ID: 1167618904

View in Genome Browser
Species Human (GRCh38)
Location 19:50550743-50550765
Sequence CTGCAGGAGAAAAATGAGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 419
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 386}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167618904_1167618912 17 Left 1167618904 19:50550743-50550765 CCGGGCTCATTTTTCTCCTGCAG 0: 1
1: 0
2: 3
3: 29
4: 386
Right 1167618912 19:50550783-50550805 TGTGTCTGACTATGTGAGTGCGG 0: 1
1: 0
2: 5
3: 57
4: 783
1167618904_1167618914 23 Left 1167618904 19:50550743-50550765 CCGGGCTCATTTTTCTCCTGCAG 0: 1
1: 0
2: 3
3: 29
4: 386
Right 1167618914 19:50550789-50550811 TGACTATGTGAGTGCGGTGAGGG 0: 1
1: 0
2: 0
3: 8
4: 90
1167618904_1167618913 22 Left 1167618904 19:50550743-50550765 CCGGGCTCATTTTTCTCCTGCAG 0: 1
1: 0
2: 3
3: 29
4: 386
Right 1167618913 19:50550788-50550810 CTGACTATGTGAGTGCGGTGAGG 0: 1
1: 0
2: 0
3: 8
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167618904 Original CRISPR CTGCAGGAGAAAAATGAGCC CGG (reversed) Intronic
900382149 1:2390328-2390350 TTGCAGGAGATGAGTGAGCCAGG + Intronic
900512867 1:3068627-3068649 ATGCAGGAGAAAAGCGGGCCGGG + Intergenic
900635833 1:3664540-3664562 CTGGTGGAGAAAATGGAGCCAGG - Intronic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
900897549 1:5494208-5494230 CTGGAAGAGAGAGATGAGCCAGG + Intergenic
901762105 1:11478436-11478458 CTGATGGAGAGAAATGGGCCAGG + Intergenic
901900460 1:12357388-12357410 TTTCAGGAGAAGAATGAGACTGG - Intronic
902858565 1:19227569-19227591 CAGAACTAGAAAAATGAGCCAGG + Intronic
902908125 1:19574360-19574382 CTGCAAGAGAAAGTTAAGCCAGG - Intergenic
903689732 1:25164250-25164272 CTCCAGGAGCAGAAGGAGCCTGG - Intergenic
904261711 1:29291389-29291411 CTGCAGGAGAAGGAGGAGTCTGG + Intronic
905749934 1:40453344-40453366 CAGATGGAGAAAAATGAGCAAGG + Intronic
906550377 1:46661231-46661253 ATGCAAAAGAAAAATTAGCCAGG - Intronic
906573023 1:46861230-46861252 TTCCAGGTAAAAAATGAGCCTGG + Intergenic
907865144 1:58392022-58392044 CTCCAGCAGATACATGAGCCTGG - Intronic
908146525 1:61251130-61251152 ATGCAAAAGAAAAGTGAGCCAGG - Intronic
909256696 1:73432329-73432351 CTGCAGGAGAAAAAAAAGCGTGG + Intergenic
909394065 1:75150075-75150097 CTACAGGAAAAAAAACAGCCAGG + Intronic
911368045 1:96963488-96963510 CTCTAGGTGAAAAATGGGCCAGG + Intergenic
912058235 1:105632050-105632072 TGGCAGGAGAAAAATGAGAGTGG - Intergenic
915585892 1:156843745-156843767 CTGCAAGAGGAAAATGGGGCTGG - Intronic
915677708 1:157547166-157547188 CTGGAGGAAAATAATGGGCCTGG + Exonic
916561539 1:165937885-165937907 ATGGACGATAAAAATGAGCCAGG + Intergenic
916911034 1:169346588-169346610 CTACGGGAAAAAAATGAGCAGGG - Intronic
917467706 1:175297097-175297119 CTGCTGGAGAAAATTCAGCCAGG + Intergenic
917923531 1:179770536-179770558 CTGGAGATGAAAAATGAGACTGG - Intronic
918268034 1:182865616-182865638 GGGCAGGATAAATATGAGCCAGG + Intronic
918767670 1:188509526-188509548 CTAGGGGAGAAAAATGACCCTGG + Intergenic
919108776 1:193190564-193190586 CTGAAGGAGAAAAATAAGGCAGG - Intronic
