - Intergenic
1163093214 19:15035808-15035830 GAGAGGAGAAGGAGGGAGGGAGG + Intergenic
1163093821 19:15041287-15041309 GAGGGGGGAGGGAGGGGGGAGGG - Intergenic
1163204911 19:15795235-15795257 GAGAAGGGAAAGAGGGAAGTAGG - Intergenic
1163351027 19:16777130-16777152 GGGAGGGGAAAGGGGAGGGAAGG + Intronic
1163351052 19:16777184-16777206 GGGAGGGGAAAGGGGAGGGAAGG + Intronic
1163351108 19:16777315-16777337 GGGAGGGGAAAGAGGAGGGAAGG + Intronic
1163351117 19:16777342-16777364 GGGAGGGGAAAGAGGAGAGAAGG + Intronic
1163352217 19:16784558-16784580 GAGAGGGGAATGAGGTTGGCGGG + Intronic
1163546089 19:17942264-17942286 GGGAGGGGGAAGAGGCCGGGAGG - Intronic
1163663479 19:18592208-18592230 GAGATGGGAAACGGGGCGGATGG + Exonic
1164149715 19:22540806-22540828 GAGAGGGGAGAGGGAGCAGAGGG + Intergenic
1164186371 19:22872413-22872435 GAGAGGGGAGAGAGGGGACAGGG + Intergenic
1164292518 19:23880757-23880779 GAGAGGAGAAAGAGGATGAAAGG + Intergenic
1164441679 19:28284416-28284438 AAGAAGGGAAGGAGGGTGGAAGG + Intergenic
1164441740 19:28284638-28284660 TAGAGGGAAAAGAGGGTGGAGGG + Intergenic
1164441774 19:28284758-28284780 TAGAGGGGAAGGAGGGTGGGAGG + Intergenic
1164441791 19:28284806-28284828 TGGAGGGGAAGGAGGGTGGAGGG + Intergenic
1164441798 19:28284822-28284844 TGGAGGGGAAGGAGGGTGGAGGG + Intergenic
1164441805 19:28284838-28284860 TGGAGGGGAAGGAGGGTGGAGGG + Intergenic
1164441830 19:28284900-28284922 TGGAGGGGAAGGAGGGTGGAAGG + Intergenic
1164441866 19:28285021-28285043 TGGAGGGGAAGGAGGGTGGAGGG + Intergenic
1164441877 19:28285053-28285075 CAGAGAGGAAGGAGGGTGGAGGG + Intergenic
1164441932 19:28285238-28285260 TGGAGGGGAAGGAGGGTGGAAGG + Intergenic
1164441961 19:28285326-28285348 TGGAGGGGAAGGAGGGTGGAAGG + Intergenic
1164581662 19:29438797-29438819 GGGAGGGGGAAGAGAGAGGAGGG + Intergenic
1164581770 19:29439193-29439215 GAGGGGGGAGAGAGGGAGGCAGG + Intergenic
1164757386 19:30700328-30700350 GAGGGGGGAGGGAGGGAGGAAGG - Intronic
1164757646 19:30702434-30702456 GAGAGGGGAATGAGGTGGGGCGG + Intronic
1165069760 19:33248516-33248538 GAGAGGGAGAGGAGGGAGGATGG + Intergenic
1165204389 19:34171806-34171828 TAGAGGGGAAACAGGGAGCATGG + Intergenic
1165327194 19:35121045-35121067 AAGAGGGGAAGGAGGGGAGATGG - Intronic
1165510598 19:36264583-36264605 GAAAGGAGAAAGAGGTTGGAGGG + Intergenic
1165637572 19:37355098-37355120 GAAAGGGGAAGGAAGGAGGAAGG - Intronic
1165745137 19:38226257-38226279 GGAAGGGGAAAGGGGGAGGAGGG - Intronic
1166309061 19:41952161-41952183 GAGAGGGGAAGGGGAGGGGAGGG - Intergenic
1166374677 19:42320989-42321011 GGGAGGGCAAAGAGAGAGGATGG - Intronic
1166567774 19:43775661-43775683 GAGAGGGGGAAGAGGGGAAAGGG + Intronic
1166634470 19:44437966-44437988 GAGAGTGGATAGTGGGAGGAGGG + Intronic
1166665655 19:44678741-44678763 GAGAGGGGGGAGGGGGTGGAAGG - Intronic
1166677214 19:44747595-44747617 GAGATGGGAGGGAGGGAGGAGGG - Intergenic
1166688807 19:44810870-44810892 GAGAAGGGATGGAGGGCGAAAGG + Intronic
1166794379 19:45417505-45417527 GGGAGGGGAAAGAGGGCTTGAGG + Intronic
1166811635 19:45517901-45517923 GGGAGGGGAAAGGGGGGTGAGGG - Intronic
1166823033 19:45592051-45592073 GAGAGGGAAAAGTTGGAGGAGGG + Exonic
1166881111 19:45930686-45930708 GAAGGGGGAAGGAGGGAGGAAGG - Intergenic
1167130553 19:47582367-47582389 GGGAGGAGAAAGAGGGGGGAGGG - Intergenic
1167140093 19:47644443-47644465 GGGAGGGGAAGGAGGGAGGGAGG - Intronic
1167207659 19:48113479-48113501 GGAAGGGGAGAGAGGGCGGGTGG + Intergenic
1167295332 19:48646191-48646213 GGGAGGGGGAGGAGGGAGGAAGG - Exonic
1167368532 19:49066946-49066968 GCAAGGGGGAAGAGGGCAGATGG - Intergenic
1167455284 19:49594564-49594586 GAGAGGAGAGAGGAGGCGGAGGG - Exonic
1167470276 19:49671914-49671936 GAAGGGGGAAGGAGGGCGGTGGG - Intronic
1167526668 19:49988552-49988574 GAGAGGGGAAGGAAGGGGGGTGG - Intronic
1167612218 19:50513016-50513038 GAGAGGGGAAAGAGGGCGGAGGG + Intronic
1167622960 19:50568912-50568934 GTGAGGGGAAAGAGGAGGTAGGG + Intergenic
1167631024 19:50626246-50626268 GTGAGGGGAGAGAGAGAGGAGGG + Intronic
1167649109 19:50719846-50719868 GAGGGAGGGGAGAGGGCGGAGGG - Intergenic
1167679035 19:50908332-50908354 GAGAGGGGAAAGGGGAGGGCAGG - Intronic
1167779938 19:51592720-51592742 GGGAGGGGAAAGAAGATGGATGG + Intergenic
1167837635 19:52087357-52087379 GAGAGTGGAAGGTGGGAGGAGGG - Intronic
1167992736 19:53374210-53374232 GAGTGGGGAGAGTGGGAGGAAGG - Intronic
1168046882 19:53800508-53800530 AAGAGGGGACAGAGAGCAGAAGG + Intronic
1168072168 19:53959401-53959423 GGGAAGGGAAAGAGGGGGGCAGG - Intergenic
1168083784 19:54029964-54029986 GGGAGGGGAGAGAGGGGAGAGGG + Intergenic
1168083791 19:54029980-54030002 GAGAGGGGAGAAATGGGGGAGGG + Intergenic
1168174248 19:54611927-54611949 GAGTGGGGAGAGAGGGAGGAGGG + Intronic
1168236429 19:55066527-55066549 GAGAGAGGAAAGAGAAAGGAAGG - Intronic
1168249432 19:55133332-55133354 GAGAGGGAGAGGAGGGAGGAAGG + Intronic
1168308600 19:55450001-55450023 GAGAGGGGACAGAGAGCCAAAGG + Intergenic
1168357862 19:55713627-55713649 GAGAGGGGAGAGGAGGAGGAGGG - Intronic
1168525771 19:57087766-57087788 GAGAGGGGAGAGGGGGAGGGGGG + Intergenic
1168536729 19:57176997-57177019 GAGTGGGGAAAGAAGGCTGAAGG - Intergenic
925154450 2:1638984-1639006 GTGAGGGGAAAGGAGGAGGAGGG + Intronic
925199278 2:1953016-1953038 GAAAGAGGAAAGAGGAAGGAAGG - Intronic
925235573 2:2274353-2274375 GAGAAGGGAAGGAGGGAGGGAGG + Intronic
925274755 2:2640939-2640961 TAGAGGGGACAGAGGCAGGAGGG + Intergenic
925356741 2:3246963-3246985 GAGAGGGGAAGGAGGGAGGGAGG + Intronic
925392767 2:3508966-3508988 AGGAGGGGAGAGAGGGCGGAAGG + Intronic
925462550 2:4075838-4075860 GAGAAGGAAAAGAGGGAGGCAGG - Intergenic
925492484 2:4410242-4410264 GAGAAGGGAGAAAGGGAGGAAGG - Intergenic
925609335 2:5691388-5691410 GAGAAGGGAAGGAGGGCGCCGGG + Intergenic
925845777 2:8031932-8031954 GACAGGAGACAGAGGGCTGAGGG + Intergenic
925910074 2:8568061-8568083 GAGAGGGGAAAGGAGGCTGCTGG + Intergenic
926025327 2:9537926-9537948 GAGAGGGGGAGGAGAGGGGAAGG + Intronic
926025337 2:9537948-9537970 GGGAGGGGGAAGAGAGGGGAAGG + Intronic
926240511 2:11081229-11081251 GAGAGGGGGAAATGGGGGGAGGG - Intergenic
926807484 2:16724443-16724465 GAGATGGGACAAAGGGAGGATGG + Intergenic
926854770 2:17242939-17242961 GAGTGGGGAAAGTGGGAAGAAGG - Intergenic
927359484 2:22215946-22215968 GAGAGGGGGAAAAGGGAGAACGG + Intergenic
927877812 2:26670505-26670527 GAGAAGGGAAGGAAGGAGGAAGG + Intergenic
927945433 2:27132527-27132549 GAGAGGGAAAAGACTGGGGATGG - Intronic
928022532 2:27715816-27715838 GGGAGGGGGGAGGGGGCGGAGGG - Intergenic
928219827 2:29394532-29394554 GAGAGGGGAGAGAGTGTGGATGG + Intronic
928278348 2:29921817-29921839 GAGAGGGAACAGAGGGAGGGTGG - Intergenic
928331313 2:30360025-30360047 GAGTGTGGACAGAGGGCAGAGGG + Intergenic
928373072 2:30755166-30755188 GAGAGGAGGAAGAGGGCGCCAGG - Intronic
928421146 2:31138489-31138511 GGGAGGAGCACGAGGGCGGAGGG + Intronic
928443821 2:31315531-31315553 GAGAGGGGAATGGGAGCAGAGGG - Intergenic
929023409 2:37576188-37576210 GAGAGGGGAGGGTGGGAGGAGGG - Intergenic
929342202 2:40834242-40834264 CAGATGGGAAGGAGGGAGGAAGG - Intergenic
929357930 2:41049456-41049478 GAGGGGGGAAAGAAGGCAGTAGG - Intergenic
929385704 2:41403703-41403725 GGAAGGGGAAAGAGGATGGAGGG + Intergenic
929515493 2:42602854-42602876 CAGAAGGGAAAGGGGGTGGATGG - Intronic
929856162 2:45640129-45640151 AAGAGGGGAAAAAGGAGGGATGG + Intergenic
930327716 2:49941365-49941387 GAGAGGAGAGAAAAGGCGGATGG - Intronic
930388493 2:50729663-50729685 GAGAGGGTGAAGAGTGCTGATGG - Intronic
930518447 2:52434834-52434856 GAGAGAGAAAAGATGGCGGTTGG + Intergenic
930919036 2:56728805-56728827 GTGAGGGGAGAGAAGGAGGAGGG - Intergenic
931260559 2:60614846-60614868 GGGAGGCCAAAGCGGGCGGATGG + Intergenic
931340766 2:61398566-61398588 AAGAGGGGAAAGTCGGGGGAGGG + Intronic
931543872 2:63359074-63359096 GAAAGTGGAAAGAGGAAGGAAGG - Intronic
931546998 2:63399589-63399611 GAGAGAGGAAGAAGGGCGGGGGG + Intronic
931668651 2:64627543-64627565 GAGAGGGGAGGGAGGGAGGGAGG + Intergenic
931826330 2:66004291-66004313 GAGAGGGAAGAGAGGAAGGAAGG - Intergenic
931901282 2:66791227-66791249 GAGAGGGCAGAGAGTGTGGATGG - Intergenic
932331692 2:70901530-70901552 GAGAGGAGGACGAGGGCCGAGGG - Intronic
932606523 2:73169398-73169420 GAGAGGAGATAGGAGGCGGAAGG + Intergenic
932624525 2:73286767-73286789 GAAAGGGGAAGGAGGAGGGAAGG - Intergenic
932769052 2:74490294-74490316 GACAGGGGCAAGGGGGCTGAGGG + Exonic
932911490 2:75810634-75810656 GGGAGGGGAAAAAGGGAGGGAGG - Intergenic
933109494 2:78379218-78379240 GAGAGGGGAGAGAGGGAGAGAGG + Intergenic
933234511 2:79850283-79850305 GAGGGGGGAGGGAGGGAGGAAGG - Intronic
933304831 2:80584418-80584440 GAGAGGAGATAGGGGGCGGGGGG + Intronic
933378528 2:81513385-81513407 AAGATGAGAAAGAGGGAGGAGGG + Intergenic
933684584 2:85133373-85133395 GAGCGGGGAGGGAGGGAGGAGGG - Intergenic
934047330 2:88183576-88183598 GAGGGAGGAAAGAGAGAGGAAGG - Intronic
934577925 2:95414642-95414664 GAGAGGGGAATGAGGGTGCCTGG - Exonic
934601513 2:95662060-95662082 GAGAGGGGAATGAGGGTGCCTGG + Intergenic
934903535 2:98179747-98179769 GAGAAAGGAAGGAGGGAGGAAGG - Intronic
935149665 2:100422448-100422470 GAGCTGGGGAAGAGGCCGGAGGG - Intergenic
935422208 2:102880954-102880976 AAGAGGGGAATGAGGAGGGAGGG - Intergenic
935442791 2:103122134-103122156 GAGAAGGGAAAGAGGAGGGAGGG - Intergenic
935540312 2:104340582-104340604 CGGAGGGGAAAGAGTGAGGAAGG - Intergenic
