ID: 1167615370

View in Genome Browser
Species Human (GRCh38)
Location 19:50530099-50530121
Sequence CTGTGGGGATGGAGAGGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1177
Summary {0: 1, 1: 0, 2: 8, 3: 137, 4: 1031}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167615370_1167615380 6 Left 1167615370 19:50530099-50530121 CCATTTCCTCTCCATCCCCACAG 0: 1
1: 0
2: 8
3: 137
4: 1031
Right 1167615380 19:50530128-50530150 CCCGCCTCATCCTCTCTCCCTGG 0: 1
1: 0
2: 9
3: 49
4: 475
1167615370_1167615382 7 Left 1167615370 19:50530099-50530121 CCATTTCCTCTCCATCCCCACAG 0: 1
1: 0
2: 8
3: 137
4: 1031
Right 1167615382 19:50530129-50530151 CCGCCTCATCCTCTCTCCCTGGG 0: 1
1: 0
2: 1
3: 25
4: 342
1167615370_1167615389 30 Left 1167615370 19:50530099-50530121 CCATTTCCTCTCCATCCCCACAG 0: 1
1: 0
2: 8
3: 137
4: 1031
Right 1167615389 19:50530152-50530174 CCCGCCGCAGCCTCCTGCCTGGG 0: 1
1: 0
2: 7
3: 167
4: 2035
1167615370_1167615387 29 Left 1167615370 19:50530099-50530121 CCATTTCCTCTCCATCCCCACAG 0: 1
1: 0
2: 8
3: 137
4: 1031
Right 1167615387 19:50530151-50530173 GCCCGCCGCAGCCTCCTGCCTGG 0: 1
1: 0
2: 4
3: 52
4: 686

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167615370 Original CRISPR CTGTGGGGATGGAGAGGAAA TGG (reversed) Intronic
900603961 1:3515667-3515689 GTGTGACGATGGAGATGAAAAGG - Intronic
900606047 1:3524012-3524034 CTGTGGACATGGAGAGGCAGAGG - Intronic
901124450 1:6919238-6919260 CTGAGGGGATAGAGAGGTGAAGG - Intronic
901236545 1:7670375-7670397 CTGTGGGGATGGCAAGGTGAGGG - Intronic
901849126 1:12004298-12004320 CTGTGGAGGTCCAGAGGAAAGGG - Intronic
902439184 1:16418159-16418181 CTGTGGGGGAGAAGAGGAGAGGG - Intronic
902521866 1:17022802-17022824 CTCTGGGAGTGCAGAGGAAAGGG + Intronic
902664049 1:17925172-17925194 GCATCGGGATGGAGAGGAAATGG - Intergenic
902712458 1:18249761-18249783 CTGTGGGCCAGTAGAGGAAAGGG - Intronic
902763315 1:18598541-18598563 CTGTGCTGAAGGAGAGGAATAGG - Intergenic
902879729 1:19363541-19363563 CTGGGGGGAAGGAGAAAAAAGGG + Intronic
903026061 1:20430622-20430644 CTGTGGGGAGGGCAAGGAAGGGG + Intergenic
903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG + Intergenic
903180485 1:21602686-21602708 TAGTGGGGATGGAGAGGCAGAGG + Intronic
903275036 1:22216197-22216219 CAGTGGGAATGGGGAGGAGAGGG + Intergenic
904037745 1:27567873-27567895 TTGTGGGGAGGGACAGGGAAGGG + Intronic
904124070 1:28223792-28223814 CTGTGGGGTTGGACTGAAAATGG + Intronic
904263845 1:29306620-29306642 CTGGGTGGCTGGAGAGGAGAGGG + Intronic
904273077 1:29363103-29363125 CTGTGGGGATCCTGTGGAAAAGG + Intergenic
904877818 1:33670151-33670173 CTGAGGGGATGGGGAGGACAAGG - Intronic
905544358 1:38785994-38786016 CAATGGGAATGGAGAGGAAAGGG + Intergenic
905969881 1:42133689-42133711 TTGTGCATATGGAGAGGAAAGGG + Intergenic
906125440 1:43424409-43424431 CAGTGAGGATGGAGAGGAGCTGG - Exonic
906142042 1:43539697-43539719 ATCTGAGGATGGAGAGGCAAAGG - Intronic
906326467 1:44849203-44849225 CCATGGGGAAGGACAGGAAAGGG + Intergenic
906612780 1:47214717-47214739 CTGTGGCGTTTCAGAGGAAAAGG - Intergenic
906666315 1:47624596-47624618 CTATGGGGAAGGAGAGCAAAGGG - Intergenic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
908114143 1:60924734-60924756 CTGTGGGGAAGAACAGGAACAGG - Intronic
908418010 1:63932291-63932313 GAGTGGGAATGGAGAGGAAGTGG + Intronic
908474782 1:64476796-64476818 CTTGGGGGAGGGAGAGGAGATGG + Intronic
908626342 1:66047924-66047946 CTGTGGGTATGAAGAGCTAATGG + Intronic
908668096 1:66514775-66514797 CTTTGGGGACTCAGAGGAAAGGG + Intergenic
909033896 1:70574669-70574691 CTGAGGGGCTGGAGTAGAAAGGG - Intergenic
909906694 1:81204906-81204928 CTTTGGAGATTGAGAGGGAAAGG - Intergenic
910415895 1:86997746-86997768 CTGTGTGGGTGGGGAGGGAAGGG + Intronic
910441804 1:87260675-87260697 GAGTAGGGATGGAGAGGAAAAGG + Intergenic
910504993 1:87940275-87940297 CGGTGGAGATGGTGATGAAATGG + Intergenic
910693827 1:89991628-89991650 CAGTGGGGATGAAGAGGAGGGGG + Intergenic
911486864 1:98513622-98513644 CTGTGGGGAGGGAGAGGGAGAGG + Intergenic
911656464 1:100449462-100449484 GTATGGGGAGGGAGTGGAAAAGG - Intronic
911685194 1:100767713-100767735 CTGTGAGTATGCAGAGAAAAAGG + Intergenic
911753309 1:101523649-101523671 CTGTGTGGGTGGCGAGAAAATGG - Intergenic
912047121 1:105472749-105472771 TGGTGAGGATGTAGAGGAAAGGG - Intergenic
912370125 1:109167378-109167400 CTCTGTCAATGGAGAGGAAATGG + Intronic
912499078 1:110110027-110110049 CAGTGGGGATGCAGAGGAGGAGG + Intergenic
912700865 1:111877412-111877434 CCCTGGGGATGGGGAGGCAAGGG + Intronic
913274636 1:117124879-117124901 CAGTGGGGATGGAAAGAAATCGG - Intergenic
913689201 1:121262388-121262410 CTCTGGAGGTGGAGAGGGAAGGG + Intronic
914148398 1:145017893-145017915 CTCTGGAGGTGGAGAGGGAAGGG - Intronic
914666881 1:149840056-149840078 CTGTGGACATGGACAGGGAACGG + Exonic
914668886 1:149853734-149853756 CTGTGGACATGGACAGGGAACGG - Exonic
914783711 1:150809175-150809197 ATGTGGGGAAGGAGAAAAAAAGG + Intergenic
915369595 1:155337481-155337503 TAGTGGAGAGGGAGAGGAAAGGG - Exonic
915455134 1:156035568-156035590 CTTTGAGGAAGGAGAGGAGAGGG - Exonic
915562127 1:156693456-156693478 CTGGGTGGGAGGAGAGGAAAGGG - Intergenic
915719885 1:157977176-157977198 GGGTGGGGTTGGAGAAGAAACGG + Intergenic
915974433 1:160375650-160375672 CACTGGGGGTGGAGAGGGAAGGG - Intergenic
916328530 1:163591115-163591137 TTGTGAGGATGTAGAGAAAAGGG - Intergenic
916735781 1:167605736-167605758 CTGTCTGGTTGGAGAGGAGAAGG - Intergenic
916825077 1:168435244-168435266 CTGGGGGGATGGAGAGCAACAGG - Intergenic
916858443 1:168776357-168776379 CTGTGGGGATGGAAAATAAATGG - Intergenic
916872672 1:168934001-168934023 CTTTCGGGATGCAGAGGAAAGGG - Intergenic
917044207 1:170838679-170838701 TTGTGAGGATGTGGAGGAAAGGG - Intergenic
917239375 1:172930998-172931020 CTTTGGGGACTCAGAGGAAAGGG + Intergenic
917318222 1:173751186-173751208 CTGTCAGAATGGAGATGAAACGG - Intronic
917672488 1:177286106-177286128 GTGTGGGGATGGAGGAGAGAAGG + Intergenic
917727254 1:177839590-177839612 GTGTCGGGGTGGAGAGGAGAAGG - Intergenic
917899068 1:179523868-179523890 CTTTGGGGATTCAGGGGAAAAGG - Intronic
917963822 1:180166156-180166178 CTGGGGGGATGGCGAGGAGCAGG + Intronic
918097691 1:181348373-181348395 ATGTGGGGAAGGGGAGGGAAAGG - Intergenic
918158948 1:181879170-181879192 CTGTGAGGTTGCAGAGAAAAAGG - Intergenic
918343200 1:183584006-183584028 TAGTGGGGATGGAGAGAAATAGG + Intronic
918440012 1:184557407-184557429 CTTTGGGGATTCAGAGGAAAGGG - Intronic
918660156 1:187078328-187078350 TAGTGGTGATGGAGAAGAAAAGG + Intergenic
919272332 1:195363931-195363953 TTGTGAGGATGTAGAGAAAAGGG + Intergenic
919598848 1:199598512-199598534 TGGTGAGGATGTAGAGGAAAGGG + Intergenic
920010371 1:202862591-202862613 AAGTGGGGATGAAGAGGAGATGG - Intergenic
920105470 1:203549995-203550017 CAGTGGGGAAGCACAGGAAAGGG - Intergenic
920180175 1:204127550-204127572 CTTTGAGGATGGAGAGAAGACGG - Exonic
920476524 1:206280863-206280885 CTCTGGAGGTGGAGAGGGAAGGG + Intronic
920663234 1:207937475-207937497 TTGTGGGGCAGGAGAGTAAATGG - Intergenic
920711865 1:208302893-208302915 CAGTGGGGCTGGAGAGGTAGTGG + Intergenic
920716729 1:208347167-208347189 CCATGGGGGTGGAGAGGGAAGGG - Intergenic
920980336 1:210828502-210828524 CGGTGGGGATGGGGTGGAATGGG - Intronic
921226425 1:213024595-213024617 CTTGGGAGATGGAGAGAAAAGGG - Intergenic
922241677 1:223759511-223759533 CAGTGGGGAGGGACAGGGAAGGG - Intronic
922345643 1:224694075-224694097 CTGTGGAGGAGGAGAGGAGAGGG + Intronic
922566617 1:226605582-226605604 CTGAGGGGATGGAGAAGAGATGG - Exonic
922639317 1:227211271-227211293 CTGGGGGGATGCAGATAAAAAGG + Intronic
922939757 1:229452111-229452133 GTGTTGGGTTGCAGAGGAAAGGG + Intronic
922960337 1:229640972-229640994 CAGTAGGGTTGAAGAGGAAAAGG - Intronic
923128443 1:231053573-231053595 CTGTCAGGATGGAGAAGAGAGGG + Intergenic
923147408 1:231207860-231207882 CTGGGGGGTTGGGGAGCAAAAGG + Intronic
923183630 1:231548534-231548556 CAGTGGGAATAGAGAGGAATGGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923738639 1:236635498-236635520 CTGTTGGAATGGAGAGGGTATGG + Intergenic
923846671 1:237741308-237741330 CTCTGGGCATGGAGATGAACTGG - Intronic
924284694 1:242474458-242474480 CAGTGGGAATTGAGAAGAAAGGG - Intronic
924419158 1:243891283-243891305 TGGTGGGGATGGGGAAGAAAAGG - Intergenic
924867667 1:248003199-248003221 CAATGAGGATGAAGAGGAAAAGG - Intronic
924872198 1:248060750-248060772 CAATGAGGATGAAGAGGAAAAGG - Exonic
1062933935 10:1371818-1371840 TTGTGTGGATGCAGAGAAAAGGG + Intronic
1063689052 10:8266267-8266289 CGGAGGGGATGGAGAGAAGAGGG + Intergenic
1064195971 10:13244367-13244389 TTTTGGGGAGGGAGAGGATAAGG + Intergenic
1064547947 10:16469495-16469517 CTGTGAGAATGAAGGGGAAAAGG + Intronic
1064731253 10:18332976-18332998 CTATGGGGTTGGGGAGTAAAGGG + Intronic
1065990072 10:31000454-31000476 TTGTGGGGGTAGAGAGAAAAAGG - Intronic
1066290359 10:34008744-34008766 CTAGGGTGATGGAGAGGAATGGG + Intergenic
1067915152 10:50389603-50389625 ATGTGGGGATGGCCAGGAAGAGG - Intronic
1068117794 10:52752994-52753016 CTGTGGGCTTGGACAGGAGAAGG + Intergenic
1068483967 10:57632437-57632459 CTAAGCAGATGGAGAGGAAAGGG - Intergenic
1068631392 10:59301962-59301984 TTGTGGGGTGGGAGAGGAAGAGG + Intronic
1069052095 10:63805962-63805984 CTGTGGTGATAGAGGGGAGAAGG - Intergenic
1069172294 10:65247426-65247448 ATGTGGAGATGAAGATGAAAGGG - Intergenic
1069173078 10:65257085-65257107 TTTTGTGGATGGTGAGGAAAAGG - Intergenic
1069436956 10:68393009-68393031 TTGAGGGGATAGAGAGAAAATGG - Intronic
1070016210 10:72534654-72534676 CTGTGGGCATAGTGAGGTAAGGG - Intronic
1070016501 10:72538087-72538109 CTGTGGGCATAGTGAGGTAAGGG - Intronic
1070931452 10:80263972-80263994 CTCTGGGAATGGAGGGGAAGAGG + Intergenic
1071220144 10:83456144-83456166 CTGTGGGGTGGGAGACGAAGAGG + Intergenic
1071317134 10:84412719-84412741 ATGTGGGGGTTGAAAGGAAATGG + Intronic
1071449369 10:85779796-85779818 CTGTGGAGATGAAGACGGAAAGG + Intronic
1071679171 10:87687184-87687206 CTGTGGGGATAGTGGTGAAAGGG - Intronic
1072156960 10:92732482-92732504 CTGTAGGTATGAAGAAGAAAGGG - Intergenic
1072421300 10:95292009-95292031 CTGGGGGGCAGGTGAGGAAAGGG - Intergenic
1072654104 10:97318864-97318886 TGGTGAGGATGGAAAGGAAAGGG - Intergenic
1072797190 10:98365102-98365124 CACTGGGGATGAAGAGAAAAAGG + Intergenic
1072948933 10:99835666-99835688 AAGTGGGGATGGGCAGGAAATGG - Intronic
1073113142 10:101074510-101074532 CAGCGGGGATGGAAAGGAGAGGG + Intergenic
1073275019 10:102302250-102302272 CTGTGGAAAGGGAGAGGGAAAGG + Intronic
1073499167 10:103920203-103920225 CTGTGTTGATGGAGACTAAAGGG - Intergenic