919406081 1:197186021-197186043 CTGAAGGAGAAAAATAAGGTTGG + Intronic
919448297 1:197737988-197738010 CTGCGGGAAGAAAATGAGCTGGG - Intronic
919730159 1:200908707-200908729 CTGCAGGAGTAAAAGAAACCTGG - Intronic
920941566 1:210488202-210488224 ATGCAGGGGAAAGAAGAGCCAGG - Intronic
921348805 1:214214466-214214488 CTGCAGTAGAAAAAGGGGCCGGG - Intergenic
921958767 1:221012273-221012295 CTGCAGGATAAAATGGAGCCTGG - Intergenic
922247615 1:223816096-223816118 CTGCAGGAGAAAAGGGTGCTGGG - Intronic
923102579 1:230828003-230828025 CTGCTGGAGAGAAATGACGCTGG + Intergenic
1062940314 10:1416118-1416140 CTGCAGGAGGGAAATAAGACAGG - Intronic
1064591846 10:16900851-16900873 CTGCAGGAGAAAAAAGAAAATGG + Intronic
1064703141 10:18042739-18042761 TTGCAGGAGAAACATCATCCAGG - Exonic
1065491539 10:26287226-26287248 CTACAGGAGACAAATGAAGCCGG - Intronic
1065534685 10:26705921-26705943 CTGAAGGAAAAAAATGGTCCAGG + Intronic
1065686826 10:28293958-28293980 CTGCAGAAAGAAAATGAACCAGG + Intronic
1066357672 10:34700854-34700876 CTACAGGAGAAAGAGGAGCTGGG - Intronic
1067157437 10:43794023-43794045 CTCCAGGAGAAGGATGAGCTGGG - Intergenic
1068004741 10:51380021-51380043 ATGGTGGAGAAGAATGAGCCAGG - Intronic
1068631237 10:59299974-59299996 TGGCAGAAGAAAAATGAGACTGG + Intronic
1069374548 10:67780780-67780802 GCCCTGGAGAAAAATGAGCCTGG - Intergenic
1069457380 10:68563352-68563374 TTGCTGGAGGAAACTGAGCCAGG + Intronic
1070352299 10:75604648-75604670 CTGGAGGAGAAAAAGGACTCAGG + Intronic
1070367901 10:75753765-75753787 CTGCAGGTTAGAAATGAGGCAGG + Intronic
1070605585 10:77895997-77896019 CTTCAGAACAAAAATTAGCCAGG + Intronic
1070667129 10:78353186-78353208 CTGCAAAAGGAAAATGAGCAAGG - Intergenic
1071276958 10:84064222-84064244 CTGCAGGAGTTAAATCATCCTGG + Intergenic
1071502294 10:86212492-86212514 GGGCAGCAGAAAAAAGAGCCAGG + Intronic
1071777572 10:88806341-88806363 CAGGAGGAGCAAAATGAGCAGGG - Intronic
1074249146 10:111726431-111726453 CAGCACTAGAAAAATAAGCCGGG + Intergenic
1075396680 10:122132820-122132842 CTGCAGGAGAAAAGAGAGGAGGG - Intronic
1075977057 10:126705223-126705245 CTGCAGGAATAAAGTGAGCAAGG - Intergenic
1076247864 10:128961688-128961710 CTGCAGGAGAAATAAAAGACAGG + Intergenic
1076745359 10:132510159-132510181 CTACAGGAGAAAGATGGGCTTGG - Intergenic
1077684174 11:4275403-4275425 CTACAGGAGAAGAATGATGCTGG + Intergenic
1077685869 11:4291362-4291384 CTACAGGAGAAGAATGATGCTGG - Intergenic
1077691018 11:4342522-4342544 CTACAGGAGAAGAATGATGCTGG - Intergenic
1078131008 11:8614176-8614198 CTAAAGTAGAAAAATTAGCCAGG + Exonic
1080253387 11:30261728-30261750 TTGCAGGAGAAAAATAAAGCAGG - Intergenic
1080628633 11:34052622-34052644 CTGGAGAAGAAAAAGGTGCCAGG + Exonic
1081649340 11:44813138-44813160 CTGCAGGAGACAGAAGCGCCAGG - Intronic
1081763577 11:45593762-45593784 CTGCAGGAGAGGAGTGAGCAAGG + Intergenic
1083648724 11:64187842-64187864 ATACAGAAGAAAAATTAGCCGGG + Intronic
1084645910 11:70457562-70457584 TTGTAGGAGAAAACTGAGCAGGG - Intergenic
1085651023 11:78268806-78268828 CTGAAGGAGGAAAAGGAGACAGG - Intronic