935726776 2:106030562-106030584 GAGAGGGGAAAGAGCGGGAAGGG + Intergenic
935863058 2:107354871-107354893 AAGAGGGGAAGAAGGGAGGAGGG + Intergenic
936397027 2:112138820-112138842 GACAGGGGAGAGAGGCGGGAGGG - Intronic
936397035 2:112138842-112138864 GACAGGGGAGAGAGGCGGGAGGG - Intronic
936397050 2:112138891-112138913 GACAGGGGACAGAGGCGGGAGGG - Intronic
936397322 2:112139889-112139911 GACAGGGGAGAGAGGCGGGAGGG - Intronic
936397409 2:112140208-112140230 GACAGGGGAGAGAGGCGGGAGGG - Intronic
936397443 2:112140338-112140360 GACAGGGGAGAGAGGAAGGAGGG - Intronic
936534876 2:113304224-113304246 GAGAGGGGAATGAGGGTGCCTGG + Intergenic
936662738 2:114560220-114560242 GGGAGGAGAAGGAGGGCAGAGGG + Intronic
936667036 2:114608887-114608909 GAAAGGGGAGAGAGGAAGGACGG + Intronic
936846789 2:116844279-116844301 GAGAGGGGAGAGAGGAAAGAAGG - Intergenic
936914148 2:117622956-117622978 GAGAGGAGAGAGAGGAAGGAAGG + Intergenic
936989979 2:118352993-118353015 GAGTGGGGAAAGTGGGAGGATGG - Intergenic
937005046 2:118503785-118503807 TAGAGTGGGAAGAGGGAGGAAGG + Intergenic
937140042 2:119592132-119592154 AAGAGGAGAAAGAGGGAGGCTGG + Intronic
937278594 2:120702303-120702325 GAGAGGGGAGTGAGGGTGGGAGG + Intergenic
937293769 2:120797719-120797741 GGGAGGGGAGAGAGGGAGGAGGG + Intronic
937293775 2:120797735-120797757 AGGAGGGGAGAGAGGGAGGAGGG + Intronic
937311680 2:120906730-120906752 GAGAGGGGACACAGGGGAGAAGG - Intronic
937328230 2:121005080-121005102 GGAAGGGGAATGAGGGCTGAGGG - Intergenic
937639766 2:124198559-124198581 GAGTGGGGAGAGAGGGAGGAGGG - Intronic
937718802 2:125066374-125066396 GAGAGGGGAGAGTAGGAGGAGGG - Intergenic
937900442 2:127015762-127015784 GAGAGAGGAAATGGGGCAGAGGG - Intergenic
938059558 2:128241524-128241546 GACAGGGGAAAGAAGGATGAAGG + Intronic
938301508 2:130217527-130217549 GAGCGGGGGACGGGGGCGGAGGG - Intergenic
938427605 2:131204307-131204329 GAGAAGAGAAAGAGGAAGGAAGG + Intronic
938468542 2:131538329-131538351 GAGAAGAGAAAGAGGAAGGAAGG + Intergenic
939198204 2:138999750-138999772 GAGAAGAGAAAGAGGGTGGTAGG + Intergenic
939630248 2:144520437-144520459 GAGAAGGGAGGGAGGGGGGAGGG - Intronic
939733834 2:145819264-145819286 GAGAAGGGAGAGAGGGAGGAAGG - Intergenic
939799998 2:146696910-146696932 GGGAGGGGAAGGAGAGGGGAAGG + Intergenic
940339147 2:152561422-152561444 GAGAAATGAAAGAGAGCGGAAGG - Intronic
941038162 2:160590456-160590478 GGGAGGGGGAAGGGGGAGGAGGG - Intergenic
941758952 2:169219686-169219708 GAGAGGGGAGGAAGGGAGGAGGG + Intronic
941927224 2:170908294-170908316 GAGTGGGGGAAGAGCGGGGAGGG + Intergenic
942125232 2:172818185-172818207 GAAAGGGGAGAGAGGGGTGAAGG + Intronic
942345311 2:174996738-174996760 GAGAGAGGAGAGAGGGCAGCTGG - Intronic
942629425 2:177939478-177939500 AAGAAGGGAGAGAGGGAGGAGGG + Intronic
942636738 2:178015773-178015795 GAGAGGAAAAGGAGGGTGGAAGG + Intronic
943028956 2:182663672-182663694 GAGAGAGGAAAGTGGGAGGAGGG + Intergenic
944039552 2:195338406-195338428 GAGAGGGGAAAGAGAGAGAGAGG - Intergenic
944121070 2:196241461-196241483 GAGAGAGGACAGAGGAGGGACGG - Intronic
944135443 2:196394151-196394173 GTGAGGGGGGAGAGGGGGGAGGG + Intronic
944154843 2:196598176-196598198 GAGAGGGGAAAGAGAGGGGAAGG + Intergenic
944775587 2:202960797-202960819 GAGAAAGGAAAGAGGAGGGAAGG - Intronic
945067275 2:205957758-205957780 GAGAGGGAAAAGTGGGGGCAAGG + Intergenic
945085340 2:206125800-206125822 GAGAGTGGAGAGTGGGAGGAGGG - Intronic
945406980 2:209460561-209460583 GAGAAGGGAAAGAGAAGGGAAGG - Intronic
945588337 2:211695980-211696002 GGGAAGGGAAGGAGGGAGGAAGG - Intronic
945639424 2:212404792-212404814 GAGAGTGGAGAGTGGGAGGAGGG - Intronic
945753493 2:213817816-213817838 GAGATGGGAAAGAGGGAGGTGGG + Intronic
946033425 2:216723298-216723320 GAGTGGGGTTAGAGGGCAGAAGG - Intergenic
946048724 2:216843047-216843069 AAGAGGGGACTGAGGGCTGAGGG + Intergenic
946225377 2:218261585-218261607 GGGAGGGGAAAGGGGGCATAAGG + Intronic
946375810 2:219308498-219308520 GGGTGGGGAAAGAGGGCGCCAGG + Intronic
946399370 2:219460660-219460682 GAGAGGGGAGAGGGGAGGGAGGG - Intronic
946715508 2:222551154-222551176 AAGAGAGGAAAGAGTGCAGATGG - Intronic
946962484 2:224999498-224999520 AAGAGGGGAGAGAGGGAGGGAGG - Intronic
947030052 2:225783019-225783041 GAGGGAGGAAGGAGGGAGGAAGG - Intergenic
947042776 2:225942489-225942511 GAGAAGGGGAAGAGGGAAGAGGG + Intergenic
947159113 2:227193990-227194012 GAGAGGAGAAAGAGAAGGGAAGG + Intronic
947323764 2:228952238-228952260 GAGAGGGAGAAGAGGGAGGGCGG + Intronic
947367143 2:229408419-229408441 GGGAAGGGAGAGAGGGAGGAGGG - Intronic
947403096 2:229748424-229748446 GGGAGGCCAAAGAGGGCAGATGG + Intergenic
947422526 2:229953707-229953729 AAGAGGGGAAGGAGAGAGGAGGG + Intronic
947771404 2:232673215-232673237 GAGAGGGTAGAGAGGAGGGAAGG + Intronic
947797628 2:232905081-232905103 GAGAGGAGAGAGAGGGGAGAGGG - Intronic
947833388 2:233158033-233158055 GAGAGGGGAAGGAGGGAGGCAGG + Intronic
947885447 2:233566159-233566181 GAGGGGGGAAGGGGAGCGGAGGG + Intronic
948295466 2:236857174-236857196 GACAGGGGAAAGAGGAGAGAGGG - Intergenic
948344325 2:237282649-237282671 GGGAGGGGAGAGAAGGGGGAGGG + Intergenic
948380144 2:237545039-237545061 GAGTGGGGACAGTGGGTGGAGGG + Intronic
948871938 2:240805076-240805098 GAGAGGGGAGGGAGAGGGGAGGG + Intronic
948871943 2:240805087-240805109 GAGAGGGGAGGGAGAGGGGAGGG + Intronic
948871955 2:240805113-240805135 GAGAGGGGAGGGAGGGCGGAGGG + Intronic
948939182 2:241187697-241187719 GAGAGGGAGAAGTGGGGGGAGGG + Intergenic
1168744450 20:226257-226279 GAGAGTGGAAGGTGGGAGGAGGG + Intergenic
1168955062 20:1828914-1828936 GAGAGGGGAAGGAAGGAGGGAGG - Intergenic
1169137102 20:3203949-3203971 ATGGGGGGAAAGAGGGAGGATGG + Intronic
1169155628 20:3327364-3327386 GAGTGGGGAAAGATGGGGGAGGG + Intronic
1169316716 20:4597896-4597918 GAGAGGAGAGAGAGGGAGGGAGG - Intergenic
1169371271 20:5030074-5030096 GAGAGGGGAAATTGGCAGGAAGG - Intergenic
1169505724 20:6209214-6209236 AAGAGGGAAAGGAGGGAGGAAGG - Intergenic
1169509906 20:6252209-6252231 GAGAGGGGAAGGAGGGAGGCAGG + Intergenic
1169541626 20:6606104-6606126 GAAAAGGGAAGGAGGGCGGGAGG - Intergenic
1170624628 20:18021802-18021824 GGGAGGGGAAAGAGGAAGCAGGG + Intronic
1170714052 20:18817042-18817064 GAGATGGGAGAGTGGGCAGAGGG + Intronic
1171332800 20:24356393-24356415 GAGAGGAGAAAGAGGACAGAGGG + Intergenic
1171370924 20:24661493-24661515 GAGGGAGGGAAGAGGGAGGAAGG + Intronic
1172095816 20:32459771-32459793 GAGAGGCCAAAGTGGGAGGATGG - Intronic
1172113937 20:32562925-32562947 GAGTGGAGAAGGAGGGTGGAGGG + Intronic
1172171741 20:32939626-32939648 GAGAGAGAAAGGAGGGAGGAAGG - Intronic
1172271833 20:33659464-33659486 GAGAGGGGCAAGCGGCTGGATGG - Intronic
1172423934 20:34842276-34842298 GGGAGGGGAAGGAGAGGGGAAGG + Intergenic
1172423935 20:34842287-34842309 GAGAGGGGAAGGAGAGAGCAAGG + Intergenic
1172467328 20:35165949-35165971 GAAGGGGGAAAGAGGGAGGGAGG - Intergenic
1172537954 20:35688763-35688785 GGGAGGGAAAAGAGGGAGAAAGG + Intronic
1172603725 20:36200826-36200848 GGAAAGGGAAAGAGGGAGGAAGG - Intronic
1172648938 20:36489643-36489665 AAGAGGGACAAGAGGTCGGAAGG + Intronic
1173103963 20:40114233-40114255 GAGAGGGGAAAGAAGGTAAAAGG + Intergenic
1173216538 20:41090216-41090238 GGGAGGCCAAAGCGGGCGGAGGG - Intronic
1173358562 20:42318797-42318819 TAGAGGGGAAAGATGACAGAAGG - Intronic
1173414601 20:42844670-42844692 GAGAGGGGAGAGGGGTCAGAAGG - Intronic
1173438992 20:43058426-43058448 GAGAGAGAAAAGAGGATGGAAGG + Intronic
1173485425 20:43437550-43437572 AAGATGGGAAAGATGGGGGAGGG + Intergenic
1173541682 20:43857346-43857368 GAGAGAGGGAGGAGGGAGGAAGG + Intergenic
1173567952 20:44055328-44055350 GAGAGTGGAAAGAGCAGGGACGG + Intronic
1173912611 20:46681440-46681462 AAGAGGGGAAGGAGGGAGGAGGG + Intronic
1174022353 20:47541322-47541344 GAGTGGGGAAAGGAGGGGGAGGG - Intronic
1174178437 20:48659321-48659343 GAGAGAGGAAGGAAGGAGGAAGG + Intronic
1174289054 20:49494424-49494446 GGGAGGCCAAAGTGGGCGGATGG + Intergenic
1174415855 20:50366508-50366530 GGGAGGGGAAGGAGGGAGGGAGG - Intergenic
1174418168 20:50381148-50381170 GGGAGGGGAGGGAGGGAGGAAGG + Intergenic
1174462399 20:50691902-50691924 GAAAGGAGAAAGAGTGAGGAAGG - Intergenic
1174578425 20:51553912-51553934 GAGGGGGGACAGTGGGCCGACGG - Intronic
1174627607 20:51928220-51928242 GAGAGAGGGAAGAGGGAGAAAGG + Intergenic
1174809841 20:53636287-53636309 GAGAGAGGAAAGAAGAAGGAAGG + Intergenic
1175226065 20:57444661-57444683 GGGAGCGGAAAGAGGATGGAGGG + Intergenic
1175279700 20:57794831-57794853 GGGAGGGGACAGAGGCAGGATGG - Intergenic
1175332533 20:58175256-58175278 GAGAAGGAAAAGAGGGAGGGAGG + Intergenic
1175402976 20:58711103-58711125 GAGAGGGGGAGGAGGGGGGGAGG - Intronic
1175487291 20:59355448-59355470 GAGAGGGGAGAGAGGGGAGATGG - Intergenic
1175744470 20:61445552-61445574 GGGAGGGGAGAGGGGGAGGAGGG - Intronic
1175766071 20:61594007-61594029 GAGGTGGGAGAGAGGGAGGAGGG + Intronic
1175862325 20:62157036-62157058 GAGAGAGGAGAGAGGGGGTATGG - Intronic
1175872968 20:62217056-62217078 GGGAGGGGAAAGAGGGAGGGAGG - Intronic
1175890602 20:62314231-62314253 GAGAGGGGAGAGATGGCGAACGG + Intronic
1176234758 20:64049115-64049137 GAGAAGGGGGAGAGGGCGGGGGG - Intronic
1176383985 21:6127875-6127897 GAGAGGAGAAAGAGGAGGGAGGG + Intergenic
1176688091 21:9872838-9872860 GAGAGTGGAAGGAGAGAGGATGG + Intergenic
1176725687 21:10430782-10430804 GAGAGTGGAAAAAGGAAGGAGGG - Intergenic