1073755120 10:106573034-106573056 CTGTGGGAATGGAAAGGTTAAGG + Intergenic
1074158209 10:110816351-110816373 TGGTGGGGAGGGAGAGGAATGGG - Intronic
1074179925 10:111050919-111050941 CTGTGGGAATGGACAGGCATTGG + Intergenic
1074532718 10:114307990-114308012 ATGGGTGGATGGAGTGGAAATGG - Intronic
1074949239 10:118312893-118312915 CTGTGGGGCTGGGGAGGAGTTGG + Intronic
1075006703 10:118835852-118835874 AGGTGGGGAGGGAGAGGAGATGG - Intergenic
1075399659 10:122151769-122151791 CCGTGGGGATGGAGGGGACCTGG + Intronic
1075961053 10:126567988-126568010 CTCTGGGAAAGGAGAGGAAATGG + Intronic
1076285103 10:129287822-129287844 ATGTGGGGAAGGTGGGGAAAGGG + Intergenic
1076376366 10:129989808-129989830 CTTTGGGGACTCAGAGGAAATGG + Intergenic
1076566886 10:131405014-131405036 CTGTGAGGATGCAGAGGACGGGG + Intergenic
1077009606 11:374339-374361 CTGTGGGGATGGACGGGGGAAGG + Intronic
1077069806 11:663769-663791 CTGAGGAGATGGAGAAGGAAAGG - Intronic
1077133474 11:986762-986784 CTGTGTGGAGGGAGGGGAAGTGG - Intronic
1077287742 11:1775317-1775339 GAGGGGGGATGGAGAGGAGATGG + Intergenic
1077287760 11:1775373-1775395 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287770 11:1775406-1775428 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287776 11:1775428-1775450 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287803 11:1775506-1775528 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287813 11:1775539-1775561 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287831 11:1775595-1775617 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287841 11:1775628-1775650 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287847 11:1775650-1775672 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287862 11:1775695-1775717 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287928 11:1775874-1775896 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287942 11:1775918-1775940 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287969 11:1775996-1776018 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077288002 11:1776096-1776118 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077358241 11:2128413-2128435 CTGTGGGGATGGAGGGACAGGGG - Intergenic
1077470658 11:2758848-2758870 CTGTAGGGATGGAGATCAGATGG + Intronic
1077670899 11:4156737-4156759 CAGTGAGGTTGGAGAGAAAAAGG - Intergenic
1077965000 11:7120369-7120391 CTGTGGGGCTGGAGCTAAAAAGG + Intergenic
1078042008 11:7874765-7874787 CTGTGGGGTAGGAGAAAAAAGGG + Intergenic
1078282309 11:9915072-9915094 TTGTGAAGATGGAGATGAAATGG + Intronic
1078326725 11:10387325-10387347 CGGTGGGGACGCAGAGGAAAAGG + Intronic
1078360135 11:10661603-10661625 CTTTGAGGATGGAGAAAAAAGGG - Intronic
1078970900 11:16410006-16410028 GGGTGGGGATGGGGAGGAATAGG + Intronic
1079161831 11:18002223-18002245 CAGTTGGGATGGAGAGTAAGAGG - Intronic
1079478162 11:20853245-20853267 GTGTGGGAAAGGAGAGGAAAAGG + Intronic
1079704242 11:23593682-23593704 CTGTGGGGAGAGAGAGCAACAGG + Intergenic
1079733268 11:23962328-23962350 CTGAGAGGATGGAGAGACAACGG + Intergenic
1080049580 11:27845807-27845829 CTGTGGAGATTGAGAGAAAAAGG - Intergenic
1080271202 11:30452390-30452412 CTGTGGGAATGGAGAAGGTATGG - Intronic
1080362479 11:31531967-31531989 TTGTGGGGATAAAAAGGAAAGGG + Intronic
1081123500 11:39294487-39294509 TTGTGGGGTTGGAGGGGAACGGG - Intergenic
1081578236 11:44333082-44333104 GTTTGGGGATGAAAAGGAAAGGG + Intergenic
1081729457 11:45359532-45359554 GTGTTGGGATGGAGAGGTGATGG + Intergenic
1081738860 11:45424269-45424291 CTAGGGGGAGGGAGAGGAGAAGG - Intergenic
1082269561 11:50155262-50155284 CTGAGGGGATGGGGAGGAAGGGG - Intergenic
1082775629 11:57242420-57242442 CTCTCGGGAAGGAGAGAAAAAGG - Intergenic
1083673623 11:64313831-64313853 CTGGGGGTATGGGGAGGAAAGGG - Intronic
1083877627 11:65532634-65532656 CTATGGGGATAGAGTGGGAAGGG + Intronic
1084039310 11:66532165-66532187 CAGTGGGGGTGGTGAGGAAGCGG - Exonic
1084601812 11:70150133-70150155 CCGTGGGGGTGGAGAGGAAATGG + Intronic
1084902081 11:72317221-72317243 CTGTGGGGAGAGAGGGCAAATGG + Intronic
1085274550 11:75289930-75289952 CTCTTGGGAAGCAGAGGAAACGG - Intronic
1085303959 11:75474678-75474700 CAGCGTGGATGGAGAGGAAGGGG + Intronic
1085305325 11:75482517-75482539 CTGTGGGGATGGCGAGAAAAGGG - Intronic
1085472393 11:76766700-76766722 CAGGGAGGATGGAGAGGAGACGG - Intergenic
1085547344 11:77332307-77332329 CTGTGGGGCGTGAGAGGAAGGGG + Intronic
1085754718 11:79193007-79193029 CTGGGAGGCTGGAGAGGAAGGGG - Intronic
1085817313 11:79753094-79753116 TGGTGAGGATGCAGAGGAAAGGG + Intergenic
1085948747 11:81304240-81304262 GTGGGGGGATGGAGAGCATAGGG - Intergenic
1086392923 11:86384308-86384330 CTGTGGGGGTGGGGAGGAGTGGG + Intronic
1087177605 11:95109756-95109778 CAGTGGTGATGGGGAGGAGAAGG - Intronic
1087195824 11:95303357-95303379 TAGTGAGGATGGAGAGGAGAGGG + Intergenic
1087322196 11:96676746-96676768 ATGTGTGGTTGGAAAGGAAAAGG + Intergenic
1087364392 11:97200985-97201007 CTGTGGGGTTGGAATGGCAAAGG + Intergenic
1088044411 11:105430472-105430494 TTGGGGGGATGGAGAGGATGGGG - Intergenic
1088183048 11:107133763-107133785 CTATGGGGAGACAGAGGAAAAGG + Intergenic
1088327653 11:108617272-108617294 TTGTGGGGAGTGAGAGGATAAGG + Intergenic
1088401416 11:109424737-109424759 GGGTGGGAATGGGGAGGAAAGGG - Exonic
1088533610 11:110836983-110837005 TGGTGGGGATGGACAGGGAAAGG - Intergenic
1088656442 11:112004427-112004449 TAGTGGGGATGGAAAGGAAAAGG + Intronic
1088705108 11:112455113-112455135 TTGTGGGGATGTAGAGCAACTGG - Intergenic
1088783083 11:113155147-113155169 CAGTGAGGAAGGAGAGGAACTGG + Intronic
1088821956 11:113464153-113464175 CTGTAGCTATGGAGAGGAATGGG + Intronic
1088843260 11:113644281-113644303 CTGTGGGGGTGGGGAGGAGCTGG - Intergenic
1089016920 11:115172909-115172931 CTGAGGGGATGGTGGGAAAAGGG + Exonic
1089318736 11:117610548-117610570 CGGTGGGGAGGAAGAGGTAATGG + Intronic
1089350411 11:117818799-117818821 CTGTGGGTTTGGAGAGTGAAGGG - Intronic
1089624767 11:119744301-119744323 CAGTGGTGATGAAGAAGAAAGGG - Intergenic
1090333973 11:125950742-125950764 CTGAGGGGCTGGTGAGGAACAGG - Intergenic
1090383536 11:126343487-126343509 CTCTGGGAAAGGTGAGGAAAGGG - Intronic
1090414478 11:126531197-126531219 CAGTGGGAATAGAGAGGAAAGGG - Intronic
1091085187 11:132714893-132714915 CTGAGGGCTTGGAGAGGAAATGG + Intronic
1091136441 11:133194766-133194788 ATGTGGGGATGAAGCTGAAAAGG - Intronic
1091337034 11:134779708-134779730 CTGTGGGGGTGAAGAGAAAAGGG + Intergenic
1092053517 12:5490348-5490370 ATGTGTGGATGGAAAGGACATGG + Intronic
1092171799 12:6378117-6378139 CTTTGGGGAGGGAAAGGAAGGGG - Intronic
1092861692 12:12724635-12724657 CTGTGATGATGAAGATGAAATGG - Intergenic
1093108823 12:15123738-15123760 TAGTTGGGATGGAGAGGGAAGGG - Intronic
1093377465 12:18448545-18448567 ATGTGGACAGGGAGAGGAAATGG - Intronic
1093484863 12:19641677-19641699 CTGTGGGGGAGGAAGGGAAATGG - Intronic
1093711279 12:22333026-22333048 CTGGGGAGGTGGAGAGGAAGGGG + Intronic
1093765188 12:22954229-22954251 TTGTGGGGATGGTTAGGAAAAGG - Intergenic
1093831108 12:23759413-23759435 CTGTGGGGGTGACGAGGGAAGGG + Intronic
1094034623 12:26054617-26054639 CTGTGGGGAGAGGGAGGCAAGGG + Intronic
1094056427 12:26273773-26273795 ATTTGGGGAAGAAGAGGAAATGG - Intronic
1094123518 12:26998723-26998745 GTGTGGGGATGGATTGGAGAGGG - Intronic
1094210442 12:27884820-27884842 CTCTGGGGATGGAGGGCACAAGG + Intergenic
1094305639 12:29016389-29016411 TTGTGGGGAGGGAAAGGGAAAGG - Intergenic
1094764039 12:33571154-33571176 CTTTGGGGACTGGGAGGAAAGGG + Intergenic
1094804846 12:34079839-34079861 CTTTGGGGATTGAAATGAAACGG + Intergenic
1095116858 12:38364768-38364790 CTTTGGGGATTGAAATGAAACGG + Intergenic
1095169527 12:39018498-39018520 CTGTGAGCTTGGATAGGAAATGG - Intergenic
1095930435 12:47620081-47620103 CTGAGGGGAAGCAAAGGAAAGGG + Intergenic
1095948374 12:47766779-47766801 CAGTGGGCAGGCAGAGGAAATGG + Intronic
1096086818 12:48870818-48870840 CTGTGGGGTTGAGGAGGAAATGG + Intergenic
1096333052 12:50731423-50731445 CTGTGGAGAGCCAGAGGAAAAGG - Exonic
1096427965 12:51520346-51520368 CAATGGTGATGGAGAGGAAGAGG + Intergenic
1096482760 12:51952832-51952854 CTGTGGGGATTGGGAGGTAAGGG - Intronic
1096526528 12:52213309-52213331 CTGCGGGGAGGGAGACGAAAAGG - Intergenic
1096561271 12:52437670-52437692 CTGTGGAGGAGGAGAGGAAGTGG + Intergenic
1096800204 12:54105637-54105659 CTGTGGGGATGCAGAGTAGTAGG - Intergenic
1096843687 12:54393633-54393655 CTGTGTTGGTGGAGATGAAAAGG - Intergenic
1096874196 12:54614513-54614535 CAGTGGGGCTGGAGAAGAGAAGG + Intergenic
1097021173 12:56021664-56021686 CTGAGGAGATGGAGAGGATGGGG + Intronic
1097128287 12:56790563-56790585 CTGTGGGAAGGGAGAGGGAGAGG + Intergenic
1098268757 12:68750068-68750090 CGGTGGGAATGGACAGGGAAAGG + Intronic
1098480944 12:70960361-70960383 TCGTGGTGATAGAGAGGAAAAGG + Intergenic
1098839005 12:75456194-75456216 CTAGGGTGAGGGAGAGGAAAAGG + Intergenic
1098917432 12:76272156-76272178 CTGAGGGGAGGGAGAAGAGACGG - Intergenic
1099265868 12:80447040-80447062 CAGTGTGGATGCAGAGAAAAGGG - Intronic
1099367087 12:81780581-81780603 CTGTGAGGTTGCAGAGGAAAGGG + Intergenic
1099458463 12:82893942-82893964 CAGAGGAGATGGAGAGAAAAAGG + Intronic
1099895889 12:88645923-88645945 CTGTGGTCATGGGGAGGCAATGG + Intergenic
1099936946 12:89137692-89137714 CTTTGGGGACTGAGAAGAAAAGG + Intergenic
1100287868 12:93184507-93184529 GGGTGGGGATGGAGAGAGAAAGG + Intergenic
1100292110 12:93225744-93225766 CTCTGGGGAAGGAGAGAAATGGG - Intergenic
1100657275 12:96660374-96660396 GTATGTGGATGGAGAAGAAAAGG - Intronic
1101323955 12:103698284-103698306 CTGTGGGGAAGGAGAGGAGAAGG - Intronic
1101464551 12:104934865-104934887 CGGTGGGGAGGAAGAGGAATGGG + Intronic
1101896243 12:108759127-108759149 CTATGGGAATAGCGAGGAAAGGG + Intergenic
1101987267 12:109457261-109457283 CTGTGGGGTTGGGGAAGCAATGG + Intronic
1102728262 12:115084913-115084935 CTGGGGGGAGGGAGGGAAAAGGG + Intergenic
1102784512 12:115593388-115593410 CTGTGGGGATTCAGGGGAAAGGG - Intergenic
1102944357 12:116972721-116972743 CTGTGGGGCTGGATTGGAATAGG + Intronic
1103018329 12:117513505-117513527 CGCTGGGGAAGGAGAGGGAAAGG + Intronic
1103130511 12:118464451-118464473 CTTTGGGGATGCAGGGGAAAGGG - Intergenic
1103852328 12:123941230-123941252 CTGTGGGAATGCAGAGGAACAGG - Intronic
1103949013 12:124541519-124541541 GAGTGGAGATGGAGAGGGAAGGG + Intronic
1104222462 12:126798155-126798177 CTGAGTGAATGGGGAGGAAACGG - Intergenic
1104231906 12:126893109-126893131 CTGTGGGGGTGGGGAACAAAAGG + Intergenic
1105008962 12:132741739-132741761 CTGTCTGCAAGGAGAGGAAAAGG + Intronic
1105306200 13:19170689-19170711 CTCTGGGGGTGGAGAGACAAAGG - Intergenic