1085736208 11:79041358-79041380 CTTCAAGAGACAAATGAGGCCGG - Intronic
1088281869 11:108143143-108143165 CTGAAAGAAAAAAATTAGCCAGG + Intronic
1088720064 11:112584438-112584460 CTGGAGGACATAAATGGGCCAGG + Intergenic
1090243597 11:125200649-125200671 GTGCAGGAGAAACATGGGCATGG - Intronic
1091339447 11:134799076-134799098 CTGCAGGAGAGGAAAGAGGCAGG - Intergenic
1091360926 11:134977975-134977997 CTGGAGGAGCAATCTGAGCCTGG + Intergenic
1091428781 12:414579-414601 CCTCAGGAGAAAAGTGAGTCAGG - Intronic
1093505071 12:19855639-19855661 CTGTTAGAGAAAAATGACCCTGG - Intergenic
1096148453 12:49294709-49294731 CAGCAGGTGAAAATAGAGCCTGG + Exonic
1096227148 12:49873405-49873427 CTGCAGAAGGAAAATGTGCTTGG - Intronic
1096793449 12:54059587-54059609 CTGCAGGAGAAAAATCAAAATGG - Intergenic
1097438329 12:59577992-59578014 GTGCAGGAGAAATATGAAGCAGG + Intergenic
1099263940 12:80419851-80419873 CTGCATGAGAGGAATGAGACTGG - Intronic
1099657973 12:85519986-85520008 CTGGAGGAGTGAAATAAGCCAGG + Intergenic
1099980494 12:89595993-89596015 GTGCATCAGAAAAAAGAGCCTGG + Intronic
1100469255 12:94874829-94874851 CTGCGGGAAAAAAATGAGAAGGG + Intergenic
1100854446 12:98746302-98746324 CTGCAGCAGAAAAATCAGGTGGG - Intronic
1100857165 12:98767522-98767544 TTGCAAGTGAAAAATGAGCATGG + Intronic
1102162535 12:110781386-110781408 CTGAAATACAAAAATGAGCCAGG + Intergenic
1103013955 12:117479600-117479622 CTGGAGGGGAAAAATGGCCCTGG + Intronic
1103229929 12:119320835-119320857 AGTCAGGAGAAAAGTGAGCCTGG + Intergenic
1103296215 12:119889347-119889369 CTACAGGAAAAAAATTAGCTGGG - Intergenic
1104684482 12:130775908-130775930 CTGCATGAAAAAAGGGAGCCCGG + Intergenic
1104857908 12:131910441-131910463 CTGCAGCAGAGCAAGGAGCCGGG - Intronic
1105306382 13:19171914-19171936 CTTCAGGGGACAAATGTGCCCGG - Intergenic
1105548381 13:21368703-21368725 CTACAGAAAAAAAATGAGCTGGG + Intergenic
1105566036 13:21549084-21549106 ATGCAAAAAAAAAATGAGCCAGG - Intronic
1105568853 13:21580058-21580080 TTGAAGGAGAAAAGTGACCCTGG - Intronic
1105924258 13:24992756-24992778 CAGAAGGTGAAAAATGAACCAGG + Intergenic
1106024216 13:25941417-25941439 CTGCAGGAGAACAGTGTGCTTGG - Intronic
1106231813 13:27826487-27826509 CAGCATGAGATCAATGAGCCAGG + Intergenic
1106776996 13:33017592-33017614 CTGCAGGAAGAGAATGAGCAGGG + Intronic
1106852617 13:33811136-33811158 TTGAAGGAGAAAAAAGAGACAGG - Intergenic
1107714778 13:43189352-43189374 TTGCTGGAGAGAAATGAGCAAGG - Intergenic
1108152078 13:47546571-47546593 CTGTAGGAGAAAAATGACCCTGG + Intergenic
1108874072 13:55024113-55024135 CTGCAGGAGAGAGAAGTGCCTGG - Intergenic
1109438327 13:62335622-62335644 AGGAAGGAGAAAAAGGAGCCAGG + Intergenic
1110333053 13:74294807-74294829 TTGCAGGGGAAAAATGAGGAAGG - Intergenic
1111243846 13:85509041-85509063 CTGCAGCAGCCAAATGTGCCTGG + Intergenic
1111394377 13:87646100-87646122 CTGCATCAGAAATATGAGACTGG + Intergenic
1112431358 13:99353472-99353494 CTTCATGAGAAAAAAGAGCGAGG + Intronic
1112438314 13:99407518-99407540 CTGAAGTACAAAAATTAGCCAGG - Intergenic
1115080821 14:29448338-29448360 CTTTTGGAGAAAAATGTGCCTGG - Intergenic