1176742548 21:10617250-10617272 GAGAAGGGAGGGAGGGAGGAAGG + Intergenic
1177454747 21:21322301-21322323 GAGAAGGGAAAGAGGGAGGTGGG + Intronic
1177674372 21:24277308-24277330 GAGTGGGGAGAGAGGGAGGGAGG - Intergenic
1178170575 21:30035269-30035291 GGGAAGGGAAAGAGGAAGGAAGG - Intergenic
1178307590 21:31503416-31503438 AAGAGGAGAAAGAGAGAGGAAGG + Intronic
1178714826 21:34954675-34954697 GTGAGGGGAGAGAGGGTGGGTGG - Intronic
1179412056 21:41169158-41169180 GAGAAAGGAAAGCGGGCGCAGGG - Intronic
1179542921 21:42095332-42095354 GGGAGGCCAAAGTGGGCGGATGG - Intronic
1179560265 21:42211450-42211472 GAGAGAGGAAGGAAGGAGGAAGG - Intronic
1179563796 21:42234160-42234182 CAGAAGGGAAGGAGGGTGGAGGG + Intronic
1179615385 21:42580093-42580115 GGGAGGGAAAAGAGGAGGGAGGG - Intronic
1179626749 21:42653509-42653531 GAGAGAGGAGAGACGGGGGAGGG + Intergenic
1179721308 21:43317545-43317567 GGGAGGCCAAAGCGGGCGGATGG - Intergenic
1179739489 21:43410363-43410385 GAGAGGAGAAAGAGGAGGGAGGG - Intergenic
1179807267 21:43847632-43847654 GGGAGGGGACAGAGGCCAGATGG + Intergenic
1179908210 21:44435036-44435058 GAGAGGGGACAGCGGGCGTCAGG - Intronic
1180186638 21:46143323-46143345 GAGTGGGGAGAGAGGGAGGTGGG - Intronic
1180186818 21:46144441-46144463 GAGAGGGGAGAGAGGGAGAGGGG - Intronic
1180794198 22:18593999-18594021 AGGAGGGGAACGAGGGGGGATGG - Intergenic
1181052808 22:20245761-20245783 GAGAGTGGAAAGTGGGGTGATGG - Intronic
1181186173 22:21105988-21106010 GAGAGGGGAAGGAGGGGGATAGG - Intergenic
1181712403 22:24698743-24698765 GGGAGGGGAAAAAGGGAGGGAGG - Intergenic
1181901519 22:26160134-26160156 GAGAGAGGAAAGAGGGAGGAAGG + Intergenic
1181958326 22:26604599-26604621 GAGAAGGGAAGGAGGGTTGAGGG + Intronic
1182065434 22:27428278-27428300 AAGAGGGGAAAGGGGCCAGAAGG - Intergenic
1182232502 22:28849459-28849481 GGGAAGGGAAGGAGGGAGGAAGG - Intergenic
1182243178 22:28933784-28933806 GGGAGGGGGAGGAGGGAGGAGGG - Intronic
1182244545 22:28945450-28945472 GAGAGGCCAAGGAGGGTGGATGG + Intronic
1182320540 22:29476042-29476064 GAGAGGGGCAAGAGGAGAGACGG + Intergenic
1182550874 22:31100170-31100192 GAGAGGGAGAAGGGGGCAGAGGG - Intronic
1182818961 22:33196776-33196798 GAGGAGGAAAAGAGGGAGGAGGG + Intronic
1183085378 22:35483693-35483715 GAGGGAAGAAAGAGGGAGGAAGG + Intergenic
1183210065 22:36445632-36445654 GAGGGAGGAAAGAGGAAGGAAGG + Intergenic
1183325338 22:37188313-37188335 GAGGGCGGAGGGAGGGCGGAGGG + Intronic
1183329633 22:37212376-37212398 GAGAGAGGCAGGAGGGAGGAAGG + Intergenic
1183464341 22:37972124-37972146 GAGGGGGGAGAGAGAGAGGAGGG + Intronic
1183464359 22:37972159-37972181 GGGTGGGGAAAGAGGGAGGGAGG + Intronic
1183483047 22:38075337-38075359 GGGAGGGGAGGGAGGGTGGAGGG - Exonic
1183615802 22:38944663-38944685 GAGAGGGGAAGGAGGGCAAAAGG - Intergenic
1183616533 22:38949052-38949074 GAGAGTGGAAAGAGGGCACAGGG - Intergenic
1183619141 22:38962435-38962457 GAGAGTGGAAAGAGGGCACAGGG - Intronic
1183624341 22:38992371-38992393 GAGAGTGGAAAGAGGGCACAGGG - Intronic
1183710573 22:39501169-39501191 GAGCTGGGAAAGAGGCCAGAGGG - Intronic
1183730913 22:39617866-39617888 GAGGGAGGAAAGAGGGAGGGGGG - Intronic
1183773449 22:39946828-39946850 GAGAAGGGAAAGGCTGCGGATGG + Intronic
1183987006 22:41575516-41575538 AAGAGGGGCCTGAGGGCGGAAGG + Exonic
1184035301 22:41915137-41915159 GAGAGAGGAGGGAGGGCGGAAGG + Intergenic
1184117700 22:42431780-42431802 GAGAGCGGGGAGAGGGGGGAGGG - Intronic
1184119048 22:42438481-42438503 GAGAGGGGAGGGAGTGGGGAAGG - Intergenic
1184229952 22:43153017-43153039 GGGAGGGGAGGGAGGGAGGAAGG - Intronic
1184742997 22:46439920-46439942 GTGAGGGGTGGGAGGGCGGACGG - Intronic
1184753433 22:46502367-46502389 GAAAGGGGAAAGGGGAGGGAAGG + Intronic
1185004908 22:48270102-48270124 GAGAGAGGAGAGAGAGGGGAAGG + Intergenic
1185229843 22:49673623-49673645 GAGAGGGGGAAGGGGGAGGGAGG + Intergenic
1185270287 22:49926708-49926730 GGGAGGGGCAAGAGGGGGGGAGG - Intronic
1185279095 22:49962334-49962356 GGGAGGGGAGAGAGGGAGGGAGG - Intronic
1203290071 22_KI270735v1_random:28094-28116 GAGAATGGTAAGAGGGAGGAGGG - Intergenic
949146756 3:710115-710137 GAGAGTGGAGGGAGGGAGGAAGG - Intergenic
949195591 3:1302490-1302512 GAGAGAGAGAAGAGGGAGGAAGG + Intronic
949257484 3:2065633-2065655 GAGAGGCTAAAGTGGGAGGATGG - Intergenic
949457088 3:4250255-4250277 GAAAAGGGAAAGAGGGGGAAAGG + Intronic
949551321 3:5114655-5114677 GAGAGAGGAGAGAGGGGAGAGGG + Intergenic
949879830 3:8652511-8652533 GAGAGAGGAAAGAAAGGGGAAGG + Intronic
950094345 3:10319983-10320005 GAGTGGGGAGAGAGGGAGGGTGG + Intronic
950342805 3:12262386-12262408 GAGACGCCAAGGAGGGCGGATGG + Intergenic
950792881 3:15487558-15487580 GGGAGGAGAAAGAGGGTGTAAGG - Intronic
950848432 3:16038032-16038054 GAGGGTGGAAAGTGGGAGGAGGG - Intergenic
950991021 3:17437671-17437693 GAGAGGGGGCAGAGGAAGGAAGG + Intronic
951194397 3:19807555-19807577 GAGAAGAGAAAGAGGGAGTAGGG + Intergenic
951206864 3:19934487-19934509 GGGAGGGGAGAGAGGGAGAAAGG - Intronic
951216204 3:20027660-20027682 GAGTGGGAAAAGAAGGAGGAAGG + Intergenic
951353423 3:21634313-21634335 GAGAAAGGAAAGAGGAAGGAAGG + Intronic
951774869 3:26298682-26298704 GAAATGGGAAAGAGGACAGAGGG + Intergenic
951786596 3:26426813-26426835 AAGAGTAGAAAGAGGGCGAAGGG + Intergenic
952503910 3:33989896-33989918 CAGAGGGAAAAGAGTGGGGACGG - Intergenic
952590146 3:34942629-34942651 GAGAGAGGAAGGAAGGAGGAAGG - Intergenic
952879324 3:37973522-37973544 CAGCGAGGAAAGAGGGTGGAAGG - Intronic
952971168 3:38651128-38651150 GGGAGGGCAAAGAGGGGGGTGGG + Intergenic
953098866 3:39806704-39806726 GAGAGGGAAGGGAGGGAGGAAGG + Intergenic
953126475 3:40095745-40095767 GGAAAGGGAAAGAGGGAGGAAGG - Intronic
953156241 3:40377100-40377122 GGGAGGGGAGGGAGGGAGGAAGG + Intergenic
953393159 3:42545563-42545585 CAGAGGGGAAAGTGGGCAGGGGG - Intergenic
953744797 3:45566203-45566225 GAGAGAGGAAGGAGGGCTGTGGG - Intronic
954069322 3:48131308-48131330 GAAAGGTGAAGGAGAGCGGAAGG - Intergenic
954387366 3:50251204-50251226 CAGAAGGGCAAGAGGGTGGAGGG - Intronic
954593066 3:51800813-51800835 GAGAGGTGAAGGAGGGAGGGAGG + Intergenic
954674082 3:52306143-52306165 GAGAAGGGAAAGGAGGTGGATGG + Intergenic
954678256 3:52327322-52327344 GGGAGGAGAAAGAGGGAGCATGG + Intronic
954947568 3:54439835-54439857 GGAGGGGGAAAGAGGGCAGACGG - Intronic
955072439 3:55583442-55583464 GAGAGGGGAAGGAGGGAGGGAGG - Intronic
955117638 3:56021714-56021736 GAGTGGGGAAGGTGGGAGGAGGG - Intronic
955137778 3:56237070-56237092 GAGAGAGGAGAGTGGGCAGAAGG - Intronic
955367849 3:58326892-58326914 GAGAGGGGAAGGTAGGCAGATGG - Intergenic
955400947 3:58591211-58591233 GAGAAGGGAAAGGGGGTGGCTGG + Intronic
955660271 3:61291466-61291488 GAGAGTGGAGAGTGGGTGGAGGG + Intergenic
955687332 3:61561158-61561180 GCGAGGGGAAAGGGGGAGGGCGG - Intergenic
955769381 3:62373104-62373126 GAAAGGGGGAAGAAGGGGGAGGG + Intronic
956639112 3:71397957-71397979 GAGTGGGGAAAGAGAGAGAAGGG + Intronic
956971538 3:74532042-74532064 GAGAGAGGAAAGAGGAAGGAAGG + Intergenic
957201853 3:77146278-77146300 GAGGGTGGAGAGAGGGAGGAAGG + Intronic
957211664 3:77266845-77266867 GAGAGAGTAAAGAGGGAGCAAGG - Intronic
957245615 3:77712263-77712285 ATGAGGGGAAAGAGGAGGGAAGG - Intergenic
957409473 3:79819401-79819423 GAGAGGGGAAAGAGGAGAAACGG - Intergenic
957763111 3:84585648-84585670 GAGAGTGGAAGGTGGGAGGAAGG - Intergenic
958070162 3:88599660-88599682 GAGAGGGGAGGGAGGGAGGGAGG - Intergenic
958436129 3:94098096-94098118 GAGAGGGGGAAGAGGCAGGTTGG - Intronic
958727059 3:97918821-97918843 GACAGGGGAAAGAGGGAGCAAGG + Intronic
958870950 3:99558333-99558355 GATGGGGGAAGGAGGGAGGAAGG + Intergenic
959544238 3:107575220-107575242 GAGAGAGGAAAAGGGGAGGACGG - Intronic
960248758 3:115428773-115428795 GGAAGGGGGAAGAGGGAGGAAGG - Intergenic
960255963 3:115511984-115512006 GAGAGGAGAAAGATGGGAGAAGG + Intergenic
960720634 3:120622072-120622094 GAGAGGGGAAAGAGAGAGAAAGG - Intergenic
960747825 3:120908829-120908851 GAGGGGGGAAAGAGGACGCGGGG + Intronic
960822887 3:121752973-121752995 GAAAGGGGAAAGAAGAGGGATGG + Intergenic
961000456 3:123370799-123370821 GAGAGGGCAAAGGGGAGGGAGGG - Intronic
961247957 3:125473179-125473201 GAGCGGGGAGGGAGGGTGGAAGG - Intronic
961340114 3:126212250-126212272 GAGAGAAGAAGGAGGGAGGAAGG + Intergenic
961345276 3:126260080-126260102 GAGAGGGGAAGAATGGAGGAGGG - Intergenic
961347723 3:126274882-126274904 GAGGGAAGAAAGAGGGAGGAAGG - Intergenic
961569041 3:127785185-127785207 GTGTGGGGAAGGAGGGGGGAAGG - Intronic
961994383 3:131226096-131226118 GAGTGGGGAAAGAGGGAGAATGG + Intronic
962072204 3:132044676-132044698 GGGAGGGGAGGGAGGGGGGAGGG + Intronic
962340050 3:134575150-134575172 GGGAGGGGAAGGGGGACGGAGGG - Intergenic
962614151 3:137107754-137107776 GAGAAAGGAAGGAGGGAGGAAGG - Intergenic
962842827 3:139251388-139251410 GAGAGGAGAAAGAGGGGAGGAGG - Intronic
962997006 3:140639880-140639902 GAGGGGGGAGAGTGGGAGGAGGG - Intergenic
963192321 3:142486616-142486638 GAGAGAGAAGAGAGGGAGGAAGG - Intronic
963451301 3:145484376-145484398 GAAAGAGGAAAGAGGGAGGTTGG + Intergenic
963851648 3:150215974-150215996 GAGGGGGAAAGGAGGGAGGATGG + Intergenic
963877923 3:150497612-150497634 AAGAGAGGAAAGAGGAGGGAAGG - Intergenic
964184420 3:153925231-153925253 AGGAAGGGAAAGAGGGAGGAGGG + Intergenic
964368397 3:155973179-155973201 GAGAGGGGATAGAGAGGAGAGGG - Intergenic
964629601 3:158795752-158795774 GGGAGGCCAAGGAGGGCGGATGG - Intronic