1105334804 13:19457520-19457542 CTGTGGGGAGGGAGGGGATGGGG - Intronic
1105673731 13:22647923-22647945 GTGTGGGAAGGGGGAGGAAACGG - Intergenic
1105675748 13:22670134-22670156 ATGTGCAGAGGGAGAGGAAAGGG - Intergenic
1105699279 13:22923861-22923883 CTGTCGGGGTGGAGGGGAAGGGG + Intergenic
1105835081 13:24203127-24203149 CTGTGGGGAGGGAGGGGATGGGG - Intronic
1105860114 13:24401871-24401893 CTGTGGGGAGGGAGGGGATGGGG + Intergenic
1106755439 13:32818529-32818551 CAGTGAGGATGTGGAGGAAAGGG + Intergenic
1106758525 13:32845719-32845741 CTGTGGGGAATCAGAGGAGATGG - Intergenic
1107580651 13:41780568-41780590 CTGTGGGGATGGAAAAGAAAGGG - Intronic
1107705853 13:43104194-43104216 CTGTGGGGAGGGATTGGCAATGG - Intronic
1107897042 13:44975534-44975556 TTGTGGGGATGGAGAGAACTAGG - Intronic
1108166563 13:47699423-47699445 CTGTGGAAAGGGAGAGGAAGAGG - Intergenic
1108183801 13:47868426-47868448 TTGTGGGGACATAGAGGAAAAGG + Intergenic
1108264694 13:48694807-48694829 GTGGGGGAATGGAGAGGAAGGGG + Intronic
1108489153 13:50962930-50962952 CTGAGGGGATAGGGAGAAAAGGG - Intronic
1108489970 13:50971685-50971707 CAGTGGGCATGAAGAAGAAAGGG - Intronic
1109166084 13:59037272-59037294 CTCTGGGGACTCAGAGGAAAGGG + Intergenic
1110412000 13:75214824-75214846 CCGTGGGGAAGGGGAGGAGAGGG - Intergenic
1111628739 13:90823003-90823025 CTATGGAGATGGAGAGTAGAAGG - Intergenic
1112230528 13:97585068-97585090 CTTTCTGGAAGGAGAGGAAATGG - Intergenic
1112785166 13:102943471-102943493 CTGGGGGGATTGGAAGGAAAAGG + Intergenic
1113102269 13:106733547-106733569 CTGGGGAGGTGGAGAGGCAATGG - Intergenic
1113599300 13:111557437-111557459 GAGTGGTGATGGAGAGAAAATGG + Intergenic
1113639418 13:111946485-111946507 TCGTGGGGATGGAGAGGCAGTGG - Intergenic
1113697876 13:112360375-112360397 TGGTGAGGATGCAGAGGAAAGGG - Intergenic
1113775497 13:112942863-112942885 ATGTGGGGATGGTGCGGAGAAGG - Intronic
1113868834 13:113545960-113545982 CAGTGGGGCTGGAGATGAAGGGG + Intronic
1114337250 14:21703278-21703300 CAATGAGAATGGAGAGGAAAGGG + Intergenic
1114421098 14:22583557-22583579 CTGTAATGATGGAAAGGAAATGG + Intronic
1114848401 14:26352179-26352201 TTGTGAGGATGCAGAGAAAAGGG - Intergenic
1114877991 14:26747178-26747200 CGGTGAGGATGTAGAGAAAAAGG + Intergenic
1115937648 14:38572445-38572467 CTTTGGGGACTCAGAGGAAAGGG - Intergenic
1116348151 14:43822828-43822850 CCATGGGGATGGAGATGAGATGG + Intergenic
1116350112 14:43850703-43850725 GTGTGGTGGTGGACAGGAAAAGG - Intergenic
1116471582 14:45291810-45291832 CTGGGGTGCTGGAGGGGAAATGG + Intergenic
1116491525 14:45509278-45509300 GTGTGGGGATAGAAAGTAAATGG - Intergenic
1116887582 14:50235999-50236021 CTGGGTGGCTGGAGATGAAAGGG + Intergenic
1116959809 14:50957279-50957301 CCGTGGGGAGGGAGAGGGAGAGG + Intergenic
1117237648 14:53795311-53795333 CTGCAGGGAAGAAGAGGAAAGGG - Intergenic
1117705514 14:58463216-58463238 GTGAGGAGATGGAGAGGAACAGG - Intronic
1118018543 14:61686426-61686448 GTCTGGGGGTGGTGAGGAAAGGG - Intergenic
1118227956 14:63920714-63920736 CCGTGGAGATGGAGAGAAATAGG + Intronic
1118322680 14:64762583-64762605 CTATGGGAATGGAGACGCAAGGG + Intronic
1118532674 14:66724512-66724534 CTGAGGGGCTGGAGTGGGAAGGG + Intronic
1118895400 14:69941496-69941518 CAGTGGGGATGGAAAAGAAGGGG - Intronic
1118920306 14:70143929-70143951 CTGTGGGGAAGAAGAGGGAGAGG - Intronic
1119068077 14:71550970-71550992 CAGTGTGGCTGGAGAGGAAAGGG - Intronic
1119068163 14:71551748-71551770 CAGTGTGGCTGGAGGGGAAAGGG - Intronic
1119195719 14:72715474-72715496 CTTTGGGGACAGAGAGGAAGGGG + Intronic
1119941826 14:78649364-78649386 AGGGGGGGTTGGAGAGGAAAAGG - Intronic
1120064357 14:80022693-80022715 CTGTGAGGTTGCAGAGAAAAGGG - Intergenic
1120215853 14:81679911-81679933 CTGTGGGACTTCAGAGGAAATGG + Intergenic
1121191914 14:92038414-92038436 CTTTGGGGATAGAAATGAAAGGG - Intronic
1121360169 14:93249838-93249860 CTGTAGGGCTGGAGAGGGGATGG + Intronic
1121632606 14:95432124-95432146 TTTTAGGGAAGGAGAGGAAAAGG + Intronic
1121689468 14:95865871-95865893 CACTGGGGAGAGAGAGGAAAAGG + Intergenic
1121708592 14:96019949-96019971 CTCTGGGGATGGAGCAGGAAGGG + Intergenic
1121821269 14:96969318-96969340 CTGTTAGGATGTAGAGAAAAGGG + Intergenic
1121859048 14:97299340-97299362 CAATGGGGATGGAGAGAGAAGGG - Intergenic
1122412952 14:101535235-101535257 CAGTGGGGATGGAGGGGACCCGG - Intergenic
1122422851 14:101588378-101588400 TTGTGGGGAGGGAGGGGGAAGGG - Intergenic
1122470099 14:101960639-101960661 ATGTGGGGATGGGGTGGGAAAGG + Intergenic
1122645715 14:103192439-103192461 CTCTGGGCATGGGGAGGGAATGG - Intergenic
1122758042 14:103997959-103997981 CTGTAGGGGAGCAGAGGAAATGG + Intronic
1122941326 14:104982697-104982719 CTGTGTGGGTGCAGAGGAAGTGG - Intergenic
1123903456 15:24898937-24898959 CTGTGGGGGTTGAAAGGAAGTGG + Intronic
1123952490 15:25294958-25294980 CTGGGGGAATGTAGAGAAAAGGG + Intergenic
1123992864 15:25696341-25696363 GTGTGGAGATGGATAGGAGAGGG + Intronic
1124218789 15:27831897-27831919 CTATGGGGATAAAGAGGAGAAGG - Intronic
1125135961 15:36342887-36342909 GTCTGAGGATGGAGAGGAGAAGG + Intergenic
1125477707 15:40058624-40058646 CTCAGGGGAAGGAGAGGAGAGGG + Intergenic
1125477758 15:40058897-40058919 CTGGGGAGATTGGGAGGAAATGG + Intergenic
1125715649 15:41818449-41818471 CTGTTGGGATGGAGAGGACTTGG + Intronic
1125767468 15:42145161-42145183 CTGGAGGGATGGAGTGGAAAAGG + Intronic
1126365440 15:47889507-47889529 CTGTGGAGATAGAGAGTAGAAGG + Intergenic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1126669596 15:51104215-51104237 CCGTGGAGATGGAAAGGAAAGGG - Intronic
1126757377 15:51937663-51937685 TTGTGGGGAATGAGAGGAAGGGG + Intronic
1126848066 15:52779933-52779955 ATGTGGAGCTGGGGAGGAAAAGG + Intronic
1127281769 15:57499062-57499084 GTGTGGGGATGGATTGGAAAGGG + Intronic
1127372579 15:58355158-58355180 GTGTGAGGATGGAGAGGGAGGGG - Intronic
1127473353 15:59309980-59310002 CTGTGAGAACAGAGAGGAAAGGG - Intronic
1128804779 15:70522464-70522486 CTGCGGGCAGGGAGAGGATAAGG + Intergenic
1129163000 15:73757660-73757682 CTGTGGCCATGGAGGGGAAGTGG + Intergenic
1129275586 15:74443187-74443209 CAGTGGGGAAGGAGAGGAGGAGG - Intergenic
1129286599 15:74530319-74530341 TTGTGGGGAGAGAGATGAAAGGG + Intergenic
1129309606 15:74696785-74696807 CTCTGGTGATGGAGGGGGAAGGG - Intergenic
1129379156 15:75154580-75154602 CGGTGGGGGTGGAGAGGCCAAGG - Intergenic
1129467426 15:75731808-75731830 ATGTGGGCGTGGAGAGGAAGAGG - Intergenic
1129468324 15:75736753-75736775 CTGTGGGGAGGGTGAGGCATAGG - Intergenic
1129589947 15:76905981-76906003 GGGTGGGGAGGGAGAGGGAAGGG - Intergenic
1129654472 15:77514882-77514904 CTGTGGGGATGCAGAGCAGCAGG + Intergenic
1129890754 15:79070206-79070228 CTTTGGAGATGGAGAGCACATGG + Intronic
1130114628 15:80996048-80996070 AAGTGGGGCTGGGGAGGAAATGG + Intergenic
1130333760 15:82941575-82941597 CAGTGGGCTTGGAGAGGAAGAGG - Intronic
1130531584 15:84750808-84750830 CTGTGGGGCTGGAGGGGGAAAGG + Intronic
1130908980 15:88257997-88258019 CTGTGGGAAAGGAGAAGAAAGGG + Intergenic
1130909808 15:88263231-88263253 CTCTGGGGATACAGAGGAAGTGG - Intergenic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131056096 15:89376030-89376052 CTGGGGTAATGGAGAGGACAAGG - Intergenic
1131229978 15:90652719-90652741 CAGTCTGGATGGAGAGGCAAAGG + Intergenic
1131263071 15:90899414-90899436 GTGTGAAGATGGAGGGGAAAAGG + Intergenic
1131646244 15:94348391-94348413 GAGAGGGGATGGAGAGGGAAGGG - Intronic
1131673632 15:94648681-94648703 CTGTGTTGATGGAGAGGTGAAGG - Intergenic
1131729028 15:95259673-95259695 CTGTGTAAATTGAGAGGAAAAGG - Intergenic
1131750992 15:95508023-95508045 CTGTGAGTATGTAGAGGAACTGG - Intergenic
1132185332 15:99798331-99798353 AAGTGGGGCTGGAAAGGAAAGGG + Intergenic
1132273845 15:100549304-100549326 TTGAGGGCATGGAGAGGGAATGG + Intergenic
1132357324 15:101181580-101181602 CAGTGGGGCTGGAGAGAGAAGGG - Intronic
1132435720 15:101800210-101800232 GAGTGGGGATGGAGAGAACAGGG + Intergenic
1132670078 16:1098931-1098953 CTGTGGGGCTGGAGCAGACACGG + Intergenic
1133395829 16:5446751-5446773 CGGTGGGGATGGACAGGAGGAGG - Intergenic
1133420110 16:5638698-5638720 CTGTGGGGACAGACAGGGAATGG - Intergenic
1134013783 16:10874427-10874449 GTGTGGGGATGGAGAGGGAGGGG - Intergenic
1134264786 16:12683709-12683731 CACTGAGGATGGAGAGGAGATGG - Intronic
1134841561 16:17405828-17405850 CTGAGGGCAGGGAGGGGAAATGG - Intronic
1135058299 16:19249379-19249401 GGGAGGGGATGGAGTGGAAAGGG + Intronic
1135184113 16:20300041-20300063 CTGGTGTGATAGAGAGGAAATGG + Intergenic
1135468899 16:22711973-22711995 GGGTGGGGATGGGGAGGGAAGGG + Intergenic
1135509336 16:23068766-23068788 CTGTGGCGAAGGAGATGACACGG + Exonic
1136155010 16:28376714-28376736 CTGTGGGGAGGGAGAGGGAGAGG - Intergenic
1136186370 16:28591074-28591096 CTTTGGGGCTGGAGTGGAAGAGG - Intronic
1136188858 16:28603790-28603812 CTTTGGGGCTGGAGTGGAAGAGG - Intergenic
1136208082 16:28738548-28738570 CTGTGGGGAGGGAGAGGGAGAGG + Intergenic
1136398051 16:30003803-30003825 CAGTGGGGAAGGAGAGGAGGTGG + Intronic
1136452347 16:30360448-30360470 CTGTGGAGGTGGAGAGGAGCAGG - Intronic
1137017613 16:35393180-35393202 CTTGGGGGAAGCAGAGGAAATGG - Intergenic
1137364936 16:47852485-47852507 TTGGGGGGGTGGAGAGGACAGGG - Intergenic
1137420191 16:48326812-48326834 CTGTGGGAAGAGGGAGGAAAGGG - Intronic
1137565205 16:49528488-49528510 CTTGGGGGAGAGAGAGGAAAGGG - Intronic
1137630784 16:49942706-49942728 CTGGAGGGATGTAGAGAAAAGGG + Intergenic
1138311332 16:56026015-56026037 TTGTGTGGATGGAGAGGACTGGG - Intergenic
1138535153 16:57656042-57656064 CTGGAGGGAGGGAGAGGAAAGGG - Intronic
1138565798 16:57831919-57831941 CTTTGGGGGTTGAGGGGAAAGGG + Intronic
1138684319 16:58711387-58711409 CCATGGGAATGGAGTGGAAAGGG - Intronic
1138924239 16:61571252-61571274 CAGTGGGGAGAGGGAGGAAATGG - Intergenic
1139099158 16:63744493-63744515 GTGTGGGGAAGGAGAGGTGATGG - Intergenic
1139278305 16:65748462-65748484 CAGTGAAGCTGGAGAGGAAAGGG - Intergenic
1139349719 16:66327477-66327499 CTGCGGGGAGGGAGAGGAACGGG + Intergenic
1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG + Intronic
1139594041 16:67947944-67947966 CTGTGGGGAGGGAGATTATAGGG - Intronic
1139910444 16:70394345-70394367 CTGAGGGGATGAGGAGGACAGGG + Intronic
1140104162 16:71944013-71944035 TTTTGGGTATGGAGAGGAAATGG - Exonic
1141137006 16:81473022-81473044 CTGAGGGTATGCAGAGGAGATGG - Intronic
1141152718 16:81575341-81575363 GTGTGGGGAGAGAGAGGAAGGGG - Intronic
1141248356 16:82331986-82332008 CTGTGGGGATGCACAGAAAAGGG + Intergenic
1141278218 16:82606966-82606988 CTGTGGGGCTCCAGAGGACAAGG + Intergenic
1141638467 16:85328212-85328234 CTGTGGAGGAGGAGCGGAAAGGG - Intergenic