1116474913 14:45328631-45328653 CAGCAGGATAAGAATGAGCAAGG + Intergenic
1118221751 14:63860879-63860901 CTGCAGTGGAAACATGAGCAGGG + Intronic
1119729754 14:76943504-76943526 CTGCAGGAGAACAGGGACCCTGG + Intergenic
1119777312 14:77257160-77257182 CTGCAGGGGAGGAATGGGCCGGG - Exonic
1119806481 14:77485457-77485479 CTGGAATAGAAAAAGGAGCCAGG - Intronic
1120692485 14:87607843-87607865 CTGCAGAAAAAAAATGATACTGG + Intergenic
1122521267 14:102345445-102345467 CAGCAGGAAAGAAAGGAGCCAGG + Intronic
1123016145 14:105376667-105376689 CTGCAGGAGCAATAGGAGGCGGG - Intronic
1123955497 15:25330304-25330326 CTGCATGTGAAAAATGATCTTGG - Intergenic
1124199341 15:27664092-27664114 CTGCAGGATTGAAATAAGCCAGG + Intergenic
1124609845 15:31200952-31200974 CTGCTGGGGAAGAAGGAGCCTGG + Intergenic
1126244085 15:46483327-46483349 TGGAAGGAGAAAAATGAGGCTGG + Intergenic
1127263848 15:57345778-57345800 CTGCAGGAGAGTAATGGGGCAGG - Intergenic
1127524221 15:59776127-59776149 CTGGAGAAGAGAAATGAGCTGGG - Intergenic
1127831951 15:62758777-62758799 CAGCAGGAGAGAAGGGAGCCAGG + Intronic
1128864820 15:71106474-71106496 CTGGTGGAGAAAAATGATCTGGG + Intronic
1129088191 15:73119597-73119619 CTGCAGGAGAAAAAGGAGAGTGG - Intronic
1130100161 15:80887351-80887373 CTTCAGGACATAATTGAGCCTGG + Intronic
1130158520 15:81375094-81375116 CTGCAGGTGACAAAGGAACCGGG - Intergenic
1130565062 15:84986971-84986993 CTGGAGGAAAAAAATCAGTCAGG - Intronic
1132359171 15:101198188-101198210 CTGCAGGAGAGGAAAGAGCCTGG - Intronic
1134809629 16:17156494-17156516 CTGCAGGAGCAAAGTGGGGCTGG - Intronic
1135892625 16:26371373-26371395 CTCCAGGAGAAAGATGAGGCTGG + Intergenic
1136749357 16:32619235-32619257 CAGCAGCACCAAAATGAGCCTGG + Intergenic
1138191455 16:55017190-55017212 CTGCAGGAGAGACAGGACCCAGG - Intergenic
1138226186 16:55297320-55297342 CTTCAGGTGAAACATGATCCAGG + Intergenic
1138495919 16:57409396-57409418 CTGGAGGAAAAAGTTGAGCCTGG + Intronic
1139598588 16:67972319-67972341 CTGAAAAAGAAAAATTAGCCAGG + Intergenic
1140264076 16:73405341-73405363 CTGAAAAAGAAAAATCAGCCAGG - Intergenic
1140858769 16:79001071-79001093 CTGCAGGAGAAAGAAGGGCAAGG + Intronic
1141818377 16:86428495-86428517 ATGCAGAAAAAAAATTAGCCGGG - Intergenic
1141848888 16:86630576-86630598 CCTCAGGAGAAAAATCAGCCGGG + Intergenic
1142356045 16:89602567-89602589 CAGCAGGAGAAAGAACAGCCTGG - Intergenic
1203051489 16_KI270728v1_random:878449-878471 CAGCAGCACCAAAATGAGCCTGG + Intergenic
1144033345 17:11341767-11341789 ATCAAGGAGAAAAATGAGCTTGG - Intronic
1144160049 17:12548902-12548924 CTGGTGGAGGAAATTGAGCCTGG + Intergenic
1145964170 17:28905102-28905124 GTGTTGGAGAAAAGTGAGCCAGG - Intergenic
1146028824 17:29346808-29346830 CTACAAAAGAAAAATGAGCTGGG - Intergenic
1146208858 17:30926373-30926395 CTGCAGGAGATAAATGTACCTGG - Intronic
1148954645 17:51343619-51343641 CTCCAGGAGAAAAGTGATGCTGG - Intergenic
1149719625 17:58830012-58830034 CTCTAGAAGAAAAATTAGCCAGG + Intronic
1150985068 17:70186573-70186595 CTGCAGGTAAAAAATGTGGCTGG + Intergenic