965033558 3:163405351-163405373 GAGGGTGGAAAGTGGGAGGAGGG - Intergenic
965211630 3:165797277-165797299 GAGGGAGGAAGGAGGGAGGAAGG - Intronic
965652236 3:170946817-170946839 GAGAGAGGAGAGAGGAGGGAGGG + Intergenic
965652259 3:170946895-170946917 GAGAGAGGAGAGAGGAGGGAGGG + Intergenic
965652274 3:170946938-170946960 GAGAGAGGAGAGAGGGAGGGAGG + Intergenic
965961746 3:174437551-174437573 GAGAGGGGAGAGAAGAAGGAGGG - Intergenic
966060546 3:175749217-175749239 GAGAGGGGGTAGGGGGAGGAGGG + Intronic
966140657 3:176752504-176752526 GAGCGGGGAGGGAGGGAGGAAGG + Intergenic
966181983 3:177196906-177196928 GAGAGAGGAAAACGGGGGGATGG + Intronic
966603813 3:181801698-181801720 GAGTGGGGAGGGAGGGAGGAAGG + Intergenic
967277376 3:187789909-187789931 AAGAGGGGAAGGAGGGAGGGAGG + Intergenic
967337537 3:188361435-188361457 GGGAGGGGAAGGAGGGAGGGAGG - Intronic
967650400 3:191978386-191978408 GAGAGTGGAAGGTGGGAGGAGGG + Intergenic
968339211 3:197941147-197941169 GAGAGAGGAAGGAGGGAGGGAGG - Intronic
968339214 3:197941154-197941176 GAGAGGAGAGAGAGGAAGGAGGG - Intronic
968339260 3:197941323-197941345 CAGAGGGGAGAGAGAGAGGAAGG - Intronic
968339268 3:197941366-197941388 GGGAGGGGAGAGAGGGAGGAAGG - Intronic
968736496 4:2299639-2299661 GGGAGGGGAGGGAGGGAGGAAGG + Intronic
968985380 4:3871878-3871900 GGGAGGGGAAGGACGGCGGCGGG + Intergenic
969051359 4:4375496-4375518 GGGAAGGGAAGGAGGGAGGAAGG - Intronic
969228996 4:5816691-5816713 GGGAGGGGAGAGAGGGGAGAAGG - Intronic
969334364 4:6498928-6498950 GAGAGGAGAGAGAGGGGAGAGGG - Intronic
969376115 4:6764344-6764366 GAGTGGGGAAAGAGAAAGGAAGG + Intergenic
969454864 4:7295074-7295096 GAGAAGGGAGAGGGGGAGGAGGG - Intronic
969467453 4:7366205-7366227 GAAAGGGAAGAGAGGGAGGAAGG - Intronic
969481437 4:7448931-7448953 GAGAGGGAAAAGAGGGAGGGAGG - Intronic
969481452 4:7448983-7449005 GAGAGGGAAAAGAGGAAGGGAGG - Intronic
969481512 4:7449132-7449154 GAGAGGGAAAAGAGGAAGGGAGG - Intronic
969481519 4:7449157-7449179 GAGAGGGAAAAGAGGAAGGGAGG - Intronic
969511056 4:7618226-7618248 GTGAGGGGATAGAGGGGGAATGG - Intronic
969611903 4:8232191-8232213 GAGGGGGCAAAGGGGGCGGCGGG + Intronic
969657678 4:8507535-8507557 GAAAGGGGAAAGAAAGGGGAGGG - Intergenic
969685572 4:8672195-8672217 GAGAGGGGATAAAGGGAGGATGG + Intergenic
970123806 4:12787147-12787169 CAGAGGGTAAGGAGGGAGGATGG - Intergenic
970974359 4:22025852-22025874 GAGAAGGGTAAGAGGGCCAAGGG - Intergenic
971007463 4:22391283-22391305 GAGAGGGGAAATGGGGTGGCAGG - Intronic
971394347 4:26214675-26214697 GAGGGAGGAGAGAGGGAGGAAGG + Intronic
971563103 4:28106268-28106290 GGGAAGGGAAGGAGGGAGGAAGG + Intergenic
971664331 4:29462184-29462206 GAGGGGGGATGGAGGGAGGAGGG + Intergenic
972074093 4:35061632-35061654 GAGGGGGGAGAGAGGGAGGGGGG + Intergenic
972445983 4:39144383-39144405 GAAAGGGGGAGGAGGGTGGAAGG - Intergenic
972491091 4:39587775-39587797 AAGAAAGGAAAGAGGGAGGAAGG + Intronic
972646228 4:40970126-40970148 GAGATGGGGAAGAGGGATGAGGG + Intronic
974020494 4:56688150-56688172 GGGAGGGGGAAGAGGAAGGAAGG + Intergenic
974020529 4:56688258-56688280 GAGAGGGGGAAGAGGAAGGAAGG + Intergenic
974707544 4:65541042-65541064 GAAAGGGGAAGGAGGGAGGGAGG - Intronic
975355202 4:73394335-73394357 GTGAGGGGAAAGAGGACAGCAGG - Intergenic
975603288 4:76125805-76125827 GAGAGGGAGAAGAGGGAGAAAGG + Intronic
975633284 4:76422718-76422740 GAGAGGGAAAAGGAGGGGGAGGG - Intergenic
975754497 4:77559264-77559286 GAGAGGGGAAAGAAGGAGACTGG + Intronic
975816035 4:78217819-78217841 GAGAGGGGAAGGGGAGGGGAGGG - Intronic
975848831 4:78551559-78551581 GAGAGCGAAATGAGGGCGTAGGG + Exonic
976131339 4:81887592-81887614 GAGAGGGGAAGGAGGTGGAAGGG + Intronic
976443722 4:85106612-85106634 AAGTGGGAAAAGAGGGAGGAAGG - Intergenic
976579500 4:86719120-86719142 GAGTGGGGAGAGTGGGAGGAAGG - Intronic
976616788 4:87086409-87086431 GGGAAGGGAAGGAGGACGGATGG - Intronic
976665221 4:87583469-87583491 GAGAGAGAAAAGAGGGGGGAAGG - Intergenic
977290554 4:95160579-95160601 GAGGGAGGAAGGAGGGAGGAAGG - Intergenic
977894678 4:102349770-102349792 GAGATGGGCAAGGGGGAGGAAGG + Intronic
978013672 4:103719089-103719111 CAGAGAGGAAAGAGGGAGAAGGG - Intronic
978297283 4:107220570-107220592 GAGTGGGGAAGGAGGGAGGGAGG + Intronic
978437227 4:108698655-108698677 GAGGGTGGAAAGAGGGCTGAGGG - Intergenic
978499961 4:109399074-109399096 GAGAAGAGAAAGAGGGAGGGAGG + Intergenic
978534389 4:109745672-109745694 GAATAGGGAAAGAGGGAGGAGGG + Intronic
978555335 4:109973571-109973593 AAGAGGGGAAAGAGGGAGAGGGG - Intronic
978689641 4:111491080-111491102 GAGAGGGGAAAGAGGGAGCGAGG - Intergenic
978702329 4:111662629-111662651 GGGAGGGGGAGGAGGGAGGATGG + Intergenic
978967571 4:114760160-114760182 GAGAGGGGGAAGAAGACAGAGGG - Intergenic
979416891 4:120452429-120452451 GAGAGGGAAAAGAAGGAGGAAGG + Intergenic
979853234 4:125599605-125599627 GAGGGGAGAAAAAGGGAGGACGG - Intergenic
980175567 4:129340257-129340279 GAGAGTGGAAGGTGGGAGGAGGG - Intergenic
980351462 4:131690677-131690699 GAGAGTGGAAGGAGAGAGGATGG + Intergenic
980455009 4:133028036-133028058 GAGAGGGGAGGGTGGGAGGAGGG + Intergenic
980969611 4:139556348-139556370 GCGAGGGGCAAGTGGGCGAAGGG - Exonic
981031885 4:140134017-140134039 GAGATGGGAGAGATGGCAGAAGG - Intronic
981198812 4:141953425-141953447 AAGAGGTGAAAGAGGGGGAAGGG + Intergenic
981280938 4:142957799-142957821 CAGAGGAGATGGAGGGCGGATGG - Intergenic
981413373 4:144458875-144458897 AAGAAGGGAAGGAGGGAGGAAGG + Intergenic
981486135 4:145288509-145288531 GAGAGGGGAACTAGGGAGAAGGG - Intergenic
981646197 4:147001519-147001541 GACAGGAGAGAGAGGGCGCAGGG + Intergenic
981814006 4:148807660-148807682 GGAAGGGGAAGGAGGGTGGAAGG + Intergenic
981955684 4:150470293-150470315 GCAAGGTGAAAGAGGGAGGAAGG - Intronic
982415260 4:155123885-155123907 GAGAGGAGATAGAGGATGGATGG - Intergenic
982481018 4:155909940-155909962 GAGAAGAGAAAGGGGGGGGAGGG - Intronic
983268010 4:165528120-165528142 GAGAGTGGATAGTGGGAGGAGGG - Intergenic
983387414 4:167082798-167082820 GAGAGAGGACAGAGGGAGGGAGG + Intronic
984456641 4:179977521-179977543 GAGAGGGGAGAGAGAGGAGAAGG - Intergenic
984637171 4:182123965-182123987 GAGATGGGAAAGACTGCAGAAGG + Intergenic
984736666 4:183115016-183115038 GAGAGTGGAAGGTGGGAGGAGGG - Intronic
984810476 4:183791913-183791935 GGGAGGGGAAAGAGAGGGAAAGG + Intergenic
985036617 4:185846811-185846833 GAGAGGGGGAAGGGGGAGAATGG + Intronic
985047811 4:185957990-185958012 GAGTGGGGAAAGAAGGCCCAGGG - Intergenic
985117277 4:186604817-186604839 GTGAGGAGGAAGAGGGAGGAGGG + Intronic
985283501 4:188310454-188310476 GAGAGGCCAAAGAAGGAGGATGG - Intergenic
985324145 4:188748704-188748726 GAGGGGGGAAGGTGGGAGGAGGG - Intergenic
985516806 5:350536-350558 GAGATGGGAGAGATGGCCGAAGG - Intronic
985552597 5:541188-541210 GAGATGGCAAGGAGGGCGGTGGG - Intergenic
985658131 5:1142495-1142517 GAGAGGGGAGAGAGGGGAGTGGG - Intergenic
985851636 5:2392670-2392692 AAGAGAGGAAGGAGGGAGGAAGG - Intergenic
985993769 5:3584893-3584915 GAGAAAGGAAGGAGGGAGGAGGG + Intergenic
985993812 5:3585064-3585086 GAGGAGGAAAAGAGGGAGGAGGG + Intergenic
986313378 5:6571142-6571164 AGGAAGGGAAAGAGGGAGGAGGG + Intergenic
986313391 5:6571177-6571199 AGGAAGGGAAAGAGGGAGGAGGG + Intergenic
986313415 5:6571247-6571269 AGGAAGGGAAAGAGGGAGGAGGG + Intergenic
986313470 5:6571414-6571436 AGGAAGGGAAAGAGGGAGGAGGG + Intergenic
986313483 5:6571449-6571471 AGGAAGGGAAAGAGGGAGGAGGG + Intergenic
986313496 5:6571484-6571506 AGGAAGGGAAAGAGGGAGGAGGG + Intergenic
986313520 5:6571554-6571576 AGGAAGGGAAAGAGGGAGGAGGG + Intergenic
986313548 5:6571633-6571655 AGGAAGGGAAAGAGGGAGGAGGG + Intergenic
986313561 5:6571668-6571690 AGGAAGGGAAAGAGGGAGGAGGG + Intergenic
986313574 5:6571703-6571725 AGGAAGGGAAAGAGGGAGGAGGG + Intergenic
986490724 5:8286905-8286927 GAGAGGGAGGAGAGGGAGGAAGG - Intergenic
986530102 5:8726995-8727017 GGGAGGGGAGGGAGGGAGGAAGG + Intergenic
986561010 5:9060960-9060982 GAGATGGGAAATTGGGAGGAAGG - Intronic
987034250 5:14004364-14004386 GAGAGGGGAAAGAAGGTAAAAGG + Intergenic
987335044 5:16891384-16891406 GAGAGAGGAAGGAGGAAGGAGGG + Intronic
987439851 5:17942432-17942454 GAGAGGAGAAAGAGATAGGAGGG + Intergenic
987447880 5:18043695-18043717 GGGAGGGGAAAGAGAAGGGAAGG - Intergenic
987608785 5:20175218-20175240 GAGAGAGGAAAGAGAGCAGGAGG + Intronic
988011963 5:25500438-25500460 TAGAGGGGAGAGAGGGAAGAAGG - Intergenic
988101101 5:26680005-26680027 AAGAGGAGAAAGAGGGAGGGAGG - Intergenic
988943903 5:36174906-36174928 GAGAGGAGAAAGATGGCCAAGGG + Intronic
989077197 5:37576121-37576143 GAGGGGGGAAGGAGGGCGGAGGG - Intronic
989395361 5:40950194-40950216 GAGAGTGGAGAGTGGGAGGAGGG - Intronic
989612295 5:43306297-43306319 GAAAGGGGAAAAAAGGGGGAGGG + Intronic
989665210 5:43846250-43846272 AGGAGGGGAAAGAGGGAGGGAGG - Intergenic
989987619 5:50720427-50720449 GCGAGCTGAAAGAGGGCTGAGGG - Intronic
990159084 5:52916626-52916648 TAGAGGGGAAAGAAGACTGAAGG + Intronic
990336966 5:54783844-54783866 GAGGGGGGAGAGTGGGAGGAGGG + Intergenic
990500838 5:56395628-56395650 GAGAGGGAAAGGTGGGAGGAGGG + Intergenic
990574515 5:57111592-57111614 TTGAGGGGGAAGAGGGCGGACGG - Intergenic
990744897 5:58949959-58949981 GAGTGGGGTAAGAGGGAGGGTGG - Intergenic
991092899 5:62710085-62710107 GAGGAGGGAGAGAGGGAGGAAGG - Intergenic
991371653 5:65925854-65925876 GCGAGGGGAGGGAGGACGGAGGG - Intergenic
991506508 5:67329510-67329532 GATAGGGGATAGAGGGAGAAAGG - Intergenic