1141822820 16:86459353-86459375 CTGTCGGGATGAAGTGAAAATGG + Intergenic
1141855396 16:86677732-86677754 GTGTGGGGATGGCGGGGAGAGGG - Intergenic
1142142672 16:88479542-88479564 CGGTGGGGACAGAGAGGAGACGG - Intronic
1142183601 16:88684013-88684035 CTGTGAGGATGAGGAGGAATAGG + Intronic
1142317913 16:89360739-89360761 ATGTGGCTATGGAGAGGAAGAGG + Intronic
1142344517 16:89545462-89545484 CTGTTGGGATGGAGAGTGAAGGG + Intronic
1142609438 17:1100541-1100563 TTTTGGAGTTGGAGAGGAAAGGG - Intronic
1142648335 17:1329663-1329685 CGGTGGGGATGGGAAGGCAAAGG - Intergenic
1142782413 17:2191434-2191456 ATGTGGGGTGGGGGAGGAAAAGG + Intronic
1142806881 17:2376000-2376022 CTGTGGGGATGCTGAGAAATGGG - Intronic
1142993220 17:3745866-3745888 ATGTGGGGAAGCAGAGGAGACGG - Exonic
1143173933 17:4945833-4945855 GTGTGTGTATGGGGAGGAAAGGG + Exonic
1143671929 17:8402717-8402739 CTGAAGGGATGCACAGGAAATGG - Intergenic
1144069552 17:11655847-11655869 CTTTGGGGACTCAGAGGAAAGGG + Intronic
1144472606 17:15558183-15558205 CTGTTGGGATCGAGAGCAGAAGG - Intronic
1144923875 17:18786508-18786530 CTGTTGGGATCGAGAGCAGAAGG + Intronic
1146279688 17:31537137-31537159 CAGTGGCGATGGGGAAGAAAAGG - Exonic
1146419934 17:32674157-32674179 GTGTGGGGGTGGAGTGGAAACGG + Intronic
1146449031 17:32957259-32957281 CTCTGAGGAGGGAGAGGAACAGG - Intergenic
1146659966 17:34659102-34659124 CTCTGGGAATGGGGAGAAAATGG - Intergenic
1146918847 17:36696341-36696363 ATGTGGGGATTGGGAGGAAGGGG - Intergenic
1146959791 17:36964302-36964324 GAGTGGGGATGGAGTGGAGATGG + Intronic
1147163189 17:38579437-38579459 CTCTGGGGAGGGAAGGGAAAAGG - Intronic
1147421657 17:40324866-40324888 CTGTGGGGTTGGTGGGGAAGAGG + Intronic
1147434611 17:40401853-40401875 CAGTGTGGCTGGAGAGGAGATGG + Intronic
1147484628 17:40800777-40800799 CAGTGGGGATGCAGAGAAGATGG + Intergenic
1147918183 17:43900830-43900852 CGGTGGGGATGGGGAGGAGGCGG + Intronic
1148354728 17:46968267-46968289 CAGTGCGGAGGGAGAGGAAGAGG - Intronic
1148595636 17:48853049-48853071 CTATAGGGATGTAGAAGAAAAGG + Intronic
1149306084 17:55347726-55347748 CTGGGGGGCTGGAGAGGAGTGGG - Intergenic
1149402315 17:56310917-56310939 CTGGGGGCAGGGGGAGGAAATGG - Intronic
1150247764 17:63689135-63689157 CTGTGGGGCAGAAGAGGACATGG - Intronic
1150582508 17:66487653-66487675 TGGTGGGGATGCAGAGAAAAGGG - Intronic
1150662315 17:67093720-67093742 CTGTGGGGTAGCAGTGGAAATGG - Intronic
1150692223 17:67376926-67376948 GTCTGGGGCTGGAGAGGCAATGG - Intergenic
1150935928 17:69635694-69635716 CTGTGGAGATGGACAGAAAAGGG + Intergenic
1151177123 17:72297838-72297860 GTGTGGGGATGACGAGGCAAGGG + Intergenic
1151190176 17:72392628-72392650 TTGGGGAGATGGAGAGGGAAAGG - Intergenic
1151247683 17:72807666-72807688 CAGTGGGCCTGGAGAGGAAATGG + Intronic
1151315661 17:73320596-73320618 TTGTGGGGAGAGTGAGGAAAAGG + Intergenic
1151390783 17:73785444-73785466 CAGAGAGGATGGAGAGGAAGAGG + Intergenic
1151675455 17:75595145-75595167 GTGCAGGGATGGAGAGGTAAAGG + Intergenic
1152793553 17:82295050-82295072 CTGTGAGGATGTGGAGGAAATGG - Intergenic
1153292123 18:3511811-3511833 CTCTGGGGATGAAAAGGAATGGG - Intronic
1153524010 18:5977978-5978000 CTCTGGGGATGAATGGGAAATGG - Intronic
1154339703 18:13492771-13492793 CTGTGGGGATGGAGAAAATGAGG - Intronic
1155488245 18:26370670-26370692 CTGAGGGGATGGTGTGGGAATGG + Intronic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1155788088 18:29927281-29927303 TTGTGGGTTTGGAGAGAAAAAGG + Intergenic
1155906484 18:31458377-31458399 AAGTGGGGGTGGAGAGGGAAAGG + Intronic
1156187351 18:34678452-34678474 CAGTGGGGGTGGAAAGGGAAGGG - Intronic
1156440638 18:37183941-37183963 TTGTGGGGCAGGAGAGGAAGGGG - Intronic
1156558953 18:38099642-38099664 ATGTGGAGAGGAAGAGGAAAAGG + Intergenic
1156623819 18:38884667-38884689 CTTTTGGGAGGGAGAGGCAAAGG - Intergenic
1157467724 18:47961857-47961879 CTGGGGGGATTGGGTGGAAATGG - Intergenic
1157869988 18:51221167-51221189 CTTTGGGGAGTCAGAGGAAAAGG + Intergenic
1157993606 18:52527860-52527882 CTCTGGGGAGGGAGAGCAACTGG + Intronic
1158452199 18:57576858-57576880 CTGTCTGGAGGGAGAGGAGATGG - Intronic
1158973203 18:62687379-62687401 CTTTGGGGATGGAAGGGAACAGG - Intergenic
1159374002 18:67567226-67567248 CAGTGGTGATGGATAGGAAGAGG - Intergenic
1159904698 18:74078644-74078666 CTGTGAGGAGAAAGAGGAAAGGG - Intronic
1160422968 18:78761124-78761146 AGGTGAGGATGCAGAGGAAAGGG + Intergenic
1160799211 19:960069-960091 CTGTGAGGGTGGAGAGGGGATGG - Intronic
1161378283 19:3951063-3951085 CTGTGGGGAGGAGGAGGAAGAGG - Intergenic
1161438551 19:4278454-4278476 TTGGGGGGTGGGAGAGGAAAAGG - Intergenic
1161811794 19:6475642-6475664 ATCTGGGGATGTAGAGGAAGGGG + Intronic
1161966254 19:7550824-7550846 CTGGGGAGAGGGAGAGGACAGGG - Intronic
1161994386 19:7703596-7703618 CTGTGGGGATGGGGAGAAGCAGG - Intergenic
1162140169 19:8580717-8580739 CTGGGGGGATGGAGAGGGGCTGG - Exonic
1162335220 19:10055968-10055990 ATGTGGGGATGAAGAAGAGATGG - Intergenic
1162614827 19:11790490-11790512 CTGTGAGGATGTAGAGAAAAAGG + Intergenic
1162753684 19:12844300-12844322 CTATGGGCATGGATAGAAAAGGG - Intronic
1162837892 19:13333325-13333347 CTGTGGGGATGTCAAGGGAAGGG - Intronic
1163092857 19:15033339-15033361 CTCTGGAGGTGGAGAGGCAAAGG - Intergenic
1163376317 19:16933695-16933717 TGGTGAGGATGGGGAGGAAATGG + Intronic
1163608947 19:18291445-18291467 CTGCGGGGATGGGGAGGCACCGG + Intergenic
1163654199 19:18536267-18536289 CTGTGAGGATGAACAGAAAAGGG + Intronic
1164146459 19:22515454-22515476 CAGTGAGGAGTGAGAGGAAAAGG + Intronic
1164934966 19:32202967-32202989 CTGGGGAGATGGTGATGAAAAGG - Intergenic
1165121289 19:33560513-33560535 CTGTGGGGAAGGACAGGAGTGGG - Intergenic
1165307912 19:35013518-35013540 CTGTGGGAAAGGGGAGGAAGCGG - Intronic
1165340681 19:35209628-35209650 CTTTGGGGATGGAGTGGAGGTGG + Intergenic
1165431601 19:35776162-35776184 CGGGGGGGATTGAGAGGAACTGG - Intronic
1165586728 19:36923305-36923327 GTGTTGGGGTGGAGATGAAACGG - Intronic
1165856258 19:38880737-38880759 CTGTGGGGAGGGGGAGCTAAGGG + Intronic
1165871551 19:38976326-38976348 CTGGGGGGATGGGGAGGACAGGG - Intergenic
1165968228 19:39602879-39602901 GTGTGTGAATGGAGAGTAAAGGG + Intronic
1165993448 19:39828584-39828606 CTGCGGGGGAGGGGAGGAAATGG + Intronic
1166371504 19:42303822-42303844 CTCTGGGGAGGAAGAGGAGAAGG + Intronic
1166580383 19:43893505-43893527 TGGTGAGGATGTAGAGGAAAGGG - Intronic
1167142896 19:47664570-47664592 CCGTGGGGATGGGGAGGGATCGG + Intronic
1167147881 19:47693933-47693955 CTGTGGGGAATGAGAGGCGAGGG + Intronic
1167284512 19:48591584-48591606 GTGTGCGGATGGTGAGGAGAGGG - Intronic
1167420430 19:49399441-49399463 CTCTGGGGTTGGTCAGGAAAAGG + Exonic
1167615370 19:50530099-50530121 CTGTGGGGATGGAGAGGAAATGG - Intronic
1168075201 19:53977579-53977601 CTGTGGGGATGGGGAGAGAGAGG - Intronic
1168276883 19:55283893-55283915 CTGGAGGGATGGAGAGGAGGTGG - Intronic
1168292872 19:55365636-55365658 GGGTGGGGACGGAGGGGAAAGGG - Exonic
1168575205 19:57503446-57503468 CTGTGGGGATAGACATGAGATGG + Intronic
925132217 2:1502066-1502088 CCCAGGGGATGGAGAGAAAATGG + Intronic
925321121 2:2969723-2969745 CTGTGGGGACTTGGAGGAAAGGG - Intergenic
925322642 2:2987340-2987362 CTTTGGGGACTCAGAGGAAAGGG + Intergenic
925330767 2:3056877-3056899 CTGAGGGAATTGAGAGGCAAGGG - Intergenic
925464685 2:4096313-4096335 CTCTGGGGAAGGCGAGGATATGG + Intergenic
925993471 2:9272192-9272214 TTGTGGGGATGTGGAGAAAAGGG - Intronic
926051101 2:9745269-9745291 CAGTGGGTGTGGGGAGGAAAGGG - Intergenic
926114982 2:10207265-10207287 CCATGGAGATGGAGAGAAAAGGG - Intronic
926233844 2:11024598-11024620 CTGTGGGGATGGGGCGGCCAAGG - Intergenic
926463120 2:13158287-13158309 CTGTGGCGATTGAGGGGAAACGG + Intergenic
926918459 2:17915897-17915919 TTGTGGGGAGGGAGAGAGAAAGG + Intronic
927139244 2:20118429-20118451 CTGCCGGGCTGGAGAGGAAGTGG + Intergenic
927272472 2:21227487-21227509 GTGAAGGGTTGGAGAGGAAATGG - Intergenic
927443114 2:23133751-23133773 ATGTGGGGATGGACAGGCAAGGG + Intergenic
927554457 2:24022410-24022432 CTGAGGAGATGGACAGGAAGTGG - Intronic
927784746 2:25965910-25965932 CTGTGGGGGTGGAAAAGACAGGG + Intronic
928314955 2:30237838-30237860 CTGTGGGGTGGGTGAGTAAATGG + Intronic
928549105 2:32354595-32354617 CTGTGGGGCTGGAGTGAGAAGGG - Intergenic
928624701 2:33127811-33127833 ATGTGGGGAAGAAGAGGAAAAGG + Intronic
929187226 2:39108064-39108086 AAGTGGGGATGGTGATGAAAGGG - Intronic
929734898 2:44537531-44537553 TGGTGAGGATGGAGAGAAAAGGG + Intronic
930101396 2:47606188-47606210 GTGTGGGGAGGGACAGGACAGGG - Intergenic
930253266 2:49060195-49060217 CGGTGAGGATGCAGAGAAAAAGG + Intronic
930363805 2:50413539-50413561 CTGTGAGGATGTGGAGAAAAGGG + Intronic
930368328 2:50471741-50471763 GTGTGAGGATGGAGAGGATCAGG + Intronic
930836357 2:55797962-55797984 CTTTGGGGATGTAGGGGAAAGGG + Intergenic
931083021 2:58796895-58796917 CAGTGGAGAGGGAGAGGAAAAGG - Intergenic
931121309 2:59223286-59223308 CTGTGGGGATGGGAAGCAACAGG + Intergenic
931376635 2:61713858-61713880 CAGTGGGGATGGGGAGGGACAGG - Intergenic
931669813 2:64636879-64636901 CAGAGGGGAGAGAGAGGAAATGG + Intronic
931774432 2:65528250-65528272 CTGCAGGAATGGAAAGGAAAGGG + Intergenic
932069659 2:68606644-68606666 ATGTGGGGATTGAAAGGAAATGG + Intronic
932511479 2:72297358-72297380 GTGTGAGGAGGGAGAGGAACAGG - Intronic
932683763 2:73850304-73850326 CTGTCGGGATGGAGTGGAGCAGG + Intronic
933192486 2:79350770-79350792 TGGTGTGGATGCAGAGGAAAGGG - Intronic
933623213 2:84568567-84568589 CTGTGGGGAGGGAGAACAACAGG + Intronic
934663327 2:96154522-96154544 CAGTGGGTACGTAGAGGAAAAGG - Intergenic
935585404 2:104796320-104796342 TTGTGGAGATGGAAAGGAACTGG + Intergenic
935836270 2:107058031-107058053 CTTTGGGGACTCAGAGGAAAGGG - Intergenic
935939043 2:108219741-108219763 CTGTGGGGAGGGAGGAGGAAAGG + Intergenic
936049102 2:109209609-109209631 CTGTGTAGGTGGGGAGGAAAGGG + Intronic
936125857 2:109788754-109788776 CTGTGGGGGTGGACAGGTATCGG - Intergenic
936165066 2:110114169-110114191 CTGGGGGGAAAGAGAGGGAAAGG - Intronic
936218836 2:110582714-110582736 CTGTGGGGGTGGACAGGTATCGG + Intergenic
936533364 2:113292101-113292123 GCCTGGGGATGGAGAGGAACTGG - Intergenic
936989633 2:118348864-118348886 TGGTGGGGATGGAAAGGAAAGGG + Intergenic
937064859 2:119010304-119010326 CTGAGTGGATGGGGAGGAACAGG + Intergenic
937226481 2:120373267-120373289 CTCTGGGGAGGGAGAGAAGAAGG + Intergenic
937239711 2:120452219-120452241 CAGTGGGGATGGAGTGAAAGTGG - Intergenic
937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG + Intergenic
937842133 2:126534639-126534661 CAGTGGTTAAGGAGAGGAAAAGG + Intergenic
937907464 2:127059156-127059178 CTGTGGGGGAGGACAAGAAAGGG + Intronic