1151463983 17:74272819-74272841 CTGCAGGGGAAAAATGAGAGAGG - Intergenic
1152316912 17:79586289-79586311 CTGCTGGAGAAGGAAGAGCCAGG + Intergenic
1152605834 17:81289534-81289556 ATGCTGCAAAAAAATGAGCCGGG - Intronic
1203172753 17_GL000205v2_random:165339-165361 CTGTAGGAGAAAAATTAGGCTGG - Intergenic
1153467921 18:5410344-5410366 CTGAATGAGAAACATGAGGCTGG + Intronic
1154306496 18:13234354-13234376 GTGCAGGAGACACATGGGCCAGG - Intronic
1155160812 18:23194007-23194029 TTGCAGAAGAAAAATGATTCAGG + Intronic
1155211410 18:23605364-23605386 CTCCAGAAAAAAAATAAGCCAGG - Intronic
1155720566 18:29006398-29006420 CTGCCTGAGAAAAAGGAGCAGGG - Intergenic
1155729833 18:29141665-29141687 TTTAAGGAGAAAAATGAGCATGG + Intergenic
1156571478 18:38258423-38258445 ATGAAGCAGAAAACTGAGCCTGG + Intergenic
1157615570 18:48985561-48985583 ATGCAGGAGAAAAAGGTGCAAGG - Intergenic
1157723034 18:49940257-49940279 CTGCAGAAGGGAGATGAGCCAGG - Intronic
1158401190 18:57122858-57122880 GTGCTGAAGAAAAATCAGCCAGG + Intergenic
1158585743 18:58732723-58732745 ATGGAGGAGACAAATGAGTCAGG + Intronic
1158916532 18:62137164-62137186 GCGCAGGAGAAATATGAGGCTGG - Intronic
1160242491 18:77133203-77133225 CTGCAGGAGGAGAGTCAGCCCGG + Intronic
1160444107 18:78914016-78914038 CAGCTGGAGAAGAATGAGCCTGG - Intergenic
1160569475 18:79807080-79807102 GTGGAGGAGAAAACTGACCCCGG + Intergenic
1160606644 18:80056333-80056355 CAGCAAGAGAAAAATAAGGCAGG - Intronic
1160793410 19:933233-933255 CTGCAGGAGACGCAGGAGCCAGG + Intronic
1162470659 19:10870841-10870863 CTCCAGGAGCAACCTGAGCCCGG - Intergenic
1163609691 19:18294461-18294483 CTGCAGGAGAGAAGAGAGCCAGG - Intergenic
1164023281 19:21327971-21327993 CTCAGGGAGAAAAATGACCCAGG + Intronic
1165325515 19:35112242-35112264 ATGCGGGAGAAAAGAGAGCCAGG + Intergenic
1166808318 19:45499920-45499942 CCGGTGGAGAAAAAGGAGCCCGG - Intronic
1167092067 19:47351347-47351369 CTGGAGAAAAAAAATTAGCCAGG - Intronic
1167618904 19:50550743-50550765 CTGCAGGAGAAAAATGAGCCCGG - Intronic
1168191004 19:54739003-54739025 CTGCAGTAGAGATATGGGCCTGG + Intronic
1168307461 19:55443141-55443163 CTGGGGGAGAGAAATGAGCATGG + Intergenic
1168314426 19:55478249-55478271 CTGCGGGGGAAAAATAAGGCAGG + Intronic
1168432090 19:56289358-56289380 CTGGAGGAGAGAAAGGGGCCAGG + Intronic
1168436520 19:56322200-56322222 CAGAAGGAAACAAATGAGCCTGG - Intronic
925290114 2:2742150-2742172 CAGTAGGAGAAACATGAGGCAGG + Intergenic
925454385 2:4002855-4002877 CTGCAAGAGAAAAAGGAACAGGG - Intergenic
925572918 2:5330739-5330761 CTGCAGGCGGAAAATAAGCAGGG + Intergenic
926225013 2:10961249-10961271 CTGGAGGAGCAGAACGAGCCCGG - Intergenic
926239452 2:11073983-11074005 CTGCAAGAAAAAAATGACTCAGG + Intergenic
926423978 2:12724730-12724752 CAGAAGGAGAAATATGAGGCTGG - Intronic
927360936 2:22232430-22232452 CTACAAAAGAAAAATTAGCCAGG + Intergenic
927679639 2:25131345-25131367 CTGCGGGAGGAAGATGAGCTGGG - Intronic
928397090 2:30950984-30951006 CTGCAGGGACAAAATCAGCCTGG + Intronic
928447239 2:31344323-31344345 CTGCAGGAGAACACTGAGGGAGG + Intronic
929292482 2:40209384-40209406 TGGCTGGAGAAAAATGATCCTGG + Intronic