991733893 5:69614205-69614227 GAGAGAGGAGAGAGGGAAGAGGG - Intergenic
991734078 5:69615717-69615739 GAGAGAGGAGAGAGGGGAGAGGG + Intergenic
991810327 5:70469346-70469368 GAGAGAGGAGAGAGGGAAGAGGG - Intergenic
991810512 5:70470858-70470880 GAGAGAGGAGAGAGGGGAGAGGG + Intergenic
991860189 5:71006425-71006447 GAGAGAGGAGAGAGGGGAGAGGG - Intronic
991860373 5:71007937-71007959 GAGAGAGGAGAGAGGGAAGAGGG + Intronic
992020558 5:72619720-72619742 GAGAAGTGAAAGAAGGCAGAGGG + Intergenic
992275975 5:75119244-75119266 GGTAGGGGAGAGAGGGAGGACGG - Intronic
992566373 5:77998893-77998915 GAGAGGGGAAAGAGAAGTGAGGG + Intergenic
992648546 5:78834971-78834993 GAGAGTGGAAAAAGGAAGGAAGG - Intronic
992737796 5:79741115-79741137 GGGAGGCCAAAGAGGGAGGATGG - Intronic
992809663 5:80374027-80374049 GAGAGTGGAAGGTGGGAGGAGGG - Intergenic
992895265 5:81240032-81240054 GGGAGGGGAAAGAGGGGGTGAGG - Intronic
993696802 5:91071141-91071163 GAGAAGGGAGAGGGGGTGGAGGG + Intronic
993735066 5:91466507-91466529 AAGAAGGGAAAAAGGGAGGAAGG - Intergenic
994013445 5:94936889-94936911 GAGAGGGGAGAAAGGAGGGAGGG - Intronic
994790400 5:104218424-104218446 GAGAGGGGAAAGAAGGGGAGGGG - Intergenic
994869691 5:105331647-105331669 GAGGGAGGAAAGAGGAGGGAGGG + Intergenic
994945071 5:106377213-106377235 GAGAGAGGAAGGAGGGAGGGAGG - Intergenic
995039417 5:107571137-107571159 GAGTGGGGGAAGAGGGCTTAGGG + Intronic
995129038 5:108610349-108610371 GAGAGAGGAATGAGGGAGAAAGG + Intergenic
995354638 5:111224143-111224165 GAGAAAGGAAAGAGGGAGGGCGG + Exonic
995710624 5:115031820-115031842 GAGAGAGGGAAGGGGACGGAAGG + Intergenic
996262240 5:121486363-121486385 GAGAGGAGAGAGTGGGAGGAGGG + Intergenic
996541003 5:124629974-124629996 GAGAGTGGAGAGAGGGCCAAAGG + Intergenic
996871955 5:128201787-128201809 GCGAGGGGAAAGAGCGGGGAAGG + Intergenic
996888241 5:128385202-128385224 GAGAGTGGAAGGTGGGAGGAGGG - Intronic
997649830 5:135508152-135508174 AAGAGGGGAAGGAGGGCGGGAGG + Intergenic
997670893 5:135671151-135671173 GAGAGTGGAATAAGGGCCGAAGG + Intergenic
997963263 5:138338367-138338389 GGGAGGGGAAAGAGGGAAGGAGG - Intronic
997969144 5:138386077-138386099 TAGAGGGGAAAGATGGCCGGAGG + Exonic
998164570 5:139835696-139835718 GAGAGGGAAAAGAGAGAGGGGGG - Intronic
998779357 5:145639355-145639377 GAGAAGGGCAAGAGGGTGGGTGG + Intronic
998804058 5:145901146-145901168 GAGGGGGGAAGGAGGGAGGGGGG + Intergenic
998823124 5:146074758-146074780 GAGAGAGGGCAGAGGGCTGAAGG - Intronic
999023774 5:148201573-148201595 TAGAATGGAAAGAGGGAGGAAGG + Intergenic
999090482 5:148931810-148931832 GAGAAGGGAAAGAGGAGAGAGGG - Intronic
999264529 5:150257670-150257692 GGGAGGGGAGAGAGGGAGGGCGG - Intronic
999284395 5:150385627-150385649 GAGTGGGGAGAGGGGGCTGATGG - Intronic
999872329 5:155765416-155765438 AGGAAGGGAAAGAGGGAGGAGGG + Intergenic
1000136846 5:158361403-158361425 GAGAGGGGAAGGAAGGAGAAAGG - Intergenic
1000428067 5:161116047-161116069 AATAAGGGAAAGAGGGAGGAAGG + Intergenic
1000698184 5:164415596-164415618 GAGAGGGGAGGGTGGGAGGAGGG - Intergenic
1000731416 5:164838734-164838756 GAGAGGAAAATGAAGGCGGAAGG - Intergenic
1000903728 5:166937717-166937739 GAGAGGGGAAGGAGGAAAGAAGG + Intergenic
1001199243 5:169700851-169700873 GAGAGGGGAGAGAGGGCGGCGGG + Intronic
1001435781 5:171698253-171698275 GAGAGGGGAAAGAGGAATGAAGG + Intergenic
1001709986 5:173770816-173770838 GAGAGGAGAGAGAGAGGGGAGGG + Intergenic
1002102327 5:176863719-176863741 GAGGGGGAAAAGGGGGAGGAGGG - Intronic
1002166625 5:177351634-177351656 GAGAGGAGAATGGCGGCGGAAGG - Exonic
1002255430 5:177954769-177954791 GAGGGGGGAGGGAGGGAGGAGGG + Intergenic
1002338325 5:178495659-178495681 GAGAGTGGGAAGGGGGAGGAAGG + Intronic
1002643999 5:180644270-180644292 GTGAGCGGAAAGAGGGCACAGGG + Intronic
1003094765 6:3133533-3133555 GGGAGGGGAAAGTGGGGGGAGGG - Intronic
1003336991 6:5183061-5183083 GAGAGAGGAAAGTGGGGTGAAGG - Intronic
1003481830 6:6541733-6541755 AAGACGGGAAAGAGGGAAGAGGG - Intergenic
1003712155 6:8603917-8603939 GAGGGAGGAAAGAGGAAGGAAGG - Intergenic
1004015425 6:11727900-11727922 GAGAGGGGAAAGAAGAAGGAAGG + Intronic
1004114049 6:12749589-12749611 GAGAGGCGGAAGGGGGAGGAGGG - Intronic
1004256507 6:14069286-14069308 GAGTGGGGAGAGAGAGAGGACGG + Intergenic
1004335585 6:14761660-14761682 GAGGGGGGAAGGTGGGAGGAGGG + Intergenic
1004632211 6:17432948-17432970 GAGGGGGGAGAGAGGGAGGGAGG - Intronic
1005159596 6:22843595-22843617 CAGAGGGCAAAGAGGAAGGAGGG - Intergenic
1005429719 6:25742418-25742440 GAGAGGTCAAGGAGGGAGGATGG + Intergenic
1005742321 6:28803584-28803606 GGAAGGAGAAAGAGGGAGGAAGG + Intergenic
1005926222 6:30447864-30447886 GGGTGGGGAAACAGGGAGGAAGG + Intergenic
1005958821 6:30682546-30682568 GACAGGGGGTAGAGGGTGGAGGG + Intronic
1006095685 6:31655178-31655200 GAGAGGCCAAGGTGGGCGGATGG - Intronic
1006187711 6:32190182-32190204 GAGAGAGGGAGGAGGGAGGAGGG + Exonic
1006207000 6:32355383-32355405 GAGAGGGAAAAAAGGGAGGGAGG - Intronic
1006245080 6:32726437-32726459 GAGAAGGGAATGAGGGCAGAAGG + Intergenic
1006263171 6:32894167-32894189 AAGAGGGGAAAGAGGGGGAAGGG - Intergenic
1006528029 6:34625171-34625193 AAGAGGGGAAGGGGGGAGGAGGG - Intronic
1006654892 6:35582471-35582493 GTGAGTGGAGAGAGGGCAGAGGG - Intronic
1006793224 6:36716969-36716991 GAGAGAAGAGAGAGGGCAGATGG + Intronic
1006803582 6:36774698-36774720 CAGAGGGGAAAGAGGTGGGGCGG + Intronic
1006809228 6:36809207-36809229 GAGAGGAGAGAGAGAGAGGAAGG + Intronic
1006814158 6:36839531-36839553 GAGAGAGGGAAGAGGGCGGAGGG + Exonic
1006888205 6:37400052-37400074 GAGAAGGGAAGGAGGGAGGGAGG - Intergenic
1007073932 6:39054839-39054861 GAGAAGGGAAACGGGGCGGTGGG + Intronic
1007219721 6:40268984-40269006 GCCAGGGGATAGAGGGTGGAGGG + Intergenic
1007407547 6:41643663-41643685 GAGAGAGAAAGGAGGGAGGAAGG + Intronic
1007431597 6:41780169-41780191 GGGAGCGGAAAGGGGACGGAGGG + Intronic
1007708538 6:43806411-43806433 GAGAGGAGTCAGAGGGAGGAAGG + Intergenic
1007817374 6:44534181-44534203 GACAAGGGAAAGTGGGCAGAGGG + Intergenic
1007840034 6:44708596-44708618 GAGGTAGGTAAGAGGGCGGAGGG - Intergenic
1007899831 6:45400239-45400261 GAGGGGAGACAGAGGGAGGAAGG + Intronic
1007924932 6:45643061-45643083 GGGAGGGGAGAGAGGAGGGAAGG - Intronic
1007941378 6:45784834-45784856 GATAGGAGAAAGAAGGAGGAAGG - Intergenic
1008413012 6:51205291-51205313 GACAAAGGAAAGAGGGGGGAGGG - Intergenic
1008504160 6:52212794-52212816 CAGAGGGGAAAGCGGGAGTAGGG + Intergenic
1008730442 6:54475692-54475714 GAAAGGGGAAAGTGGGAGGGAGG + Intergenic
1008965889 6:57312056-57312078 GAGAGGGGAGAGGGGGGAGAGGG + Intergenic
1009284429 6:61798010-61798032 GAGAGGAGAAGGTGGGAGGAGGG - Intronic
1009328183 6:62380362-62380384 CAAAGGGGAAAGAGGGATGATGG + Intergenic
1009815542 6:68729165-68729187 GAGAAGGGCAACAGGGCAGAGGG - Intronic
1009829860 6:68916382-68916404 GAGAGAGGAGAGAGAGGGGAAGG - Intronic
1010704367 6:79090021-79090043 GAGGGGGGAAGAAGGGAGGAAGG - Intergenic
1010923362 6:81712366-81712388 GAGAGTGGAAGGTGGGAGGAGGG + Intronic
1010950623 6:82032999-82033021 GTGAGGGGAAAGAGGTGGGAAGG + Intergenic
1011251210 6:85374191-85374213 GAGAGGGGGAATAGGGAGGAGGG + Intergenic
1011275944 6:85631407-85631429 GAGTGGGGAAAGAGGTAAGAAGG + Intronic
1011362620 6:86544066-86544088 GAGAGGGGAGGGAGGGAGGGAGG + Intergenic
1011446185 6:87443766-87443788 GAGTGGGGAGAGAGAGAGGAGGG - Intronic
1011632362 6:89339597-89339619 GAGGGGGGAAGGAGAGGGGAGGG + Intronic
1011656297 6:89555085-89555107 GAGGGGGGAGAGAGGGGGGAGGG - Intronic
1011693198 6:89888145-89888167 GAGAGGGGAAGGGGAGGGGAGGG + Intergenic
1011717041 6:90117343-90117365 GAGAGAGGGAAGAGGGAAGAAGG - Intronic
1011732127 6:90275645-90275667 GAGAGTGGAGAGTGGGAGGAGGG - Intronic
1011854325 6:91669761-91669783 CAGTGGGGAAAGAGAGGGGAGGG + Intergenic
1012085581 6:94822296-94822318 AAGGGGGGAAAGAGGGGGGAAGG - Intergenic
1012250544 6:96975578-96975600 GAGAGGGGACAGAGTGGGAAGGG + Intronic
1012356295 6:98318248-98318270 GAGAGTGGAGAGTGGGAGGAGGG - Intergenic
1013537250 6:111074701-111074723 GAGAGAGGAAGGAGGTAGGATGG + Intergenic
1013590849 6:111618665-111618687 GAAAGGGGAAGGAGAGAGGAAGG - Intergenic
1013682110 6:112535835-112535857 GAGGGTGGAAAGTGGGAGGAGGG - Intergenic
1013685596 6:112577839-112577861 GAGAGGGGAGAGAGAGGAGAAGG + Intergenic
1014054477 6:116997825-116997847 TGGAGGGGAAAGAGGGAGGTAGG - Intergenic
1014629109 6:123767526-123767548 GAGAGGTCAAAGAAGGAGGATGG + Intergenic
1014664292 6:124217223-124217245 GAGAGGGGGAAGAGTGAGGTAGG + Intronic
1014684398 6:124477781-124477803 GGGAAGGGGAAGAGGGAGGAGGG - Intronic
1015093327 6:129385141-129385163 GGGAGGGGAGGGAGGGAGGAAGG + Intronic
1015326756 6:131932218-131932240 TAGAGGAGCAAGAGGGAGGAGGG - Intergenic
1015567453 6:134588074-134588096 GAGAGGGAAGGGAGGGAGGAAGG + Intergenic
1015591461 6:134826701-134826723 GAAGGGGGAAAGAGGGGGGAGGG + Intergenic
1015697595 6:135998877-135998899 GAGAGAGGAAAGAAGGAGGAGGG + Intronic
1015821954 6:137270917-137270939 GAGGGGGGAAGGTGGGAGGAGGG + Intergenic
1015823059 6:137283338-137283360 GAGAGGGGACAGGGTGGGGAGGG - Intergenic
1015973202 6:138763206-138763228 GGGAGAGGAAAGAGGGTAGAAGG + Intronic
1016091580 6:139985683-139985705 GAGAGAGGAAGGAGGGAGGGAGG - Intergenic
1016614196 6:146028185-146028207 GTGATGAGAATGAGGGCGGAGGG + Intronic
1016772823 6:147870821-147870843 GGGAGGGGAGGGAGGGAGGAAGG + Intergenic
1017054834 6:150427410-150427432 GGGAGGGGAATGAGGAAGGATGG + Intergenic