937975267 2:127578314-127578336 CCTTGGGGAGGGAGAGGGAAGGG + Intronic
938302041 2:130222755-130222777 CTGTGGGAAGGGAAATGAAATGG + Intergenic
938454659 2:131451697-131451719 CTGTGGGAAGGGAAATGAAATGG - Intergenic
938464069 2:131515491-131515513 CTGTGGGGAAGCAGAGCAACTGG + Intergenic
938701784 2:133886017-133886039 CTGGGAGGAAGGAAAGGAAAGGG - Intergenic
939378960 2:141409489-141409511 CTCTGTGGAAGGAGAGGAGAAGG - Intronic
939625562 2:144473115-144473137 CTATGAGAATGGAAAGGAAAGGG + Intronic
939631488 2:144531291-144531313 GTGTGGGATTGGAGGGGAAAGGG - Intergenic
939671804 2:145022174-145022196 GTGGGGGGAAGGAGAGGAAGAGG - Intergenic
940277909 2:151958655-151958677 TAGTGGGGATGGAGAGGAGGAGG - Intronic
940519569 2:154726998-154727020 CTTTGGGGACTAAGAGGAAAGGG + Intronic
940855067 2:158723309-158723331 CTGTGGGGGTGGAGGACAAATGG - Intergenic
941176309 2:162201467-162201489 ATGTGGGGAGGGCAAGGAAAAGG - Intronic
941188026 2:162341740-162341762 GGTTGGGGATGGAGAGAAAAGGG + Intronic
941225144 2:162838827-162838849 CTGTGGGGGTGGGGTGGGAAGGG + Intergenic
942246536 2:174013337-174013359 CTCTGGGGAAGGGGAGGAGAGGG - Intergenic
942529902 2:176898391-176898413 TGGTGAGGATGGAGAGAAAAGGG - Intergenic
942613062 2:177762091-177762113 CTGTGAGGATGGACAGGAGCAGG + Intronic
942865801 2:180673382-180673404 CTAAGGGCATAGAGAGGAAATGG + Intergenic
943584751 2:189725178-189725200 CTGTGGGGTTGGATTGGAACTGG + Intronic
943615289 2:190085149-190085171 TTGAGGGGAGGGAAAGGAAATGG + Intronic
943901676 2:193446684-193446706 CAGTGAGGATGCAGAGAAAAAGG - Intergenic
945829251 2:214763396-214763418 CTGAGGGGATGATGAGGCAAAGG + Intronic
945869862 2:215215316-215215338 ATGTGGGGTGGGAGAGGAAAGGG + Intergenic
946348151 2:219128010-219128032 CAGTGGGGATGAGTAGGAAAAGG - Intronic
946519973 2:220453821-220453843 CTGTGCTGATGTAGGGGAAAGGG + Intergenic
946570472 2:221018626-221018648 CAGTCTGGATGGAAAGGAAATGG + Intergenic
946862209 2:224011031-224011053 CTGTGGGAATGGAGGGGGAGGGG + Intronic
947106684 2:226675074-226675096 GTGTGGGGAGGGAGAGGATCAGG + Intergenic
947398365 2:229708432-229708454 ATGTGGGGAAGCAGAGGAAGGGG + Intronic
947651419 2:231789498-231789520 CTGTGAGGATGAAGAGGAAGGGG - Intronic
948179182 2:235966286-235966308 CTCTGGGGATGGAGAAGAGGGGG + Intronic
948719449 2:239889468-239889490 CTGTGGGGATGGAGTGGGACCGG - Intergenic
948932141 2:241138732-241138754 CTGTGTGGATGAAGAGGATGCGG - Exonic
1169066851 20:2698564-2698586 AAGGGGGGATGTAGAGGAAAGGG + Intronic
1169230921 20:3888689-3888711 CTGTGGCGAAGGAGGGGAAGTGG - Intergenic
1169969718 20:11256380-11256402 CTGTGGGGACTCAGGGGAAAGGG - Intergenic
1170143052 20:13144151-13144173 GTTTGGGGATGGGGAGGAAAGGG - Intronic
1170335581 20:15267168-15267190 GAGTGGGGATGCAGAGGAGAGGG - Intronic
1170393983 20:15906075-15906097 ATATGGGGTTTGAGAGGAAAGGG + Intronic
1170589814 20:17763334-17763356 CTGTAGGGAGGGGAAGGAAATGG - Intergenic
1170613762 20:17933555-17933577 GGGAGGGGATGGAGAGCAAAGGG + Intergenic
1170793817 20:19529482-19529504 TTGTGGAGATGGAGAGGAGATGG - Intronic
1170914619 20:20610647-20610669 CTGTGGAAAGGAAGAGGAAAAGG - Intronic
1171093229 20:22306000-22306022 CTGAGGGGCTGGAGCGGGAAAGG + Intergenic
1171277992 20:23874948-23874970 CCATGGGGGTGGAGAGGAAATGG + Intergenic
1171796246 20:29568704-29568726 CTGTGGGGATGCAGAGTAATAGG + Intergenic
1171851991 20:30315463-30315485 CTGTGGGGATGCAGAGTAATAGG - Intergenic
1172472201 20:35207862-35207884 TTTTGTGGAAGGAGAGGAAATGG - Intergenic
1172738583 20:37147834-37147856 CTGTGGGGACCCACAGGAAAAGG - Exonic
1172875450 20:38161355-38161377 ATGTCGGGGTGGAGAGGAAGTGG + Intronic
1172895946 20:38300077-38300099 CTGAGGGGAGGGAGAGTACAGGG + Intronic
1173183303 20:40820708-40820730 CTGTCGGGGTGGAGGGGACAGGG - Intergenic
1173197540 20:40928255-40928277 CTGTGGGAGTGCAGAGGAGAGGG - Intergenic
1173250219 20:41360436-41360458 CTTAGGGGAAGGAAAGGAAAAGG + Exonic
1173779041 20:45738004-45738026 CTGTGGGGCTGAACAGGAGAGGG - Intergenic
1174273005 20:49383237-49383259 TTGTGGGGATGGAAAGCAATGGG - Intronic
1174437830 20:50523759-50523781 CTGTGGGGATGCTCAGGAAAAGG + Intronic
1175062294 20:56254637-56254659 ATGAGGGGAAGGAGAGGAGAAGG + Intergenic
1175689475 20:61055159-61055181 CTTTGGAGATGCAGAAGAAAAGG + Intergenic
1175778792 20:61669224-61669246 CTGTGGGCCTGGAGAGTTAAAGG + Intronic
1175792165 20:61746525-61746547 GTGTGGGGAAGGAGTGGAAAAGG + Intronic
1176301137 21:5099576-5099598 CCCTGGGAGTGGAGAGGAAACGG + Intergenic
1176425789 21:6547541-6547563 CTCGGGGGATGGAGAGGAGAAGG - Intergenic
1176457823 21:6928780-6928802 CTCTGGGGACGGAGAGCAGAGGG + Intergenic
1176640422 21:9298563-9298585 ATGTGGGGGTTGAAAGGAAATGG - Intergenic
1176835995 21:13793864-13793886 CTCTGGGGACGGAGAGCAGAGGG + Intergenic
1177198956 21:17932313-17932335 TTGTGAGGATGAAGAGAAAAGGG + Intronic
1177501692 21:21964762-21964784 ATGTGGGGGTTGAAAGGAAATGG + Intergenic
1177867860 21:26534533-26534555 GACTGGAGATGGAGAGGAAAGGG + Intronic
1178068880 21:28938898-28938920 CTGCGGGGTTTGAGAGGAAATGG + Intronic
1178251098 21:31004059-31004081 ATGTGGGCATTGAGAGGAAAAGG + Intergenic
1178319685 21:31595941-31595963 CTTTGGGGATGGAAGAGAAAAGG + Intergenic
1178498348 21:33105550-33105572 CTGTGTGGACAGGGAGGAAATGG - Intergenic
1178720000 21:34999636-34999658 ATGTGGGGACCGAGATGAAAGGG + Intronic
1178930154 21:36810994-36811016 CAGTGCTGATTGAGAGGAAAAGG + Intronic
1179002104 21:37471198-37471220 ATGTGGTGATGTAGATGAAAAGG + Intronic
1179327351 21:40360948-40360970 CTGTGAGGGTGCAGAGAAAAGGG - Intronic
1179701280 21:43155858-43155880 CTCGGGGGATGGAGAGGAGAAGG - Intergenic
1179855892 21:44162322-44162344 CCCTGGGAGTGGAGAGGAAACGG - Intergenic
1179933542 21:44588984-44589006 CTTTGGGGACTGAGAGGGAAAGG + Intronic
1180013978 21:45071137-45071159 CTGTGTGGCTGGAAAGGGAAAGG + Intergenic
1180131672 21:45830661-45830683 CAGTGGGGAAGGGGTGGAAAGGG - Intronic
1180349447 22:11787946-11787968 ATGTGGGGGTTGAAAGGAAATGG - Intergenic
1180667775 22:17528368-17528390 CCGTGGAGATAGAGGGGAAAAGG + Intronic
1180855412 22:19041960-19041982 CTGAGGGGGAGGGGAGGAAATGG + Intronic
1181305761 22:21916467-21916489 GGGTGGGGATGGAGGTGAAAGGG - Intergenic
1181477247 22:23176402-23176424 ATGTGGGGATTGAAAGGAAGCGG - Intergenic
1181793235 22:25283499-25283521 CTGAGGGGATGGAGTTGGAAAGG - Intergenic
1182255032 22:29031797-29031819 CTGTGGTCAGGGAGGGGAAAAGG - Intronic
1182868384 22:33624868-33624890 CAGTGGGGATGGAGAGAACGGGG + Intronic
1182970728 22:34573618-34573640 CTATGGGGATTTAGGGGAAAAGG - Intergenic
1183203095 22:36399593-36399615 CTTTGTGGTTGGAGAGGAAAGGG - Intergenic
1183237459 22:36630285-36630307 CTGTGGGCGTGGACAGGAGATGG + Intronic
1183399348 22:37592871-37592893 CTGTGGGGATTGAGAAAAGAGGG - Intergenic
1183438631 22:37810004-37810026 CTGAGGTGAAGGAGAGGAGATGG - Exonic
1183718284 22:39547085-39547107 CTGTGGGCATGGAGAGGGAGAGG + Intergenic
1183967657 22:41452291-41452313 CTGCGTGGAAGGAGAGGCAAAGG + Intergenic
1183983303 22:41555248-41555270 CTGGGGGGACTGACAGGAAATGG + Intergenic
1184115171 22:42417918-42417940 CTGTGGGGGTGGGGAGGCACAGG - Intronic
1184142077 22:42583786-42583808 CTGTGCAGAAGGAGAGGAAGGGG - Exonic
1184802451 22:46769840-46769862 CTGTGGGGTTGGAGAGGATCGGG + Intronic
949266600 3:2164007-2164029 CTTTGGGGATTCAGGGGAAAGGG + Intronic
949935091 3:9110264-9110286 CTGTGGAGATGAAGAGGAGCAGG + Intronic
950011579 3:9727898-9727920 CAGTGGGGAGGGAGAGAAAGTGG + Intronic
950021558 3:9791486-9791508 CTGTGGAGCTGGAGAGGACAGGG + Exonic
950043419 3:9934258-9934280 CTGTGGGGATGGGTGGGGAAAGG - Intronic
950100982 3:10356650-10356672 CTGTGGGGTTGGGAAGGACAGGG + Intronic
950154235 3:10709649-10709671 AGGTGGGGAAGGAGTGGAAAGGG - Intergenic
950194278 3:10998300-10998322 CTGTGAGGCTGGGGAGAAAAGGG + Intronic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
950729138 3:14941546-14941568 GTGGGGGGATGGAGGGGCAATGG + Intergenic
950753708 3:15154443-15154465 CTGTGGCAAGGGAAAGGAAATGG - Intergenic
950890443 3:16399820-16399842 CCGTGGAGAGGGAGAGGACAAGG - Intronic
952064972 3:29558322-29558344 CTAGGGGGTTGAAGAGGAAAGGG + Intronic
952364392 3:32662066-32662088 CTGAGGGGAGGGAGTGGAGAGGG + Intergenic
952503125 3:33982934-33982956 GTCTGGGGATGGGGAGCAAAGGG - Intergenic
952686050 3:36149415-36149437 GAGTGGGGAAGGAGAGGAAGGGG + Intergenic
952712136 3:36442470-36442492 CTGTGGGGATGGACAGAGCAAGG + Intronic
953138850 3:40208877-40208899 GGGTGGGAATGGAGAGGAAGAGG - Intronic
953472656 3:43180161-43180183 TTGTGGGGAGGGAGAGGAAGAGG + Intergenic
953620893 3:44531889-44531911 CTGTGGAGATGGAAAGAAATGGG - Intergenic
953639969 3:44697883-44697905 CTTTGGGGACTTAGAGGAAAGGG + Intergenic
953931011 3:47005653-47005675 GTGTAGGGATGGAGAGCAGATGG + Intronic
954222448 3:49163033-49163055 CTGTTGGGCAGAAGAGGAAAAGG - Exonic
954332448 3:49898198-49898220 CTGTGGGGGTGGAACTGAAATGG + Exonic
954419771 3:50412613-50412635 GGGTGGGGAGGGAGAGGATAGGG + Intronic
955051584 3:55416026-55416048 TTGTGGAGATGGGGAGGGAAGGG - Intergenic
955192207 3:56771850-56771872 CCACTGGGATGGAGAGGAAAGGG + Intronic
955202694 3:56865133-56865155 CTGTGGGGATGGCGAGCACATGG + Intronic
955333734 3:58068409-58068431 CTGTGTGGATGGAAGGGATATGG + Intronic
956136060 3:66100268-66100290 CTGTGGGGATGGAGAGCATGAGG - Intergenic
956256673 3:67290599-67290621 CAGTGTGGCTGCAGAGGAAAGGG - Intergenic
956491592 3:69778053-69778075 CTGTGGAGATGGAGAGGAGGTGG + Intronic
956559742 3:70561819-70561841 CAGTGAGGATGTGGAGGAAAGGG - Intergenic
957481420 3:80801880-80801902 CAGTGAGGATGCAGAGAAAATGG + Intergenic
957571272 3:81949999-81950021 CTTTGAGGAAGGAGAGAAAAAGG - Intergenic
957632661 3:82737657-82737679 TTGTGGGGTGGGAGAAGAAATGG - Intergenic
957721126 3:84000539-84000561 CTTTGGGGATTCAGAGGGAAAGG - Intergenic
958444417 3:94197383-94197405 CTTTGGGGACTCAGAGGAAAGGG - Intergenic
958797092 3:98717336-98717358 CTGAGGAGATTGGGAGGAAAAGG - Intergenic
958966468 3:100564049-100564071 GTTTGGGGATGGAGAGGCAAGGG + Intronic
959304851 3:104649291-104649313 TGGTGAGGATGGAGAGAAAAGGG - Intergenic
959388903 3:105748502-105748524 CAGTGGGGATATAGAGGAAAAGG + Intronic
959578495 3:107960723-107960745 CAGTGGGGAGGGAGAGAGAAAGG + Intergenic
960423869 3:117482358-117482380 CTGTGGGACTTGAGAGGAAGAGG + Intergenic
960637398 3:119796831-119796853 CTTTGGGCATGAAGAGGAAGAGG - Intronic
960692078 3:120357080-120357102 CTGTGGGGTTGGAGAGAGAAGGG + Intergenic
960915858 3:122694179-122694201 CTGTGGGAAATGGGAGGAAAGGG + Intronic
961073527 3:123961094-123961116 CTGTGGGGATGGAGAGGGACAGG - Intronic