931246618 2:60497886-60497908 CTGCAGGATGGAAGTGAGCCAGG + Intronic
931482504 2:62655947-62655969 TTTCATGAGAAAAATGAGACTGG + Intergenic
932096182 2:68850864-68850886 CTTCAGGAGCAAAAGGAACCAGG + Intergenic
933262741 2:80148470-80148492 CTGCAGGGGCAAACTGAGGCAGG + Intronic
933998806 2:87689324-87689346 CTGAAGGAAGAAAATGACCCTGG - Intergenic
935825354 2:106942455-106942477 CTTCAGGAAAAAAAAGACCCTGG + Intergenic
936295041 2:111261554-111261576 CTGAAGGAAGAAAATGACCCTGG + Intergenic
936921332 2:117691707-117691729 CTGCAGCAAATAAATGAGCAAGG + Intergenic
937029686 2:118728167-118728189 GGGCAGGAAAAAAATGAGCCTGG + Intergenic
937067223 2:119026445-119026467 CAGCAGGAGAAAGGTGGGCCAGG + Intergenic
937717138 2:125045512-125045534 CTGCAGGAGATAAATGTGAATGG - Intergenic
937955823 2:127421279-127421301 CTGCTGGAGAACACTGAGTCTGG - Exonic
939118257 2:138086557-138086579 CTGCATAAGAAAAGTGTGCCAGG - Intergenic
939471554 2:142628394-142628416 CTGGAGGAGGAAACTGAGCTTGG - Intergenic
939545918 2:143552544-143552566 CTTCAGGAGAAAAAAAAGTCGGG + Intronic
941024873 2:160447386-160447408 CTGCAGGAAGAAAATGAAACAGG + Intronic
941124479 2:161569261-161569283 ATGCAGGAGAAAAGTGTGTCTGG - Intronic
941175437 2:162192454-162192476 TGGAAGGAGAAAAATGAGCCTGG - Intronic
941508196 2:166374139-166374161 CTACAGAAGAAAGATGAGTCAGG - Intronic
941684887 2:168438158-168438180 CTGGAGGTGAAAGATGAGTCTGG - Intergenic
942514914 2:176741899-176741921 CTGCTGAAAAAAAATTAGCCGGG - Intergenic
943691644 2:190875432-190875454 CTGAAAAAGAAAAACGAGCCAGG - Intergenic
944140059 2:196446359-196446381 CTGCAGGAGAAAAATAAAGCAGG - Intronic
944522599 2:200586949-200586971 CTGAAGGAGGAAACTGAGGCAGG + Intronic
944832686 2:203548881-203548903 CTCCAGAAGAAAAAAGAGCAGGG - Intergenic
945124095 2:206489095-206489117 CCACAAGAGAAAAATGAGGCAGG - Intronic
947647350 2:231753161-231753183 CTGGAGGAGAAAAATGAGTTGGG - Intronic
1169077624 20:2771073-2771095 CTACAAAAGAAAAATTAGCCAGG + Intergenic
1169808221 20:9581022-9581044 CTACAGAAGAAAAAAGACCCCGG + Intronic
1172336223 20:34118248-34118270 CAGAAGGAGAAGAATAAGCCAGG + Intergenic
1173297762 20:41774471-41774493 CTGCAGGACAAAAATAACCAGGG - Intergenic
1173598668 20:44277362-44277384 GTGCAGGAGAAGATTGAGGCAGG + Intronic
1174198435 20:48789947-48789969 AAGAAGGAGAAAAATGGGCCTGG + Intronic
1174659051 20:52194612-52194634 CTTCAGTACAAAAATTAGCCAGG + Intronic
1174983160 20:55420178-55420200 TTAGAGGAGAAAAATGAGCAAGG - Intergenic
1175213917 20:57379734-57379756 GGGCAGCAGAGAAATGAGCCTGG - Intergenic
1177191277 21:17853941-17853963 CTGCAGGGGAATAAAGAGTCTGG - Intergenic
1177485613 21:21751508-21751530 ATGAAGGAGAAAAATTAGGCAGG + Intergenic
1177598575 21:23280631-23280653 CTGGAGGAGAAGAATGACCCAGG - Intergenic
1179017939 21:37609897-37609919 CTGCAGTAGAAAAATGTCCAAGG - Exonic
1179410992 21:41163082-41163104 CTTGAGGAGCAAAATGAGGCAGG + Intergenic
1180033494 21:45228949-45228971 CTGCAGGAGAAAAAAGTGTGAGG + Intergenic
1180847732 22:18993417-18993439 AAGCAGGAGAAGAATGAGGCTGG - Intergenic