1017068279 6:150549815-150549837 TAGAGTGGAGAGAGGGAGGAAGG + Intergenic
1017081660 6:150675223-150675245 GAGAGGGGACTGAAGGGGGAAGG - Intronic
1017238258 6:152139605-152139627 GAGGGGGGAGAGAGGAAGGAAGG + Intronic
1017293255 6:152765634-152765656 GAGAGGGGAAGGAGAGGGGAGGG - Intergenic
1017332750 6:153218493-153218515 GAGAAGGGAAAGGGAGAGGAGGG - Intergenic
1017466353 6:154697268-154697290 GAGTGGGGAAAGGGGGCCCAAGG + Intergenic
1017869846 6:158478098-158478120 GAGAGTGGGAGGAGGGAGGAGGG + Intronic
1017894483 6:158667468-158667490 GAGAGAGGACAGAGGGCTGCGGG - Intronic
1017914119 6:158818830-158818852 GAGAGGGGGCACAGGGCGGGCGG + Intronic
1017931910 6:158963402-158963424 GAAGGGGGAAGGAGGGGGGAGGG - Intergenic
1018128595 6:160706161-160706183 GAGAAGGGAGAGAGGGAGCAAGG - Intronic
1018136470 6:160782820-160782842 GAGCCGGGAGAGAGGGAGGAAGG - Intergenic
1018208025 6:161453775-161453797 GAGAGGGGAAGGGGAGGGGAGGG - Intronic
1018298273 6:162372558-162372580 GAGAGGGGAGTGAGGGAGGAGGG + Intronic
1018839761 6:167508706-167508728 GAGAGGGGACAGGGGAAGGAAGG - Intergenic
1018956746 6:168415506-168415528 GAAGGGGGAATGAGGGTGGAGGG + Intergenic
1019266751 7:121486-121508 AAGATGGGAAAGAGGGAGGGAGG + Intergenic
1019327608 7:446008-446030 GAGGAGGGAGAGAGGGAGGAGGG + Intergenic
1019519902 7:1455872-1455894 GAGAGGGGAATGAGGTGGCAAGG + Intronic
1019664788 7:2246403-2246425 GAGTGTGGAAGGAGGGAGGAAGG + Intronic
1019806465 7:3129933-3129955 GTGAGGGGAAGGAGGGAGGGAGG + Intergenic
1019830296 7:3321737-3321759 GGGAGGGGAAGGAGGGGGGAGGG - Intronic
1019920035 7:4157514-4157536 GAGCGGGGAGGGAGGGAGGAAGG + Intronic
1019928657 7:4209273-4209295 GGGAGGGCAGAGAGGGAGGAGGG + Intronic
1019935019 7:4249124-4249146 GATAGGGGAAGAAGGGTGGAGGG + Intronic
1019964095 7:4484759-4484781 GAGAGGAGGAAGAGTGAGGAGGG + Intergenic
1019964111 7:4484826-4484848 GAGAGGAGGAAGAGAGAGGAAGG + Intergenic
1019987748 7:4670192-4670214 GAGAGGGGAGAGAGGGGCGGGGG - Intergenic
1019995966 7:4724781-4724803 CAGAGGGGAGAGAGGAGGGAGGG + Intronic
1020029133 7:4920674-4920696 GAGGGAGGAGAGAGGGAGGAGGG - Intronic
1020307130 7:6843912-6843934 GAGAGGGAAAAGATGGCAGCCGG - Intergenic
1020430430 7:8112128-8112150 GAGATGGGAGAGAGGCAGGAAGG + Intergenic
1020531229 7:9338482-9338504 GAGAGGGAAAAGAAGGAGGTTGG + Intergenic
1020689342 7:11335467-11335489 GAGAGTGGAAAGTGGGAGGAGGG + Intergenic
1020752727 7:12163509-12163531 GAGAGTGGATAGTGGGCGGAGGG - Intergenic
1021352976 7:19617752-19617774 GAGAGAGGAGAGAGGGAGGAAGG - Intergenic
1021423391 7:20471101-20471123 GAGAAAGGAAAGAGGAAGGAAGG - Intergenic
1021494360 7:21258071-21258093 GAGAATGGAAAGGGGGAGGAAGG + Intergenic
1021499707 7:21319046-21319068 GAGAGGGGAAATGGGGTGGAGGG - Intergenic
1021579086 7:22133254-22133276 GAGAGGGGAGACAGGCTGGAAGG + Intronic
1021874579 7:25036636-25036658 GAGAGGGCAAGGAGAGCAGAGGG + Intergenic
1021889932 7:25177950-25177972 GAGGGTGGAGAGAGGGAGGAAGG - Intronic
1021948563 7:25752541-25752563 TAGAGTGGAAATAGGGCGGAGGG - Intergenic
1022037161 7:26545387-26545409 TAGAGGGAAAAGTGGGCAGATGG + Intergenic
1022291228 7:29005597-29005619 GAAAGGGGAGAGAGGGTGGAGGG - Intronic
1022370865 7:29770114-29770136 GAGAGGGAAAAGAAGGAGGGAGG - Intergenic
1022756678 7:33300229-33300251 GAGACTGGAGAGAGGGAGGAAGG - Intronic
1023128398 7:36977711-36977733 TAGAGGGGAAGGAGGGCGGAAGG + Intronic
1023236538 7:38095846-38095868 GGGAGGGGAGAGAGGGAGGGAGG + Intergenic
1023320473 7:38991920-38991942 GAGAAGGGAAGGAGGGGGTATGG - Intronic
1023820477 7:43977759-43977781 GAAAGAGGAAAGAGGAAGGAAGG - Intergenic
1023913074 7:44569091-44569113 GGGAGGGGAATGAGAGGGGAGGG - Intronic
1024168259 7:46756739-46756761 GAGAAGGGAGAGAAGGAGGAAGG + Intronic
1024377398 7:48655477-48655499 GAGAGTGGAGACAGGGTGGAAGG + Intergenic
1024391413 7:48816947-48816969 GAGTGGGGACAGAGGGATGAAGG + Intergenic
1024471335 7:49770877-49770899 GGGAAGGGAAAAAGGGGGGATGG + Intergenic
1024805260 7:53132039-53132061 GAGAATGGAAAAAGGGAGGAAGG - Intergenic
1024920049 7:54545915-54545937 GAGAGAGGTAAGAGGGGGGAAGG + Intronic
1024959715 7:54961187-54961209 GAGAGAGGACAGAGGGAGGGAGG + Intergenic
1025709024 7:63890868-63890890 GAGAGGAGGAGGAGGGCTGAAGG + Intergenic
1025997889 7:66539605-66539627 TAAAGGGGAAAGAGGGGGGCTGG + Intergenic
1026112077 7:67466396-67466418 GGGAGGGGAGAGAGGGAGGAAGG - Intergenic
1026308767 7:69166144-69166166 AAGAGGGGAAAGGGGGGGGAAGG + Intergenic
1026488829 7:70845627-70845649 GAGAGAGGAAACGGGGGGGAGGG + Intergenic
1026630260 7:72031984-72032006 GGGAGGTGGAGGAGGGCGGACGG - Intronic
1026672841 7:72404654-72404676 GAGAGTAGAAAGAGGGCAGAGGG - Intronic
1026762566 7:73137768-73137790 GGGAGGGGAAGGAGAGGGGAAGG + Intergenic
1026762572 7:73137779-73137801 GAGAGGGGAAGGGGAGGGGAAGG + Intergenic
1026762608 7:73137878-73137900 GGGAGGGGAAGGAGAGGGGAAGG + Intergenic
1026762614 7:73137889-73137911 GAGAGGGGAAGGGGAGGGGAAGG + Intergenic
1026846270 7:73700634-73700656 GAGAAGGGAGAGAGGTGGGATGG + Intronic
1026874771 7:73872894-73872916 GAGAGAGAAAGGAGGGAGGAAGG - Intergenic
1027039029 7:74947544-74947566 GGGAGGGGAAGGAGAGGGGAAGG + Intergenic
1027039035 7:74947555-74947577 GAGAGGGGAAGGGGAGGGGAAGG + Intergenic
1027039071 7:74947654-74947676 GGGAGGGGAAGGAGAGGGGAAGG + Intergenic
1027039077 7:74947665-74947687 GAGAGGGGAAGGGGAGGGGAAGG + Intergenic
1027039081 7:74947676-74947698 GGGAGGGGAAGGAGAGGGGAAGG + Intergenic
1027039087 7:74947687-74947709 GAGAGGGGAAGGGGAGGGGAAGG + Intergenic
1027084564 7:75254701-75254723 GAGAGGGGAAGGGGAGGGGAAGG - Intergenic
1027084570 7:75254712-75254734 GGGAGGGGAAGGAGAGGGGAAGG - Intergenic
1027084574 7:75254723-75254745 GAGAGGGGAAGGGGAGGGGAAGG - Intergenic
1027084580 7:75254734-75254756 GGGAGGGGAAGGAGAGGGGAAGG - Intergenic
1027084600 7:75254789-75254811 GAGAGGGGAAGGGGAGGGGAAGG - Intergenic
1027084606 7:75254800-75254822 GGGAGGGGAAGGAGAGGGGAAGG - Intergenic
1027084642 7:75254899-75254921 GAGAGGGGAAGGGGAGGGGAAGG - Intergenic
1027084648 7:75254910-75254932 GGGAGGGGAAGGAGAGGGGAAGG - Intergenic
1027084652 7:75254921-75254943 GAGAGGGGAAGGGGAGGGGAAGG - Intergenic
1027084658 7:75254932-75254954 GGGAGGGGAAGGAGAGGGGAAGG - Intergenic
1028246664 7:88487324-88487346 GAGAGAGAAAAGAAGGCGGGGGG + Intergenic
1028248798 7:88515124-88515146 GAGAGGAGAAAGAAGGGAGACGG + Intergenic
1028316085 7:89404921-89404943 GAAAGGGGAGAGAGGGAGGGAGG + Intergenic
1028428760 7:90722126-90722148 AAGAGGGGTAAGAGGGGAGAAGG - Intronic
1029311952 7:99675662-99675684 GAGAGAGGAAGGAGAGGGGAGGG - Intronic
1029379538 7:100203998-100204020 CTGAGGGGAAAGAGTGGGGAAGG - Intronic
1029412782 7:100426667-100426689 GAGGGAGGGAAGAGGGAGGAAGG - Intronic
1029412912 7:100427018-100427040 GAAAGGGGAGGGAGGGAGGAGGG - Intronic
1029584776 7:101463512-101463534 AAGAGGGGGAAGAGGGGGGAAGG - Intronic
1029628868 7:101737809-101737831 AGGAAGGGAAAGAGGGAGGAGGG + Intergenic
1029873451 7:103721195-103721217 GAGGAAGGAAAGAGGGAGGAAGG - Intronic
1029919158 7:104244082-104244104 GAGAGGGGAGAAAGGGAAGAGGG - Intergenic
1029922928 7:104285435-104285457 GAGAGGAGAAAGATGACTGAGGG - Intergenic
1030166749 7:106562945-106562967 GGGAGGGGAGAGAGGGGGGAGGG + Intergenic
1030174345 7:106636014-106636036 GAGAGGGAAAAGAGGAAGGAAGG + Intergenic
1030235654 7:107258834-107258856 GAGACGGGAAGGAGGGGGAAAGG + Intronic
1030305727 7:108017402-108017424 GAGAGAAGAAACAGGGTGGAGGG + Intergenic
1030365524 7:108641548-108641570 GGGAAGGGAAAGAGGAAGGAAGG - Intergenic
1030547654 7:110917685-110917707 GAGACGGGAAACAAGGTGGACGG + Intronic
1030583093 7:111384289-111384311 GAGAGGAGAAAGGAGGAGGAGGG + Intronic
1030593447 7:111508544-111508566 GAGAGGGCACAGAGGGTGGGAGG + Intronic
1031140758 7:117940496-117940518 GAAAAGGGAAAGAGGGCGACTGG + Intergenic
1031422836 7:121569829-121569851 GAGTGGGGAAAGAGGTTGGAGGG - Intergenic
1031562837 7:123258749-123258771 GAGAGGAGAATGAGGGAAGAAGG + Intergenic
1031584650 7:123519642-123519664 GAGAAGGGCAGGAGGGAGGAAGG + Intronic
1031866031 7:127039755-127039777 GAGAAGGGTAAGAGAGGGGAAGG + Intronic
1032058293 7:128701419-128701441 GAGAGGGGAAGGGGAGGGGAGGG + Intergenic
1032477866 7:132224663-132224685 CAGAGGGGAAAGTGGAGGGAGGG + Intronic
1032746304 7:134790110-134790132 GAGAGGACAGAGAGGGAGGAAGG + Intronic
1032838724 7:135697331-135697353 TAGAGGGGAAAGAGGAAGTATGG - Intronic
1033130281 7:138740124-138740146 GAGAGGGGACAGAAGGGGAAAGG + Intronic
1033969806 7:147025393-147025415 GGGAGGGGGAAGAAGGGGGAGGG + Intronic
1034233375 7:149549874-149549896 GAGAGCTGAAAAAGGACGGAGGG - Intergenic
1034263637 7:149771786-149771808 CGCAGGGGAGAGAGGGCGGAAGG - Intronic
1034318451 7:150156567-150156589 GAGAGGAGAAAGAGAGGAGAGGG + Intergenic
1034488170 7:151379206-151379228 GAGAGAAGAATGGGGGCGGATGG + Intronic
1034612178 7:152380791-152380813 GAGAGTGGAAAAAGGAAGGAGGG + Intronic
1034662645 7:152785441-152785463 GGGAGGGGGGAGAGGGGGGAGGG + Intronic
1034732552 7:153400553-153400575 TAGAGGGGAGAGAAGGAGGAAGG + Intergenic
1034757391 7:153635534-153635556 GAGGGGGGAGGGAGGGGGGAGGG - Intergenic
1034928516 7:155142097-155142119 GAGAGGGAGAAGAGGGAGGGAGG - Intergenic
1034967499 7:155400243-155400265 GAGTGGGAAATGAGAGCGGATGG + Intergenic
1034985261 7:155509467-155509489 GAGAGAGGAGAGAGAGAGGAGGG + Intronic