961083027 3:124042699-124042721 CTGTGGGGAGGCAGGGGAAGAGG + Intergenic
961115185 3:124323281-124323303 CTGTGGGGATTCAGAGGGAAGGG - Intronic
961310041 3:125990726-125990748 CTGTGGGGATGGAGAGGGACAGG + Intergenic
961362185 3:126375045-126375067 GTGTGGGGTTGGGGAGGATAAGG + Intergenic
961792910 3:129389512-129389534 ATGTGGGGGTTGAAAGGAAACGG - Intergenic
962038530 3:131680827-131680849 CTGTGGGGACGCAGGGGAAAGGG - Intronic
962166590 3:133055660-133055682 CAGTGGGCATGGAAAGAAAAAGG - Intronic
962532726 3:136298415-136298437 GTGAGGGGAAGGAAAGGAAATGG - Intronic
962658136 3:137570537-137570559 CTATGGGTATGGAGAGTAAGGGG - Intergenic
962925028 3:139985028-139985050 CAGTGGAGATGGAGAGAAATGGG - Intronic
963275322 3:143324281-143324303 CTGTGGGAATGGAGAGGGAGAGG - Intronic
963390822 3:144661631-144661653 CTGTGAGGATGCAGAGCAATTGG - Intergenic
963516080 3:146309866-146309888 CTGGGTGCAGGGAGAGGAAATGG - Intergenic
963732045 3:148984451-148984473 CTTTGAGGAAGGAGAGGAGAGGG - Intergenic
963829613 3:149992844-149992866 CTATGGATATGGAGATGAAAGGG - Intronic
963942228 3:151106342-151106364 CTGTAGGAAAGGAAAGGAAAGGG - Intronic
964563853 3:158027853-158027875 CTGAGGGTAGGGGGAGGAAATGG - Intergenic
964630525 3:158804962-158804984 TTGAGGGGATGGAGAGGGTAGGG + Intronic
964764765 3:160169318-160169340 GTGTGGGAATGGGGAGGAATAGG - Intergenic
965053915 3:163689552-163689574 ATGTGGGGATTGAGAGAAAGTGG - Intergenic
965284189 3:166796145-166796167 TAGTGAGGATGCAGAGGAAAGGG + Intergenic
966007339 3:175031751-175031773 CAGTGAGGCTGGAGAGAAAAAGG - Intronic
966157005 3:176927433-176927455 CTGTGGGGCGTGACAGGAAAGGG - Intergenic
966229425 3:177634971-177634993 CTTTGGGGATTCAGGGGAAATGG - Intergenic
966248114 3:177831379-177831401 CTGGGTGGATGGACAGTAAAGGG + Intergenic
966319389 3:178684335-178684357 GTGGGGGGTGGGAGAGGAAATGG + Intronic
966431257 3:179833172-179833194 CAGTGGGAATGGAGAGGAAAGGG + Intronic
966669344 3:182509337-182509359 TTGTGGGGCTGGAGAGCAAAGGG + Intergenic
966876285 3:184323711-184323733 CTGTTGGGAGGGACAGGAGAGGG - Intronic
966925927 3:184644549-184644571 CCGTGGGGAGGGAGAGGCAAGGG - Intronic
967098743 3:186198467-186198489 CTCTAGGGATGGAGCAGAAATGG + Intronic
967229121 3:187320895-187320917 CAGTGGACCTGGAGAGGAAAAGG - Intergenic
967943905 3:194787141-194787163 CTGTGGGAATGGAGAGGGAGGGG + Intergenic
968315506 3:197720941-197720963 CGGTGAGGATGGGGAGAAAAGGG - Intronic
1202746471 3_GL000221v1_random:106461-106483 ATGTGGGGGTTGAAAGGAAATGG + Intergenic
968577774 4:1375953-1375975 CTGTGGGGGTGGGGAGGGAGAGG + Intronic
968699542 4:2048026-2048048 CTGTGGGGATGAGGTGGAGAGGG + Intergenic
969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG + Intronic
969337356 4:6519489-6519511 CTGTGTGGCTGCAGAGGAGAGGG - Intronic
969593414 4:8134417-8134439 CTGTGGGTGTGGAGAGGGAGGGG - Intronic
969684818 4:8665514-8665536 CTGAGTTGATGGAGAGGAAGTGG + Intergenic
970083406 4:12316368-12316390 CTGTGGGGATAGAAAAAAAATGG - Intergenic
970230402 4:13904151-13904173 GTGTGGGGGTGGGGAGGAAAAGG + Intergenic
970689811 4:18609944-18609966 CAGTGGGCCTGGAGAGCAAATGG + Intergenic
971021765 4:22544208-22544230 TGGTGGGAGTGGAGAGGAAATGG + Intergenic
972026444 4:34384183-34384205 GGGTGGGGATGGCTAGGAAATGG - Intergenic
972231901 4:37082475-37082497 CTGTGGGGAGTGAAAGGCAAGGG + Intergenic
973184327 4:47306568-47306590 CTCTGGGGAGGGAGAGGTAGGGG - Intronic
973757121 4:54086348-54086370 AGGTTGGGATGGAGATGAAATGG - Intronic
974462873 4:62210609-62210631 CTGTGGGGCTTTAAAGGAAAGGG + Intergenic
974789428 4:66668134-66668156 GTGTGGGGATAGGGAGGATATGG - Intergenic
976218832 4:82739906-82739928 CGGTGGGGATGGAGAGGGGTCGG - Intronic
976291806 4:83426347-83426369 CTGAGGGGAAGGAGAAGGAAAGG + Intronic
976521764 4:86035958-86035980 ATGTGGGTATAGAGAGTAAATGG + Intronic
976748967 4:88434527-88434549 GGTTGGGGATGGAGAGGAGATGG + Intronic
976847803 4:89510312-89510334 TTGTGAGGAAGGAGAAGAAATGG + Intergenic
977459505 4:97307759-97307781 CTTTGGGGAAGAAGAGGTAAGGG + Intronic
978538420 4:109787958-109787980 CTGAGTGGATTGAGAGGATAAGG - Intronic
978613948 4:110574820-110574842 ATGTTGGCATTGAGAGGAAAAGG + Intergenic
979610810 4:122687057-122687079 CTGGGGGGAGGGAGAAGGAATGG + Intergenic
979962897 4:127042383-127042405 TGGTGAGGATGCAGAGGAAAGGG + Intergenic
980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG + Intergenic
980785245 4:137545300-137545322 CTCTGGGGATGGAAAGGGAAGGG - Intergenic
980989448 4:139726530-139726552 CTGTGGGGACTGAGTTGAAAGGG + Intronic
981011358 4:139928541-139928563 CTGTAAGGATGGGGAGGATATGG + Intronic
981027182 4:140088461-140088483 CAGTGGGAATGGAAAGGAAGAGG - Intronic
981312920 4:143314228-143314250 GTGTGGGGATGGAAAGCAACAGG + Intergenic
981658288 4:147137181-147137203 CAGTGGGGATGGAGAGAACTAGG - Intergenic
981820899 4:148886482-148886504 CTGTAGGAATTGAGAGGCAAAGG + Intergenic
982198327 4:152937037-152937059 GTGTGGGGAGGGGGAGGAAGCGG + Intronic
982316331 4:154035801-154035823 CTGTCGGGGAGGAGGGGAAAGGG + Intergenic
982695727 4:158597799-158597821 CTGTGGGGATGGGATGGAAAAGG - Intronic
983287526 4:165758798-165758820 CTGTTAGGATGCAGAAGAAAAGG + Intergenic
983972938 4:173896491-173896513 CTGTGAGGATGAAGAGGCAATGG - Intergenic
984026471 4:174548676-174548698 CTGGAGGGAAGGAGAGGAAATGG + Intergenic
984519272 4:180782448-180782470 CTGTGGGGATGAAGCTGTAAAGG - Intergenic
985042173 4:185902429-185902451 CTGTGCAGTTGGAGAGTAAATGG + Intronic
985139972 4:186829833-186829855 CTGTAGGGATTGAGAGGACTTGG - Intergenic
985485628 5:146668-146690 CTGTGGGGGAGGAGAGGAGGGGG - Intronic
985844193 5:2331986-2332008 CTGTGAGGAGGCAGCGGAAAGGG + Intergenic
985960306 5:3297415-3297437 CTGTGGAGAAGGAAAGGATAGGG - Intergenic
986183914 5:5418822-5418844 CTCTGAGGAGGGATAGGAAAGGG - Intergenic
986259485 5:6131782-6131804 CTTTGGGGACTGAGGGGAAAGGG + Intergenic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987258722 5:16182332-16182354 TGGTGGGGATGGAGGTGAAAAGG - Intergenic
987323439 5:16791290-16791312 CTGTGGGAATTAAGAGAAAATGG - Intronic
987431115 5:17834540-17834562 GTGTAGGGATGGGGAGGCAAGGG - Intergenic
988245346 5:28673777-28673799 CTGTAGGGATGGGTAGGACATGG - Intergenic
988605069 5:32672193-32672215 ATGTGGGGGTTGAAAGGAAATGG + Intergenic
988656609 5:33218777-33218799 CATTAGGGATGGAGAGGAAGAGG - Intergenic
989179128 5:38558436-38558458 CTGTGAGGATTAAGAGGTAATGG - Intronic
989368419 5:40680701-40680723 TTGTGGGGAGGAAGAGGAATGGG + Intronic
989378402 5:40789631-40789653 AAGTGGGGCTGGAGGGGAAAAGG + Intronic
989435794 5:41411500-41411522 CTGTGAGATTGGAGAGCAAAAGG - Intronic
989526443 5:42458991-42459013 CTGTGAGGTTGTAGAGAAAAGGG + Intronic
989612800 5:43311815-43311837 CTGTGGGGAGGGAGTGTAAAAGG - Intronic
989983872 5:50673168-50673190 CTGTGGGGAGGGAGTGTGAAGGG + Intronic
990110452 5:52316575-52316597 TTGTGGGGTTGGAGGGGAAGAGG + Intergenic
990140406 5:52696828-52696850 CTATGGAGATGGAGAGGATGGGG - Intergenic
990237056 5:53779694-53779716 CTGTTGGAAGGGAGAGGAAGTGG + Intergenic
990505257 5:56437670-56437692 CTTTGGGGATTTAGGGGAAAAGG + Intergenic
990736796 5:58873106-58873128 CTGTGGGAATGGGGAGGAATAGG + Intergenic
990742093 5:58922673-58922695 CGGTGGGGCTGGGGAGGAAATGG - Intergenic
990849695 5:60188594-60188616 GAGTGGAGATGGAGGGGAAATGG + Intronic
990981184 5:61603733-61603755 CAGACTGGATGGAGAGGAAAGGG + Intergenic
991054846 5:62308763-62308785 TGGTGGGGAAGGAGAGGAAATGG + Intronic
991955557 5:71991794-71991816 CTGTCAGAATGGAGAGGAGAAGG + Intergenic
992005442 5:72472926-72472948 CTGTGGGAGTTGAGAGGAAGGGG - Intronic
992136185 5:73748762-73748784 CTGTGGGAGTGGCGGGGAAATGG - Intronic
992880680 5:81106286-81106308 CTGTGAGAATGAAGAGGAAAGGG - Intronic
993201122 5:84816494-84816516 AGGTGAGGATGGAGAGGGAAGGG + Intergenic
993893447 5:93502989-93503011 CTATGGGAAAGGAGAGAAAAGGG + Intergenic
994052171 5:95374690-95374712 CTGTGGGCATTGACAGGGAAGGG - Intergenic
994497043 5:100526035-100526057 CTTTGGAGATGTAGGGGAAAGGG + Intergenic
994953694 5:106498974-106498996 CTTTGGGGACTGGGAGGAAAAGG - Intergenic
994961705 5:106613713-106613735 CGGTAGGGATGGAGAGAGAATGG + Intergenic
995390059 5:111630479-111630501 AAGGGGGGATGGAGAGAAAAAGG + Intergenic
995741770 5:115363522-115363544 CTGAGGCAAGGGAGAGGAAAGGG - Intergenic
995916946 5:117258586-117258608 TTCTGCAGATGGAGAGGAAATGG + Intergenic
996293219 5:121879352-121879374 TTCTGGGGATGGAGAGAAATGGG + Intergenic
996900328 5:128537165-128537187 CTGCGGGGTTGGGAAGGAAAAGG + Intronic
997797223 5:136822394-136822416 CTTTGGGGATGCTGGGGAAAGGG - Intergenic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
998375694 5:141689138-141689160 CTGAGCTGAGGGAGAGGAAATGG + Intergenic
998391208 5:141788150-141788172 GTGTGGGGGTGTAGAGGGAAAGG - Intergenic
998482038 5:142470600-142470622 CTGTGGGAATTGACGGGAAAGGG + Intergenic
998851972 5:146359743-146359765 CTGTGTGGAGGAAGAGGAATGGG + Intergenic
999490681 5:152047484-152047506 TTTTGGGGATGTGGAGGAAAGGG - Intergenic
999598860 5:153237803-153237825 CTCTGGGGCTGGAGAGAAAGGGG - Intergenic
1000089191 5:157915473-157915495 CTCAGGAGTTGGAGAGGAAATGG - Intergenic
1000322363 5:160144732-160144754 CGGTGAGGATGCAGAGAAAAGGG - Intergenic
1000829484 5:166085311-166085333 ATGTGGGGATGGGGAGGCCAAGG - Intergenic
1001165269 5:169359788-169359810 TTGTGAGGATGCAGAGAAAAGGG + Intergenic
1001502218 5:172246124-172246146 TGGTGGGGTGGGAGAGGAAAGGG + Intronic
1001638693 5:173230603-173230625 CTGTGGGAAGGAAGAGGAAAGGG - Intergenic
1001702572 5:173718012-173718034 CTGTGGGAATGGAACTGAAATGG - Intergenic
1001721979 5:173864451-173864473 CTGTGGGTCTAGAGAGGCAAAGG - Intergenic
1001969443 5:175942608-175942630 CAGTGAGGATGTAGAGAAAAGGG + Intronic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002247992 5:177901145-177901167 CAGTGAGGATGTAGAGAAAAGGG - Intergenic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1002660527 5:180788370-180788392 CTGTGAGGGTGGAGAGGAAGAGG - Intergenic
1003528251 6:6916494-6916516 CTGTGCTCATGGAGAGAAAATGG + Intergenic
1003579284 6:7325080-7325102 CTGTGGGAGTGGAGAGAGAAGGG - Intronic
1003712896 6:8613560-8613582 CTAAGGGGAGGGAGAGGAGACGG - Intergenic
1004294856 6:14401285-14401307 ATGTGCTGATGGTGAGGAAACGG - Intergenic
1004479017 6:16001160-16001182 GTGTAGGGGTGGAGAAGAAAAGG - Intergenic
1004785168 6:18960531-18960553 CTTTGGGGAGAGAGAGAAAAAGG - Intergenic
1005359861 6:25021622-25021644 CTCTGGGGATTCAGAGGGAAAGG + Intronic
1005531684 6:26713504-26713526 CTGTGAGGAGGGAGGAGAAAAGG - Intergenic
1005539111 6:26788161-26788183 CTGTGAGGAGGGAGGAGAAAAGG + Intergenic