1181681520 22:24498866-24498888 CACCAGGAGAAAAAGGAGCAAGG - Intronic
1184732710 22:46379645-46379667 AAGCAGGAGAAGAATGAGGCTGG + Intronic
1184918946 22:47592164-47592186 CAGCAAGAGAAAAATAAACCCGG + Intergenic
949257495 3:2065689-2065711 CTGGGGGAAAAAAATTAGCCAGG - Intergenic
949919465 3:8989823-8989845 CTGCAAGAGAAGAATGTTCCAGG - Intronic
950655315 3:14432810-14432832 CTGGAGGAGAAAGAGGAGCTTGG - Intronic
951112589 3:18822427-18822449 CTCCAGGAAAAAAATGTTCCTGG - Intergenic
951569548 3:24047512-24047534 CTGCAGCAGGAACATGAGCCTGG - Intergenic
951763247 3:26167812-26167834 CAGCAGGAGAAAAATGGCACTGG - Intergenic
952885063 3:38007023-38007045 CGGCAGGAGAAAAAGCAGCTGGG + Exonic
954068135 3:48123174-48123196 CTGAAAGATAAAAATGAGGCAGG - Intergenic
956698874 3:71941460-71941482 GAGAAGGAGAAAAATAAGCCTGG + Intergenic
956783954 3:72626866-72626888 CTGCAAAAGGAAAAAGAGCCAGG + Intergenic
957134311 3:76265152-76265174 CTGAAGCAGAAAAAGGACCCAGG - Intronic
958822854 3:98995768-98995790 CTGCAGGAGAAAAAATATACTGG - Intergenic
959198729 3:103219603-103219625 CTGCAGCAGAGAAATAAGGCAGG + Intergenic
961358310 3:126352459-126352481 CTGGAGGAGAACATGGAGCCTGG - Exonic
961533949 3:127557848-127557870 CTACAGTAGAAAAATTAGCCAGG + Intergenic
962124093 3:132596480-132596502 CTGCAGGTGGAGACTGAGCCTGG + Intronic
962136531 3:132740393-132740415 TTGCAGAAGAAAAATTACCCAGG - Intergenic
962810115 3:138952277-138952299 TTGTGGGAGAAAATTGAGCCAGG - Exonic
962842998 3:139252351-139252373 CTGCAGAGGTGAAATGAGCCAGG + Intronic
962847015 3:139281868-139281890 CTGCTGGCGAAATATGGGCCAGG + Intronic
962929285 3:140022401-140022423 TTGCAGAAGAGCAATGAGCCTGG + Intronic
963725613 3:148917442-148917464 CTACAGTTTAAAAATGAGCCAGG + Intergenic
964392619 3:156213376-156213398 CTACAAAAGAAAAATTAGCCAGG - Intronic
964546831 3:157843566-157843588 CAGCAGCAGCAAAATGAGCAAGG + Intergenic
967833292 3:193940628-193940650 CTGCAGGGGAATCAGGAGCCTGG - Intergenic
968466777 4:755874-755896 CTGAAGAAGAAAAATGAGGAGGG - Intronic
969696829 4:8739839-8739861 CTGCAGAAGGAAGAGGAGCCTGG + Intergenic
970390676 4:15608393-15608415 CTTCAGGAGCATAATGACCCAGG - Intronic
970694673 4:18663537-18663559 TAGAAGGAGAAAAATGGGCCAGG + Intergenic
970698350 4:18704942-18704964 CTACAAAAGAAAAATGAGCTAGG - Intergenic
971478899 4:27097128-27097150 CTGCTGGATAGAAATGAGCCAGG - Intergenic
971638939 4:29103393-29103415 CTGCCACAGAAAAATGAACCTGG - Intergenic
971788272 4:31133698-31133720 CTACAGCAGAAAAATGTGCGAGG - Intronic
972772621 4:42211838-42211860 CTTCAGGAAAAAAAAAAGCCAGG + Intergenic
973624467 4:52757604-52757626 TTGCAGTAGAATAATGTGCCTGG + Intergenic
973704043 4:53564276-53564298 CTTCAGGAGAAAGATGACACAGG - Intronic
976619605 4:87114715-87114737 CTGCAGGGGGAAAGGGAGCCAGG + Exonic
977571803 4:98636684-98636706 CTGCTGGAAAAAAATGCGGCTGG + Intronic
979471170 4:121098715-121098737 CTGTAGAAGTAGAATGAGCCTGG - Intergenic
979551829 4:121999641-121999663 CAGCAGGAGTAAAAAGAGCATGG + Intergenic