1035070415 7:156140572-156140594 GAGAGGAGAAAGAGGCAGGTGGG + Intergenic
1035117828 7:156539736-156539758 GGGAGGGGAGAGAGAGGGGAGGG - Intergenic
1035357392 7:158284680-158284702 TAGAGGGGACAGAGGTGGGATGG - Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035435841 7:158858803-158858825 GGGAGAGGAAAGTGGGGGGAGGG - Intronic
1035714577 8:1744219-1744241 GAGAGGGGAGAGCCAGCGGAAGG + Intergenic
1035724572 8:1816696-1816718 GTGAGGTCCAAGAGGGCGGATGG + Intergenic
1035732058 8:1860318-1860340 GAGAGGAGGAGGAGGGGGGAAGG - Intronic
1035732080 8:1860385-1860407 GAGAGGAGGAGGAGGGGGGAAGG - Intronic
1035776256 8:2191160-2191182 GAGGAGGGAAGGAGGGAGGAAGG - Intergenic
1035776272 8:2191205-2191227 GGGAGGGGAAAGGGAGGGGAGGG - Intergenic
1035776391 8:2191486-2191508 GGGAGGGGGAAGGGGGGGGAAGG - Intergenic
1035776460 8:2191622-2191644 GGGAGGGGGAAGGGGGGGGAAGG - Intergenic
1035776511 8:2191717-2191739 GGGAGGGGGAAGGGGGGGGAAGG - Intergenic
1035994883 8:4534579-4534601 GAATGGGGAAAGAGGGAGGAGGG - Intronic
1036130424 8:6104309-6104331 GAGAGGGGAGGGGGGGGGGAAGG + Intergenic
1036402322 8:8420391-8420413 GAGAAGGGAGGGAGGGAGGAAGG + Intergenic
1036405396 8:8450388-8450410 GAGAGGCCAAGGCGGGCGGATGG + Intergenic
1036541461 8:9716663-9716685 AAGAGGGGAAAGAGGGAAGCAGG - Intronic
1036663048 8:10720858-10720880 GAGGGGGGAAGGAGGGAGGAAGG - Intergenic
1036692403 8:10952088-10952110 GAGAGGGGCAGGAGGGCTGCAGG - Intronic
1036950691 8:13136325-13136347 GAGTGGGGAGAGAGGGAGGAAGG - Intronic
1037098009 8:15008695-15008717 GAGAGGAGAAAAGGGGAGGAGGG + Intronic
1037171278 8:15895292-15895314 GGAAGGGGAAAGAGAGGGGATGG - Intergenic
1037195185 8:16180121-16180143 GAGAGAGGAGAGAGGGAGAAGGG - Intronic
1037209356 8:16366897-16366919 GAGAGTGGGAAGAGGGTGAAGGG + Intronic
1037458850 8:19088970-19088992 GAGAGTGGAGAGTGGGAGGAGGG + Intergenic
1037480613 8:19302036-19302058 GGGAGGGGAGGGAGGGAGGAAGG + Intergenic
1037588788 8:20295944-20295966 GAGAGGGGAGAGAGGGAAGGAGG - Intronic
1037598449 8:20373797-20373819 GAGAAGGGAAAGGAGGAGGAGGG + Intergenic
1037630817 8:20654025-20654047 GAGAGAGGAGAGAGGACGGGAGG - Intergenic
1037752552 8:21692351-21692373 GAAAGGGGAAAGGAGGAGGAGGG + Exonic
1037752839 8:21693770-21693792 GAGAGAGGAAGGAGAGGGGAAGG + Intronic
1037752841 8:21693781-21693803 GAGAGGGGAAGGAGAGAGGAAGG + Intronic
1037753226 8:21696073-21696095 GGGAGGGGAGAGAGGGGGGAGGG - Intronic
1037753250 8:21696129-21696151 GAGAGGGGACAGAGGGAGAGGGG - Intronic
1037753467 8:21697114-21697136 GGGAGGGGAGAGAAGGGGGAGGG + Intronic
1037762690 8:21752419-21752441 GAGAGTGGAAGGAGGCAGGAGGG - Intronic
1038001591 8:23396376-23396398 GGGAAGGGAAGGAGGGAGGAAGG + Intronic
1038064068 8:23943665-23943687 AAGAGGGGAAGGTGGGAGGAAGG - Intergenic
1038087005 8:24209429-24209451 GAGAAGGGAAAGAGGGGGAGAGG + Intergenic
1038152676 8:24956578-24956600 GAGAGAGGGAAGGGGGAGGATGG + Exonic
1038167715 8:25101782-25101804 GAGACGGGAAAGCAGGAGGAGGG - Intergenic
1038296052 8:26291721-26291743 GGGGGGGTAGAGAGGGCGGATGG - Intronic
1038307620 8:26419062-26419084 GAGAAGGAAAAAAGGGAGGAAGG + Intronic
1038497353 8:28013111-28013133 GAGAGGGAAGAGAGGGAGCATGG + Intergenic
1038920342 8:32076568-32076590 GAGGGTGGAAAGTGGGTGGAGGG + Intronic
1038934764 8:32236732-32236754 GAGAGGAGAAAGAGGCAGGAAGG + Intronic
1039125012 8:34191746-34191768 GAGAGGGGGAGGGGAGCGGAGGG - Intergenic
1039338780 8:36623873-36623895 GAAAGTTGAAAGAGGGCGGGGGG + Intergenic
1039392148 8:37189957-37189979 GAGAAGGGAAAGGGAGGGGACGG + Intergenic
1039409673 8:37342316-37342338 GAGAGGGGAGAGAGGCAGAATGG + Intergenic
1039436267 8:37561371-37561393 GGGAGGAGAAAGAGGGTGGGGGG + Intergenic
1039453779 8:37695455-37695477 GAGAGAGGAGAGAGAGCGGCCGG + Intergenic
1039721501 8:40169312-40169334 GTCAGGGGAAAGTGGGAGGAGGG + Intergenic
1039737542 8:40348642-40348664 GTGATGAGAAAGAGGGAGGAAGG - Intergenic
1039845473 8:41322450-41322472 GGGAGGGGAGAGAGAGAGGAGGG + Intergenic
1039927592 8:41950936-41950958 GAGAGGGGAGAGAGGAAGGGAGG + Intronic
1040059679 8:43093576-43093598 GCGAGGGGTGAGAGGGCGAAGGG + Intronic
1040099733 8:43488184-43488206 AAGAGGAGAAAGAGGGAGGTTGG + Intergenic
1040523753 8:48199941-48199963 AAGAAGGGAGAGAGGGAGGAGGG - Intergenic
1040993561 8:53378305-53378327 GAGAGGAGAAAGAGAGTGGCAGG - Intergenic
1041168932 8:55120619-55120641 GAGAAGGGGAAGAGGGCATATGG - Intronic
1041496474 8:58491072-58491094 GAGAGGCCAAAGAAGGAGGATGG - Exonic
1041498572 8:58514565-58514587 GACTGGGGAAAGAGGAAGGATGG - Intergenic
1041796893 8:61754345-61754367 CAGAGAGGAAAGAGGGAGGAGGG - Intergenic
1041802317 8:61813488-61813510 AAGAAGGGAAGGAGGGAGGAAGG - Intergenic
1042101994 8:65283892-65283914 GAGAGGGGAAGGAGGGGAGGTGG + Intergenic
1042363554 8:67909863-67909885 AAGAGGGGAAAGAGGAGAGAAGG + Intergenic
1042460543 8:69060387-69060409 GAGAGAGGAAAGAGGGAGAAGGG - Intergenic
1042703990 8:71647396-71647418 GAGGGTGGAAAGTGGGAGGAGGG + Intergenic
1043744358 8:83855075-83855097 GAGCAGGGAGAGAGGGAGGAAGG + Intergenic
1043835129 8:85036816-85036838 GAGGGAGGGAGGAGGGCGGAGGG + Intergenic
1043913535 8:85893095-85893117 GAGGGGGGTGAGAGGGAGGAAGG + Intergenic
1044129339 8:88501282-88501304 AAGAGAGGAAAGAGGACAGAGGG + Intergenic
1044176507 8:89130653-89130675 GGTAGGGGAAAGAGGGGAGAGGG + Intergenic
1044825127 8:96188587-96188609 GAGAGGGAAAAAAGAGAGGAGGG + Intergenic
1044900298 8:96936973-96936995 GAGGGAGGAGAGAGGGAGGAAGG - Intronic
1045033691 8:98161549-98161571 GAGAGGGGAAGGGGAGGGGAAGG - Intergenic
1045048055 8:98297674-98297696 GAGAGGGGAGGGAAGGAGGAGGG - Intergenic
1045071809 8:98514099-98514121 GAGAGGGGAAGGAGGCAGCATGG - Intronic
1045358198 8:101408039-101408061 GAGAGAGGAAAAAAGGAGGAAGG + Intergenic
1045395764 8:101759358-101759380 GAGAGGGGGAAAAGGAGGGAAGG + Intronic
1045791867 8:105993031-105993053 GAGAGGAGAAAGCAGGAGGAAGG - Intergenic
1045837372 8:106537876-106537898 GAGAGAGGAAAAAGAGGGGAGGG + Intronic
1046719974 8:117608420-117608442 GAGGGGGGAAGGAGGAAGGAAGG - Intergenic
1046770078 8:118109965-118109987 CAAAGGGGAAAGAGGACTGAGGG + Intronic
1046806200 8:118481446-118481468 AAGAAGGAAAAGAGGGAGGAAGG + Intronic
1047062797 8:121247257-121247279 GAGGAGGAAAAGAGAGCGGAGGG - Intergenic
1047203110 8:122782513-122782535 GAGAGGGGAGCGAGGGGAGAGGG - Intronic
1047284250 8:123472901-123472923 GAAAGAGGGAAGAGGGCAGAGGG - Intergenic
1048007693 8:130432178-130432200 GAGAAGGGAGAGAGGGAGGAAGG + Intronic
1048690385 8:136955955-136955977 GAGAGGGGAGGGAGGGAGGAAGG - Intergenic
1048824340 8:138409249-138409271 GAGAGGAGAAAGATGGGGGAAGG + Intronic
1048997088 8:139800970-139800992 GAGCGGGGGAAGATGCCGGAGGG - Intronic
1049181680 8:141226189-141226211 CAGAGGGGAAAGATGGAGAAAGG - Intronic
1049272397 8:141702883-141702905 GAGAGGGGAAGGAGGAAAGAAGG - Intergenic
1049370331 8:142261272-142261294 GAGAGAGGATAGAGGGAGGGAGG + Intronic
1049370376 8:142261409-142261431 GAGAGAGGAAGGAGGGATGAAGG + Intronic
1049409563 8:142466432-142466454 GAGAGGGGCCAGAGGAAGGAGGG + Intronic
1049439543 8:142602846-142602868 GAGAGTGGGAAGGGGGCAGAGGG + Intergenic
1049575767 8:143388949-143388971 GAGTGGGGAAAGAGGAAGGGAGG + Intergenic
1049909120 9:248461-248483 GAGAGAGGAGGGAGGGAGGAAGG - Intronic
1050414152 9:5397624-5397646 AAGAGGGGAGAGAGGGAAGAAGG + Intronic
1051014966 9:12463207-12463229 GAGAGAGGGAAGAGGGAGGGAGG - Intergenic
1051196596 9:14568401-14568423 GAGGGCGGAAAGAGGGAGGAAGG + Intergenic
1051260391 9:15258233-15258255 GAGAGAGGAAAGTGAACGGATGG + Intronic
1052724162 9:32209347-32209369 GAGAGGGGAGAGAGAGCAAAAGG - Intergenic
1052886366 9:33652036-33652058 GACAGGGGAAGGAGGGAGCAGGG - Intergenic
1053280509 9:36817422-36817444 GAGAGAGGAGGGAGGGAGGAAGG + Intergenic
1053288976 9:36867695-36867717 GAGAGATAAAAGAGGGAGGAAGG - Intronic
1053308959 9:37003110-37003132 GAGAGGAGAAAGAGGGGAGCCGG + Intronic
1053329222 9:37188620-37188642 GGGAGGGGAAAGGAGGGGGAGGG - Intronic
1053595021 9:39551811-39551833 AAAAGAGGAAAGAGGGGGGAGGG - Intergenic
1053781253 9:41609035-41609057 GAGAGTGGAAGGAGAGAGGATGG - Intergenic
1053852803 9:42306839-42306861 AAAAGAGGAAAGAGGGGGGAGGG - Intergenic
1053946349 9:43312797-43312819 GAGAAGGGAGGGAGGGAGGAAGG + Intergenic
1054169199 9:61819188-61819210 GAGAGTGGAAGGAGAGAGGATGG - Intergenic
1054542282 9:66278126-66278148 GAGAGGGGAAGGGGAGGGGAGGG - Intergenic
1054542289 9:66278137-66278159 GGGAGGGGAAGGAGAGGGGAAGG - Intergenic
1054668333 9:67761628-67761650 GAGAGTGGAAGGAGAGAGGATGG + Intergenic
1054714840 9:68547028-68547050 GAGTGGGGGAAGAGGAGGGAGGG - Intergenic
1054731430 9:68705614-68705636 GGGAGGGGCGGGAGGGCGGAGGG - Intronic
1054790925 9:69255962-69255984 GAGAAGGGAGGGAGGGAGGAAGG - Intergenic
1055356993 9:75447936-75447958 GAGAAGAGAAGGAGGGAGGATGG - Intergenic
1055477599 9:76678384-76678406 GAAAGGGAAAGGAGGGAGGAAGG + Intronic
1055514798 9:77023630-77023652 GAGAAAAGAAAGAAGGCGGAGGG + Intergenic
1056075171 9:83030917-83030939 GAGAGTGAAAAGAGGGAGAAAGG - Intronic
1056165540 9:83937382-83937404 GAGAAGAAAAAGAGGGGGGAGGG + Intergenic
1056178338 9:84057600-84057622 GACATGGGAAAGATGGCAGAAGG - Intergenic
1056367274 9:85918263-85918285 GAGAGAGGGGAGAGGGAGGAAGG - Intergenic
1056472035 9:86915052-86915074 GAGAATGGAAAGAGGAAGGAAGG + Intergenic
1056592080 9:87971962-87971984 GAGAGGCCAAGGTGGGCGGATGG + Intronic
1056597655 9:88020965-88020987 GAGAGGGGAGAGAGGGGGTGGGG - Intergenic