1005750153 6:28874756-28874778 ATGTGGGGGTTGAAAGGAAATGG + Intergenic
1006254644 6:32820602-32820624 ATGTGGGGATGGGGAGGAAGTGG + Intronic
1006308416 6:33239519-33239541 CTGGAGGAATGCAGAGGAAACGG + Intergenic
1006497134 6:34431870-34431892 CTGTGGTGATGGAGAGTAATGGG + Intergenic
1006650388 6:35546183-35546205 CTGTGGGGAGGGAGAGCATCAGG + Intergenic
1006671018 6:35729746-35729768 CTATGGGGCTGGAGGGGAAAGGG - Intergenic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1006840635 6:37026068-37026090 CTGTGGGCAGAGAGAGGAAGAGG - Intronic
1007048309 6:38799756-38799778 CTGGGAGGGTTGAGAGGAAATGG - Intronic
1007341434 6:41193713-41193735 GTCTGTGGATGGAGAGGAGAGGG - Intronic
1007457743 6:41993287-41993309 CTGTGAGGATGAGGAGAAAAGGG - Intronic
1007702847 6:43774473-43774495 CTGTGGGGAGGAAGGGGAAGGGG + Intronic
1007790025 6:44303424-44303446 CTGGAGGGGTGGGGAGGAAATGG + Intronic
1008191844 6:48468283-48468305 GTGTGGGGATGGAGGAGAAGTGG + Intergenic
1008202859 6:48614068-48614090 CTGAGGGAATGGAGAGGTTATGG - Intergenic
1008237487 6:49067821-49067843 CAGTGAAGATGTAGAGGAAAGGG + Intergenic
1008508716 6:52256215-52256237 ATGTGGGGCTGGAGAGCAGATGG - Intergenic
1008664007 6:53697894-53697916 CAGTGAGGATGGAGAGGAAGAGG + Intergenic
1008774875 6:55026259-55026281 CTTTGGGGATTCAGAGGGAAAGG - Intergenic
1008795392 6:55296526-55296548 TTGTGAGGATGCAGAGAAAAGGG - Intergenic
1009009945 6:57830387-57830409 CTGTGAGGAGGGAGGAGAAAAGG + Intergenic
1009529230 6:64788619-64788641 TTGTGTGGATGGAGCTGAAACGG - Intronic
1010007453 6:71011068-71011090 CTGTGGGGATGGAGTGGTGGAGG + Intergenic
1010040621 6:71378663-71378685 CTGTGGAGATGGAGAAGTCATGG + Intergenic
1010153321 6:72762198-72762220 CTGGGGGGAAGGAAAGGAAAGGG + Intronic
1010722466 6:79299337-79299359 TTGTGAGGATGTAGAGGAACTGG + Intergenic
1011164236 6:84428105-84428127 CTGTGGGGAGGGGAAGGAAATGG - Intergenic
1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG + Intergenic
1012043905 6:94244704-94244726 GTGTGGGGATGGGGAGCAAATGG - Intergenic
1012247043 6:96937717-96937739 CTGTGAGGATGGAGGGTAGAGGG - Intronic
1012563251 6:100613811-100613833 CTATGAGGATGCAGGGGAAAGGG - Intronic
1012932300 6:105329900-105329922 GTGTGGAGATGGAGGGGAAATGG + Intronic
1013211469 6:107990757-107990779 ATGTGGGGGTTGAAAGGAAACGG - Intergenic
1013985068 6:116182027-116182049 CTTTGGGGACGCGGAGGAAAGGG - Intronic
1014148063 6:118021167-118021189 CTCTGGGGATTGAGATAAAAGGG + Intronic
1014447279 6:121543485-121543507 CTTTGGGGACTCAGAGGAAAGGG - Intergenic
1014837929 6:126181697-126181719 CTCTGGGGATGAAGAAGAAGAGG + Intergenic
1015146916 6:129997296-129997318 CACTGGGGATGGAGAGGCCAAGG + Intergenic
1015149479 6:130020723-130020745 CGGCGGGGAGGGGGAGGAAAAGG - Intronic
1015365117 6:132388617-132388639 CTTGGAGAATGGAGAGGAAAGGG + Intronic
1015578152 6:134694772-134694794 TGGTGAGGATGTAGAGGAAAAGG - Intergenic
1016085114 6:139903927-139903949 TGGGGGGGATGGAGAGGAAAGGG - Intergenic
1016170918 6:141015551-141015573 CCTTGGGCATGGAGAGGAATAGG + Intergenic
1016305493 6:142679386-142679408 CTTGGGGGATGGACAGGAAATGG + Intergenic
1016314905 6:142774299-142774321 CTGTGGCCATGTATAGGAAAAGG + Exonic
1016642160 6:146361471-146361493 CTGTAGTGAAGGACAGGAAAGGG + Intronic
1017205454 6:151800270-151800292 CTGAGAGGAGGGAGAGGAAGAGG + Intronic
1017374440 6:153751671-153751693 CTTTGGGGACTCAGAGGAAAGGG - Intergenic
1017553929 6:155542624-155542646 TTGTGGGGATGAAGAGGAATTGG + Intergenic
1017660495 6:156669646-156669668 CTGTGGAGAGGGAGAGGGAGAGG - Intergenic
1018346600 6:162905292-162905314 CTGTGTGAATGGAGTGGGAAGGG + Intronic
1018371634 6:163173843-163173865 CTTTGGCTATGGAGAGGACAAGG - Intronic
1019042446 6:169118413-169118435 CTGTGGGGGTGGAGTGGGGATGG - Intergenic
1019650292 7:2153556-2153578 TGGTGAGGATGCAGAGGAAAGGG + Intronic
1019752072 7:2737088-2737110 CACTGGGGAGTGAGAGGAAAAGG + Intronic
1019999099 7:4744772-4744794 CTGGGCGGAAGGAGGGGAAAGGG - Intronic
1020431822 7:8123258-8123280 CTGGGGAAATGGAGAGGAAGGGG - Intronic
1020654992 7:10918319-10918341 CGGAGGGAGTGGAGAGGAAAGGG - Intergenic
1021296832 7:18918333-18918355 TGGGGGGGATGGAGGGGAAAGGG + Intronic
1021424547 7:20485079-20485101 AGGTGGGGATGGAGAGAAAAGGG + Intergenic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1021769684 7:23985707-23985729 CTGTGGGGTTGGAATGGAAGCGG - Intergenic
1021802048 7:24316837-24316859 CTGTAGGGCTGGAGGGGCAAGGG - Intergenic
1022140089 7:27486414-27486436 TTCTGGGGATGTGGAGGAAACGG + Intergenic
1022276213 7:28857379-28857401 GTGTGGGGGTGGAGAAGGAAGGG + Intergenic
1022351797 7:29573111-29573133 TTGAGGGGTTGGAGAGAAAAGGG - Intergenic
1022376095 7:29812726-29812748 CTGTGAGGAAGAAGAGGGAATGG + Intronic
1022377587 7:29828963-29828985 GTGTGGGGGAGAAGAGGAAAAGG - Intronic
1022404824 7:30078892-30078914 CTGGGGGGATGGACAGGAGGTGG + Exonic
1022728698 7:33003356-33003378 ATGTGGAGAGAGAGAGGAAAAGG - Intronic
1022922727 7:35032883-35032905 CTGTGGAGATGGAGAGAAATTGG - Intronic
1023196923 7:37651258-37651280 CTGTGGGGTTGGAGCGGGGAGGG - Intergenic
1023243007 7:38169041-38169063 CTTTGGGGAGGGACTGGAAAAGG + Intergenic
1023321282 7:39000508-39000530 CTGTGGGTATGTTGAGAAAATGG - Intronic
1023513419 7:40977210-40977232 CTGCTGGGAGGGAGAGAAAAGGG + Intergenic
1024248814 7:47490946-47490968 GTGTCGGGAAGTAGAGGAAAGGG + Intronic
1024776902 7:52798274-52798296 CAGTGGGGATGAAGCAGAAAAGG + Intergenic
1025044949 7:55684633-55684655 ATGTGGAGAGAGAGAGGAAAAGG + Intergenic
1026132029 7:67628838-67628860 CTGTGGGTTTGAAGATGAAAAGG + Intergenic
1026218055 7:68366993-68367015 CTTTGGGAATTCAGAGGAAAGGG - Intergenic
1026516101 7:71073967-71073989 ATGTGGGGGTTGAAAGGAAATGG - Intergenic
1026787632 7:73311865-73311887 CTGTGGGTATGGTGAGTCAAAGG + Intergenic
1026880590 7:73904620-73904642 CAGTGGGGATGGAGAGGGCCGGG + Intergenic
1027184587 7:75963314-75963336 CTGTGGGAACGGCGAGGACATGG + Intronic
1027195347 7:76026257-76026279 CAGCGGGAATGGGGAGGAAAGGG + Intronic
1027428050 7:78081887-78081909 CTGTGGGGAAGGAGATGATGAGG + Intronic
1027432200 7:78125838-78125860 CTTTGGGGTTGGGGAGAAAATGG + Intronic
1027540666 7:79460184-79460206 CTGGGAACATGGAGAGGAAAGGG + Intergenic
1028188982 7:87823576-87823598 GTTTGGGGACTGAGAGGAAAGGG - Intronic
1028792339 7:94867067-94867089 CTTTGGGGACTCAGAGGAAAGGG - Intergenic
1029242327 7:99172290-99172312 CTCTGGGGATGGGGTGGAAGAGG + Intergenic
1029853069 7:103484762-103484784 CTGAGGACATGGAGAGGACATGG + Intronic
1030124116 7:106138532-106138554 CTGTGGAGAGGGAGATGAGAGGG + Intergenic
1030132986 7:106218911-106218933 CTTTGTGGATGGAGAGGAATGGG + Intergenic
1030158969 7:106487949-106487971 TTGGGGGGATATAGAGGAAAGGG - Intergenic
1031003433 7:116444611-116444633 TAGTGGGAATTGAGAGGAAAAGG - Intronic
1031068509 7:117135095-117135117 CAGTGGGGAAGGAGAGTGAAAGG + Intronic
1031110926 7:117607381-117607403 TGGTGAGGATGGAGAAGAAAAGG + Intronic
1031329783 7:120450439-120450461 ATGGGGTGATGGAGTGGAAAAGG + Intronic
1031350979 7:120730799-120730821 ATATGGAGATGGAGAGGAATTGG - Intronic
1031484449 7:122310754-122310776 CTGCGGGAATGCAGAGGAGAAGG - Intergenic
1032098616 7:128954065-128954087 ATCTGGGGATGGAGTTGAAAGGG - Intergenic
1032166953 7:129552999-129553021 GTGTGGGGATGGAGAGGAGGTGG - Intergenic
1032263042 7:130351803-130351825 CTGAGGGGATCCAGAGGACAGGG - Intronic
1032308043 7:130755173-130755195 AGGTGGGAATGGAGGGGAAATGG - Intergenic
1032805249 7:135347853-135347875 CAGAGGGGATGGAGAGGATATGG - Intergenic
1032941227 7:136794917-136794939 CTGTGAGGATGTGGAGAAAAGGG + Intergenic
1033327611 7:140392474-140392496 CAGTGAGGATGGAGAGAAGAGGG - Intronic
1033652815 7:143355167-143355189 CTGTGGGGTTGGAGAGCACTTGG - Exonic
1033735452 7:144217415-144217437 CTGTGGCAGTGGAGAGGATATGG + Intergenic
1033747602 7:144333554-144333576 CTGTGGCAGTGGAGAGGATATGG - Intergenic
1033880519 7:145877032-145877054 AGGTGGGGAATGAGAGGAAATGG - Intergenic
1034277751 7:149831044-149831066 CTGTGGGGGTGGGGAGGCACAGG - Intergenic
1034291234 7:149933254-149933276 CTATGGGGATGGTGGGGAGATGG - Intergenic
1034529242 7:151685118-151685140 CTGGGGGGAAAGAGAAGAAATGG - Intronic
1034569534 7:151944279-151944301 CTGTGGGGCTGGGGAGGAGGGGG - Intergenic
1034814864 7:154163677-154163699 CTATGGGGATGGTGGGGAGATGG + Intronic
1034866708 7:154648321-154648343 CACTGGGGATGGATAGGGAAAGG + Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035023207 7:155810600-155810622 CTGTCGGAAGGGAGAGGAATGGG - Intronic
1035059320 7:156057255-156057277 CTGTGCAGAGAGAGAGGAAAGGG - Intergenic
1035218605 7:157390693-157390715 CTGTGGGAAGGCAGAGGAAAAGG - Intronic
1035241620 7:157534292-157534314 GAGTAGGGAGGGAGAGGAAAGGG - Intergenic
1035655211 8:1300323-1300345 CTGAGGGGAAGGGTAGGAAAGGG + Intergenic
1035692098 8:1566979-1567001 CTCTGTGGAGGGAGAGGAGATGG - Intronic
1035692710 8:1570738-1570760 CTTCTGGGATGGAGAGGAGAGGG + Intronic
1035692926 8:1571768-1571790 CTTCTGGGATGGAGAGGAGACGG + Intronic
1035693020 8:1572218-1572240 CTGATGAGATGGAGAGGAGAGGG + Intronic
1035693093 8:1572586-1572608 CTGCTGGTATGGAGAGGAGAGGG + Intronic
1036642809 8:10594566-10594588 CTGTGGGGCTGGGGAGGGGAGGG + Intergenic
1036988193 8:13560764-13560786 CTGTGGGGGGGGAGGGAAAAAGG + Intergenic
1037270184 8:17118551-17118573 CTGGGGGACTGGGGAGGAAAGGG - Intronic
1037314328 8:17586461-17586483 CTAAGTGGATGGAGAGGCAATGG + Intronic
1037320338 8:17635295-17635317 CTTTGGGGATTCAGGGGAAAGGG - Intronic
1037386479 8:18347855-18347877 CTTGGGGGAAGGAGTGGAAAGGG + Intergenic
1037414414 8:18633897-18633919 CAGTGGGGCTGCAGAGAAAAGGG - Intronic
1037910257 8:22739896-22739918 CTGGGGGGATGGAGGGGGAGGGG + Intronic
1038129512 8:24714233-24714255 ATGTGGCCATGGGGAGGAAATGG + Intergenic
1038150969 8:24942170-24942192 CGGTGGGGATGGGGAAGACAGGG - Intergenic
1038873782 8:31525384-31525406 GTGAGGAGATGGAGAGGAAGTGG - Intergenic
1039341736 8:36658071-36658093 GTGAGGGGATGGAGAAGGAAGGG - Intergenic
1039571021 8:38586336-38586358 AGGTGGGGATGGTAAGGAAAGGG + Intergenic
1039644331 8:39264078-39264100 ATCTGGGGATAGACAGGAAATGG - Intronic
1039743278 8:40401453-40401475 CTTGGGGTAGGGAGAGGAAAAGG - Intergenic
1039793404 8:40892889-40892911 CTGTGAGGAGGGAAAGGCAAGGG - Intronic
1039845316 8:41321612-41321634 CGGTGGGGCTGGAGAGCAGAGGG + Intergenic
1039928145 8:41957992-41958014 CTTGGGGAATGGAGAGGGAAGGG - Intronic
1040083914 8:43319164-43319186 CTGTGTTGCTGCAGAGGAAATGG + Intergenic
1041013440 8:53567412-53567434 CTCTGGAGAGGAAGAGGAAAAGG - Intergenic
1041168327 8:55114209-55114231 CTGTGAGGTTGCAGAGAAAAGGG - Intronic