1056665251 9:88576584-88576606 GAGAAGGGGAAGAGGGAGAATGG + Intronic
1056843295 9:90016306-90016328 GACAGGGGAAAGGGGACGAAGGG - Intergenic
1056965190 9:91159467-91159489 GAGGAGGGAAGGAGGGAGGAAGG + Intergenic
1056970101 9:91194575-91194597 GAGAGAGGAAGGAGGGAGGGAGG - Intergenic
1057421598 9:94917419-94917441 GAGAGAGGCATGAGGGCGGAAGG - Intronic
1057480341 9:95440479-95440501 GGGAGGGGAAGGAGGGAGAAGGG + Intergenic
1057503989 9:95617836-95617858 GAGAGACGGAAGAGGGCGGGGGG + Intergenic
1057545985 9:96020946-96020968 GGGAGCGGGGAGAGGGCGGAGGG + Intergenic
1058052217 9:100418405-100418427 GAGAGAGAAAAGAGGGAGGGAGG - Intergenic
1058163527 9:101595121-101595143 AGGAGGGAAAAGGGGGCGGAAGG + Intronic
1058425062 9:104868991-104869013 GAGAGGGAAGAGAGGGGTGAAGG + Intronic
1058448233 9:105072585-105072607 GACAGGGGAAAGATGAGGGATGG + Intergenic
1058456249 9:105140750-105140772 GAGAGGGGTAGGAGGGAGCAGGG + Intergenic
1058843608 9:108934254-108934276 CAGATGGGCAAGAGGGCAGAGGG - Exonic
1058880001 9:109277777-109277799 GGGAGGGGACAAAGGGCAGAAGG + Intronic
1058944216 9:109841653-109841675 GAGAGGGGAGGGTGGGGGGATGG + Intronic
1058972794 9:110098144-110098166 GACAGTGGAAAGAGGGGAGAGGG + Intronic
1059048052 9:110892675-110892697 GAGAGGGGGAAGGGAGGGGAGGG + Intronic
1059086710 9:111310889-111310911 GAGAGGGGGAGGAGGGAGGGAGG - Intergenic
1059606138 9:115838540-115838562 AAGCGGGGAAAGAGGGCAGGAGG + Intergenic
1059814074 9:117892072-117892094 AAGAGGAGAAAGAGGCAGGATGG - Intergenic
1059965482 9:119609668-119609690 GGGAGGGGAAGGAGGGAGGGAGG - Intergenic
1060157316 9:121328833-121328855 GAGATGGGAGAGAGGGGTGATGG + Intronic
1060386051 9:123229673-123229695 GTGAGAGGAATGAGGGCAGAAGG + Intronic
1060735740 9:126065568-126065590 GAGGGGGGAAGGAGGGAGGGAGG - Intergenic
1060736210 9:126067969-126067991 GAGAGGGGAGCAGGGGCGGAGGG + Intergenic
1060757136 9:126222448-126222470 GACCGGGGAAAGAGGAGGGAAGG + Intergenic
1061255657 9:129453353-129453375 GAGGGGTGGAAGAGGGGGGATGG + Intergenic
1061275769 9:129568831-129568853 GAGAGGGGAGCGCGGGCGGGAGG + Intergenic
1061339221 9:129965794-129965816 GAGGGGGGAAGGAGGGAGGGAGG + Intronic
1061390532 9:130315181-130315203 GGGAGGGGAGGGAGGGAGGAAGG - Intronic
1061495418 9:130971116-130971138 GAGAAGGGAAGAAGGGAGGAGGG + Intergenic
1061942553 9:133891409-133891431 GAGGGGGGATGGAGGGGGGACGG + Intronic
1061947129 9:133914696-133914718 GGGAGGGGAAGGAGAGGGGAGGG + Intronic
1062113335 9:134794746-134794768 AGGAGGGGAAGGAGGGAGGAAGG + Intronic
1062194130 9:135263876-135263898 GAGAGGGGAAGGAGGGGAGAGGG - Intergenic
1062211887 9:135369363-135369385 GCTAGAGGAAAGAGGGCAGAGGG + Intergenic
1062443159 9:136582519-136582541 GAGACAGGAAAAAGGGAGGAAGG + Intergenic
1062576804 9:137212608-137212630 GGGATGGGACAGTGGGCGGACGG + Intronic
1062631536 9:137465269-137465291 GAGAGGGGACAGTGGGCGTGTGG - Intronic
1203742536 Un_GL000218v1:14710-14732 GAGAAGGGAATGTGGGCAGAGGG + Intergenic
1203364402 Un_KI270442v1:244075-244097 GACGGGGGAAAGAGGGAGGGAGG + Intergenic
1203589479 Un_KI270747v1:41355-41377 GAGAAGGGAGGGAGGGAGGAAGG + Intergenic
1185598883 X:1325443-1325465 GGGAGGGGAGAGAGGGAGGTGGG + Intergenic
1185608452 X:1380480-1380502 GAGGGGGGAAAGGAGGGGGAAGG + Intronic
1185611100 X:1394184-1394206 GAGAGAGGAAAGAGGCAGGGAGG - Intergenic
1185751106 X:2609871-2609893 TGGAGGGGAAAGAAGGAGGAAGG + Intergenic
1185784731 X:2881121-2881143 GAGAGGAGGAAGTGGGAGGAAGG + Exonic
1185908414 X:3959580-3959602 GAGAGTGGAGGGAGGGAGGAGGG - Intergenic
1185911321 X:3983547-3983569 GAGAAAGGAAAGAGGGAGGGAGG + Intergenic
1185915177 X:4027058-4027080 GAGTGGGGAAAGAAGGAGGGGGG + Intergenic
1185932314 X:4216891-4216913 GAGAGGCCAAGGTGGGCGGATGG + Intergenic
1186059356 X:5687227-5687249 GAGAGAAGAAAGATGGAGGAAGG + Intergenic
1186111945 X:6266901-6266923 AAGGGAGGAAAGAGGGAGGAGGG + Intergenic
1186216812 X:7309391-7309413 GAGAGGGGAGGGTGGGAGGAGGG + Intronic
1186410534 X:9342098-9342120 GGGAAGTGAAAGAGGGAGGAGGG - Intergenic
1186757288 X:12685348-12685370 GAGAGAAGAAAGAGGGAGGAAGG - Intronic
1186761579 X:12729070-12729092 AAGAGGGGAAAGAAGACAGAGGG - Intergenic
1187283714 X:17882970-17882992 GAGAGGGGAGGGAGGGAGAAAGG + Intergenic
1187283758 X:17883144-17883166 GAGAGGGGAGAGAAGGGAGAGGG + Intergenic
1187447707 X:19373241-19373263 GAGAGGGGGAAGAGGAGAGAGGG + Intronic
1187492090 X:19761350-19761372 GAGAAGGGAGAGAGTGGGGAGGG + Intronic
1187567711 X:20468581-20468603 GATAGGGGAAATAGGGCGTGGGG + Intergenic
1187754015 X:22500074-22500096 GAGAGAGGAAAGAGGAGAGAGGG + Intergenic
1187755870 X:22525546-22525568 GAGAGTGGAGGGAGGGAGGAGGG + Intergenic
1187876006 X:23804825-23804847 GAGAAAGGAAAGAGGAAGGAAGG - Intergenic
1188026564 X:25216335-25216357 GGGAGGGGAAAGGGGGGAGAAGG - Intergenic
1188303465 X:28533043-28533065 GGGAGGGGAAGAAGGGTGGAAGG + Intergenic
1188734586 X:33696735-33696757 GAGAGAGGGAAGAGGGTGCAAGG + Intergenic
1189224159 X:39398598-39398620 GAAAAGGAAAAGAGGGAGGAAGG - Intergenic
1189269397 X:39740298-39740320 GAGAGGGGAATGATGGCAGTTGG - Intergenic
1189571415 X:42301924-42301946 GAGAGGAGAAAGAGGGAGGAGGG - Intergenic
1189676596 X:43467274-43467296 GAGAGGGGAAAGACAGAGAAGGG + Intergenic
1189799136 X:44675853-44675875 GAGGAGGGAAAGAGGGCTGTGGG - Intergenic
1189834108 X:45003850-45003872 GAGAGGGGAGAGAGAGGAGAAGG - Intronic
1189892965 X:45624655-45624677 GTGAGGGGAAAGTGGCTGGAAGG + Intergenic
1189909832 X:45799389-45799411 AAGCAGGGAAAGAGGGAGGAGGG + Intergenic
1190010252 X:46778519-46778541 TGGAGGGGAAAGAGGGAGGAGGG - Intergenic
1190074047 X:47302678-47302700 CGGAGGGGAAAGAGGGAGGAGGG - Intergenic
1190089680 X:47426987-47427009 GAAAGGGGGAAGAGGGAAGAGGG - Intergenic
1190220293 X:48508694-48508716 GAGAAGGGAAAGATGGGGGAGGG - Intergenic
1190260357 X:48793397-48793419 GAAAGGGGAAAGAGGAAAGAGGG - Intronic
1190399180 X:50014588-50014610 GAGAGGGGGAGCAGGGCAGAAGG - Intronic
1190401962 X:50046133-50046155 GAGATGTGAAAGAAGGTGGAGGG + Intronic
1190469993 X:50769216-50769238 GAAAGGGGAAGGAGGGAGGGAGG + Intronic
1190812202 X:53895629-53895651 GAGGGTGGAAGGAGGGAGGAGGG + Intergenic
1192143161 X:68661930-68661952 GAGAGAGGAAGGAGGGAGGGAGG - Intronic
1192450525 X:71241948-71241970 AAGAGGGGAAACAGGCCAGAGGG + Intronic
1192451473 X:71247688-71247710 GAGGCGGGAAAGAGGGCAGTGGG - Intronic
1192848062 X:74925762-74925784 GAGAGGGTAAGGAGAGCGGGAGG - Intergenic
1193512771 X:82426164-82426186 GAGAGTGGAGGGAGGGAGGAGGG - Intergenic
1193526190 X:82592363-82592385 GAGTGGGGAAAAAGAGAGGAAGG - Intergenic
1193741977 X:85227985-85228007 GGGAGGGGAAAGAGTGTAGAGGG + Intergenic
1194698057 X:97080226-97080248 AAGAAGGGAATGAGGGAGGAAGG - Intronic
1195063624 X:101219724-101219746 GAGAGGGGGAAGAGGGAGAGAGG - Intergenic
1195324192 X:103744647-103744669 CAAAGGGGAAAGAGGACAGATGG + Intergenic
1195537678 X:106027289-106027311 GAGAGGCCAAAGCGGGGGGAGGG - Intergenic
1195934620 X:110113023-110113045 CAGAGGGGAGGGAGGGAGGAAGG - Intronic
1196039736 X:111189065-111189087 GAGTGAGGAAGGAGGGAGGAGGG - Intronic
1196227599 X:113184945-113184967 GAGAGGGGAGAGTGGGAGGAGGG - Intergenic
1196237539 X:113299970-113299992 GAGAGGGGAAGGGGAGGGGAGGG - Intergenic
1196481601 X:116156673-116156695 GAGAGGGAAAAGGAGGGGGAGGG + Intergenic
1196738390 X:119001215-119001237 GAGAGAGGAGAGAGGGAGGGAGG + Intronic
1196885800 X:120244515-120244537 CAGAGGCGAAAGAGGGTGGAGGG + Intergenic
1197027585 X:121773507-121773529 AAGTGGGGAGAGAGGGAGGATGG - Intergenic
1197045069 X:121986451-121986473 GAGAGGGGAGGGTGGGAGGAGGG + Intergenic
1197408715 X:126088825-126088847 GAGAGTGGAGAGTGGGAGGAGGG + Intergenic
1197651604 X:129071542-129071564 GAGGGGGAAAAGAGGGAGGAAGG + Intergenic
1197709311 X:129654491-129654513 GAGAGTGCGAATAGGGCGGAGGG + Intronic
1197833273 X:130668099-130668121 GAAGGGGGAAAGGGGGCAGAGGG + Intronic
1197925766 X:131645497-131645519 GAGAGGGAAGAGAGGGCATATGG + Intergenic
1198051392 X:132956341-132956363 TAGGGGGGAAAGCGGGGGGAGGG + Intronic
1198217623 X:134570271-134570293 CAGAGGGAAAAGAAGGCTGAGGG + Intronic
1198242024 X:134796589-134796611 GAGGGGGGAAAGGGAGAGGAAGG + Intronic
1198266089 X:135010256-135010278 GAAAGGGGAAAAAGGACAGAAGG + Intergenic
1198269465 X:135041631-135041653 GAGAAGGGAGGGAGGGAGGAAGG + Intergenic
1198517572 X:137425058-137425080 GAGAGGGGGACGAGGACGGAAGG + Intergenic
1198791772 X:140354298-140354320 GAGAGGGGAAAGAAGGAACAGGG + Intergenic
1198885365 X:141329666-141329688 GAGGGTGGAAAGTGGGAGGAGGG + Intergenic
1199264767 X:145817764-145817786 GAGAGGGGAAGAAGGGAGGGAGG - Intergenic
1199330052 X:146548975-146548997 GAGGGTGGAAAGTGGGAGGAGGG - Intergenic
1200238051 X:154478652-154478674 GAGAAGGAAAGGAGGGCGGGCGG - Intronic
1200243167 X:154508243-154508265 GAGCAGGGAAGGAGGGCGGCAGG + Intronic
1200742583 Y:6870075-6870097 GAGAAGAGAAAGAGAGAGGAAGG + Intronic
1200788526 Y:7279620-7279642 GAGAGAGGAGAGAGGAGGGAGGG + Intergenic
1200884837 Y:8257078-8257100 GAGAAGGGAGAGAGGGAGGGAGG + Intergenic
1200978207 Y:9236328-9236350 GAGAGAAGGAAGAGGGAGGAAGG - Intergenic
1201256345 Y:12111992-12112014 GAAGGGGGAAGGAGGGAGGAAGG - Intergenic
1201300167 Y:12498407-12498429 GAAAGAGGAAGGAGGGAGGAAGG - Intergenic
1201517636 Y:14835316-14835338 AAGAAGGGAAGGAGGGAGGAAGG + Intronic
1201517641 Y:14835327-14835349 GAGGGAGGAAGGAGGGAGGAGGG + Intronic