1041214128 8:55583045-55583067 AAGAGGGGATGGAGAGGGAAAGG - Intergenic
1041566933 8:59289205-59289227 CTCTGAGGATGGATAGGCAAAGG - Intergenic
1041992033 8:64005000-64005022 CTGAGGGGTGGGAGAGAAAATGG - Intergenic
1042425849 8:68647308-68647330 CCGTGAGGATGTAGAGAAAAGGG + Intronic
1042616871 8:70659276-70659298 CTGTGGGTAGGGAGACCAAAAGG + Intronic
1043503182 8:80876046-80876068 CTTTGGGAATGGAAAGGAAGGGG - Intergenic
1044535521 8:93352937-93352959 CTCTGGGGATGGACGGCAAAGGG - Intergenic
1044613675 8:94118758-94118780 CTGAGGGGATGGAGAAAAATGGG + Intergenic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1045322199 8:101090801-101090823 CAGTGGGGATGGAGAGAATTGGG + Intergenic
1045485197 8:102625777-102625799 CTGTGAGGAGGGAGAGGACAGGG + Intergenic
1045489457 8:102657326-102657348 CTGCGGGGATGAGGAGGGAATGG + Intergenic
1045652279 8:104352418-104352440 CTTTGGGGGTGGCCAGGAAAAGG + Intronic
1045878411 8:107009978-107010000 CTTTCGGGATTCAGAGGAAAGGG + Intergenic
1046025440 8:108717698-108717720 ATGTGGGGATTTGGAGGAAAAGG + Intronic
1046085451 8:109428434-109428456 ATTTGGGGAAGGAGAGGAAGTGG + Intronic
1046356355 8:113090608-113090630 CAGTGTGGATGGGGAAGAAAGGG - Intronic
1046358990 8:113125810-113125832 CTGATGAGAAGGAGAGGAAAAGG + Intronic
1046829905 8:118733203-118733225 AGGGAGGGATGGAGAGGAAAGGG - Intergenic
1047096984 8:121636440-121636462 CAGTGGGACTGGAGAGAAAAAGG - Intronic
1047438889 8:124858802-124858824 CAGAGGTGATGGAGAGGAAGTGG - Intergenic
1047594521 8:126365049-126365071 CTGTGGGGAAGAAGGGGGAAAGG + Intergenic
1047787670 8:128169440-128169462 CTCAGGGGATGGAGAGGATCGGG - Intergenic
1048001992 8:130386205-130386227 CAGTGGTGATGCAGAGAAAAGGG + Intronic
1048483764 8:134828607-134828629 ATGTGGGGATAAGGAGGAAAGGG - Intergenic
1048496879 8:134942751-134942773 CAGTGGTGATGGAGATGACATGG + Intergenic
1048762489 8:137810803-137810825 TTCTGGGAATGGAGAGGAAGAGG + Intergenic
1048795501 8:138145774-138145796 ATTTCGGGAGGGAGAGGAAACGG - Intronic
1049032021 8:140045115-140045137 CAGCAGAGATGGAGAGGAAAAGG + Intronic
1049746732 8:144266252-144266274 CTCTGGGGATGCGGAGGAACTGG - Intronic
1049748039 8:144271233-144271255 CTTTGGGGAGGGGGAGGGAAGGG - Intronic
1049808992 8:144554894-144554916 CTGTGGTGCTGGGGAGGAACTGG - Intronic
1049853472 8:144847177-144847199 TTGTGGAGAGGGAGAGGAAGAGG + Intronic
1050033756 9:1413684-1413706 GTGTAGGGCTGGAGACGAAATGG + Intergenic
1050190362 9:3018885-3018907 ATGTGAGGATGCAGTGGAAAAGG - Intergenic
1050398655 9:5227705-5227727 CTGTGGGGGTGGTGGGGCAAGGG + Intergenic
1050598510 9:7227597-7227619 CTTTGGGGATGGGAAGGAATGGG + Intergenic
1050602582 9:7267662-7267684 CTGTGAGAAAGGACAGGAAAGGG - Intergenic
1050882324 9:10718021-10718043 ATCTGGGGATGAAGAGGAATGGG + Intergenic
1051207281 9:14701488-14701510 CTCTGGGAAAGGAGATGAAAAGG + Intergenic
1051364973 9:16315459-16315481 TTGAGGGGACAGAGAGGAAAAGG + Intergenic
1051760744 9:20461023-20461045 ATGTGTGGATGGAGAGGAGAAGG - Intronic
1052170810 9:25394222-25394244 CTGTGGATATGGAGAGCCAACGG + Intergenic
1052325759 9:27215288-27215310 CCTTGGGGCTGGGGAGGAAAGGG + Intronic
1052801297 9:32970581-32970603 CTCTGGGCATGAAGAGGGAACGG + Intergenic
1052837868 9:33264907-33264929 TTCCGGGGATGGAGAGCAAAAGG - Intronic
1052916204 9:33925950-33925972 CTGTGGGGACAGAGGGGAATAGG - Intronic
1052992195 9:34525262-34525284 GTCTGGGGATGGGGAGGACAGGG - Intergenic
1053753465 9:41279195-41279217 CTGGGGGGAGGAAGAGGAATGGG + Intergenic
1053789774 9:41678717-41678739 CTGTGGGGATGCAGAGTAATAGG - Intergenic
1054155367 9:61636036-61636058 CTGTGGGGATGCAGAGTAATAGG + Intergenic
1054178114 9:61890407-61890429 CTGTGGGGATGCAGAGTAATAGG - Intergenic
1054258989 9:62843558-62843580 CTGGGGGGAGGAAGAGGAATGGG + Intergenic
1054332790 9:63776482-63776504 CTGGGGGGAGGAAGAGGAATGGG - Intergenic
1054475153 9:65567147-65567169 CTGTGGGGATGCAGAGTAATAGG + Intergenic
1054659415 9:67690417-67690439 CTGTGGGGATGCAGAGTAATAGG + Intergenic
1054782864 9:69181975-69181997 CCATGGGGGTGGAGAGGAAGAGG - Intronic
1054856875 9:69909980-69910002 CTGTGGGAATTGGGAGGGAATGG - Intergenic
1054916585 9:70500176-70500198 CTGTGGCCATGAAGAGGAACTGG + Intergenic
1055347335 9:75352697-75352719 CTTTGGAGATGAAGAGTAAAGGG + Intergenic
1055467612 9:76581113-76581135 CTGAGAGGATGTAGAGAAAAGGG - Intergenic
1055544149 9:77349451-77349473 ATTTGGGGGTGGAGAGTAAAAGG - Intronic
1056507515 9:87271198-87271220 CTGGAGGGAGGGAGAGGTAAGGG - Intergenic
1056579457 9:87880454-87880476 CTGCAGGGAAGCAGAGGAAAGGG - Intergenic
1056729751 9:89155451-89155473 CTGTAAGGATGGAGAAGCAATGG - Intronic
1057130530 9:92651389-92651411 GGGTGGGGATGGAGGAGAAAGGG + Intronic
1057133925 9:92673245-92673267 CAGTGGGAATGCAGAGGAGAGGG + Intergenic
1057144731 9:92750113-92750135 CTCTGGGGATTGCGAGGAGATGG - Intronic
1057389533 9:94631194-94631216 CTCTGGGGCTGGAAAGGGAAAGG - Intronic
1057407725 9:94788820-94788842 CTGTGGTGCTGGAGGAGAAATGG - Intronic
1057545937 9:96020757-96020779 CTGTGGGGATGGGGAGTGGACGG + Intergenic
1057787319 9:98096709-98096731 CAGTGGGGATGGGGAGAAACAGG - Intronic
1058219830 9:102284792-102284814 CTTTGGGGATTGAGGGGAAAAGG + Intergenic
1058935163 9:109763306-109763328 CTATGGAGATGGAGAGAAAAGGG - Intronic
1060041363 9:120304352-120304374 CCGTGGAGATGGAGAGGGAGAGG - Intergenic
1060310524 9:122456182-122456204 GTCTGGGGATGGAGATGAATGGG + Intergenic
1060353553 9:122881668-122881690 GGGTGGGGATGGAGAGGACAGGG + Intronic
1060840203 9:126786918-126786940 CTGTGGAGACTTAGAGGAAAGGG - Intergenic
1061393203 9:130329154-130329176 CAGTGGGGCTGGAGCAGAAATGG - Intronic
1061823173 9:133239782-133239804 CTGTGGGGAGGATGATGAAAGGG - Intergenic
1062264271 9:135679692-135679714 CTGTGGGGAGGGGGAGGGGAGGG - Intergenic
1062264315 9:135679815-135679837 CTGTGGGGAGGGGGAGGGGAGGG - Intergenic
1062264329 9:135679850-135679872 CTGTGGGGAGGGGGAGGGGAGGG - Intergenic
1062320659 9:135989184-135989206 CTGTGGGGAGGGGGAGGTCAGGG - Intergenic
1062326652 9:136015572-136015594 CTTTGGGGGTGGACAGGAACAGG + Intronic
1203686913 Un_GL000214v1:3815-3837 ATGTGGGGGTTGAAAGGAAACGG - Intergenic
1203715108 Un_KI270742v1:136554-136576 ATGTGGGGGTTGAAAGGAAATGG + Intergenic
1203649362 Un_KI270751v1:100238-100260 ATGTGGGGGTTGAAAGGAAACGG + Intergenic
1186301336 X:8202935-8202957 TAGTGGGGATGGAGAGTATATGG - Intergenic
1186441478 X:9590845-9590867 CTGTGGGGGTGGGGAGGATGGGG + Intronic
1186461942 X:9754764-9754786 CGGTGGGGATGTGGGGGAAAAGG - Intronic
1186630154 X:11340008-11340030 CTGTGGAGATGGAGAAGGGATGG - Intronic
1187493244 X:19772559-19772581 ATGTTGGAACGGAGAGGAAATGG - Intronic
1188473868 X:30569345-30569367 GTGTGGGTATGTAGGGGAAATGG + Intronic
1188794488 X:34444951-34444973 CTTTGGGGATTTAGAGGAAAGGG + Intergenic
1189286105 X:39853600-39853622 GGGTGGGGAAGGAGAGGAGAAGG + Intergenic
1189434175 X:40976547-40976569 CTTTGGGGACTCAGAGGAAAGGG - Intergenic
1189809954 X:44772713-44772735 TAGTGGTGATGGAGAGAAAAAGG - Intergenic
1190087226 X:47406002-47406024 CTTTGGGGACTGAGAAGAAAGGG - Intronic
1190404044 X:50068461-50068483 GGGTGGGGGTGGAGTGGAAAAGG - Intronic
1190641930 X:52488300-52488322 GGGTGCGGGTGGAGAGGAAACGG + Intergenic
1190645742 X:52524566-52524588 GGGTGCGGGTGGAGAGGAAACGG - Intergenic
1190884625 X:54520713-54520735 CTGTGGGGGTGCAGGGGAACTGG + Intergenic
1191032729 X:55991736-55991758 TTGTGAGGTTGCAGAGGAAAGGG - Intergenic
1191042256 X:56095806-56095828 TGGTGGGGATGCAGAGAAAAAGG + Intergenic
1191161294 X:57331936-57331958 GTGTGTTGATGGAGAAGAAATGG + Intronic
1191716825 X:64199610-64199632 TTGGGGAGCTGGAGAGGAAAAGG - Intronic
1191918604 X:66229435-66229457 CTTTGGGGATTCAGGGGAAAGGG + Intronic
1192053199 X:67745932-67745954 CTCAGAGGATTGAGAGGAAATGG + Intergenic
1192307130 X:69973232-69973254 CTTAGGGAATGCAGAGGAAAGGG + Intronic
1192538376 X:71947877-71947899 CTTTGGGGATTCGGAGGAAAGGG + Intergenic
1192658500 X:73017974-73017996 CAGTGAGGATGCAGAGAAAAGGG - Intergenic
1192886114 X:75336607-75336629 CTGTGGGGTTGGAGTGGCAGAGG + Intergenic
1192916525 X:75657338-75657360 ATGTATGGATGTAGAGGAAAGGG - Intergenic
1192917281 X:75666224-75666246 CTCTGGGCATGGAGTGGAGAGGG + Intergenic
1193088012 X:77464888-77464910 CTTTGGGGACTGAGGGGAAAGGG + Intergenic
1193938145 X:87647712-87647734 CTTTGGGGACTCAGAGGAAAGGG + Intronic
1194104128 X:89747347-89747369 CTTTGGGGACTGAGGGGAAAGGG - Intergenic
1195153893 X:102102947-102102969 CTTTGGGGACTCAGAGGAAAGGG - Intergenic
1195224015 X:102773610-102773632 CTGTGGAGATAGAGAGTAGAAGG - Intergenic
1195382312 X:104282486-104282508 CTCTGAGGGTGAAGAGGAAAAGG - Intergenic
1195585049 X:106555504-106555526 TTGTGGGGATGTGGAGAAAAAGG + Intergenic
1195802867 X:108733337-108733359 CTGAGGGGAAGGGGAGGAAGTGG + Exonic
1195968075 X:110447450-110447472 GTGTGGGGATGTAGGGGAGATGG + Intronic
1196575902 X:117318726-117318748 CTGTGGTCATGTAGATGAAATGG - Intergenic
1196577066 X:117331290-117331312 CAGAAGGGATGGAGACGAAAAGG + Intergenic
1196585965 X:117428384-117428406 ATGTGGGGATGAAGAGAGAAAGG - Intergenic
1197327382 X:125110387-125110409 CTTTTGGGATGGAAAGGGAAGGG - Intergenic
1197373097 X:125648206-125648228 TTGTGAGGATGTAGAGAAAAGGG - Intergenic
1197971618 X:132120592-132120614 CTGTGGGGATGGGAAGCCAAGGG + Intronic
1197973460 X:132139438-132139460 CAGTGAGGATGCAGAGAAAAGGG - Intergenic
1198267250 X:135021532-135021554 CTCTGGGATTGGGGAGGAAATGG + Exonic
1198270332 X:135051184-135051206 CTCTGGGGATGGGGAGGAAATGG + Exonic
1198546981 X:137702685-137702707 CTCTGGGGAAGGAAAGCAAAGGG - Intergenic
1198895900 X:141454261-141454283 TGGTGGGGATGTAGAGAAAAGGG + Intergenic
1199227344 X:145393728-145393750 AAGAGGGGGTGGAGAGGAAAAGG - Intergenic
1199492233 X:148413066-148413088 CTGAGGGGATTGAGGGGAAATGG + Intergenic
1199530518 X:148842169-148842191 CTGTGTGGATGGAAGAGAAATGG - Intronic
1199609693 X:149601913-149601935 CTGGGAGGATGCAGAGGAACTGG - Intronic
1199629423 X:149767439-149767461 CTGGGAGGATGCAGAGGAACTGG + Intergenic
1199771887 X:150980411-150980433 CTGGGGGGATGGGGAGGAGCAGG + Intergenic
1200036571 X:153334939-153334961 CTGTGGAGAGGCAGGGGAAAGGG + Intronic
1200271058 X:154683864-154683886 GTTTGGGGATGGAGAGAAATTGG + Intronic
1200456083 Y:3395156-3395178 CTTTGGGGACTGAGCGGAAAGGG - Intergenic
1201514135 Y:14799018-14799040 CTGGGGGCATGGAGGGGAAGGGG + Intronic
1201906988 Y:19095753-19095775 GTGTGGGGATGGGGAGGGCAAGG - Intergenic
1202337285 Y:23825550-23825572 GAGTGGGGATGAGGAGGAAAGGG - Intergenic
1202533481 Y:25844521-25844543 GAGTGGGGATGAGGAGGAAAGGG + Intergenic