981995134 4:150965873-150965895 CTGAAGGAGAGAGATGAGCAAGG + Intronic
982207340 4:153006466-153006488 GTGCCTGAGAAAAATGAGGCTGG + Intergenic
982340569 4:154293678-154293700 CTGGAGGAGAGAAATGAGTTAGG - Intronic
982636775 4:157906837-157906859 CAGCAAGAGAAGAATGAACCAGG + Intergenic
983535124 4:168849428-168849450 CTGCAGAAGAAAAAGGAGAAAGG + Intronic
984095200 4:175425798-175425820 CTTCAGGTGAAAAAAGAGGCTGG - Intergenic
985136044 4:186787204-186787226 GTGTAGGAGAAACATGAGTCTGG + Intergenic
986274810 5:6264459-6264481 CTGCAGGACAACAAACAGCCTGG + Intergenic
987288479 5:16484829-16484851 CTGCAGGAATAACATCAGCCTGG - Intronic
987452283 5:18101006-18101028 CACCAGGAGTGAAATGAGCCAGG + Intergenic
987659899 5:20858741-20858763 CAGCAGTAGAAAAATGTGACGGG + Intergenic
991619567 5:68531577-68531599 CAGCAAGAGAAAAATGAGAAGGG - Intergenic
992639877 5:78760099-78760121 CTACAGGAGGAAAAAGTGCCAGG + Intronic
993111097 5:83658242-83658264 CTGCAGGAGAATGAGCAGCCAGG + Intronic
993776501 5:92005368-92005390 AAGCAGAACAAAAATGAGCCAGG + Intergenic
994009102 5:94879016-94879038 CTTCTGGAGAAAAGTGATCCAGG + Intronic
994026269 5:95087988-95088010 CTACAGGAGCAAAATGCGCTGGG + Intronic
994761099 5:103855397-103855419 ATGCAGGAGAAAAGGAAGCCTGG - Intergenic
997246490 5:132354346-132354368 AAGCAGGAGAAAAATGAAGCAGG - Intergenic
997497818 5:134345344-134345366 CAACATGTGAAAAATGAGCCTGG + Intronic
997674415 5:135702014-135702036 ATGGATGAGAAAGATGAGCCTGG + Intergenic
997702227 5:135910872-135910894 AGGCAGGAGAAGAATGAACCAGG + Intergenic
998545323 5:143022820-143022842 TTGCAGGAAAAAAATGACCCTGG - Intronic
999464442 5:151788775-151788797 CTCCAGAAAAAAAAAGAGCCAGG - Intronic
1000125856 5:158243294-158243316 GGGCAGGAGAAAAAAGAGCACGG - Intergenic
1000950661 5:167478349-167478371 CTCCAGGAGAAAACTCTGCCAGG + Intronic
1001418995 5:171572655-171572677 CAGGAGGGGAAAAATGAGACTGG - Intergenic
1001695107 5:173664169-173664191 CTGCAGAAGAGAAATGGGCTAGG - Intergenic
1002854305 6:1023702-1023724 CTGCAGAAGGAAAAGGAGTCTGG - Intergenic
1004268735 6:14174807-14174829 CTTCAGGAAAAAGATGAGTCGGG - Intergenic
1004766716 6:18737314-18737336 CTTCAATAGAAAAATGAGGCCGG + Intergenic
1005500256 6:26423051-26423073 CTGCAGGGGAGAACTGAGACTGG - Intergenic
1006096373 6:31659186-31659208 CTGCAGGAGACCAAAGAGGCAGG + Exonic
1007317900 6:41004109-41004131 CAGCAGGAGAAGAAGCAGCCTGG - Intergenic
1008192424 6:48475963-48475985 CTGCAGGCGAATAAAGAACCAGG + Intergenic
1011140546 6:84150875-84150897 CTGTAGGAGGAGAATGAGCATGG - Intronic
1012032181 6:94085586-94085608 CTGCTGGAAAAAAATGAGAAAGG - Intergenic
1014226643 6:118855818-118855840 GTGGAGGAAAAAAATAAGCCAGG - Intronic
1015263712 6:131267578-131267600 CGGGAGGAGAATGATGAGCCTGG - Intronic
1015278941 6:131411684-131411706 AAGAAGGAGAAAAATGAGACTGG + Intergenic
1015580214 6:134715876-134715898 ATGCAGGAGAAAAAGCAGCAGGG - Intergenic
1015965857 6:138694212-138694234 CAGTGGGAGAAAAATGGGCCTGG + Intergenic
1017017300 6:150112068-150112090 TTGCAGGAGTAAAAGGAGGCAGG - Intergenic
1017086071 6:150714105-150714127 CTCCTGGAGAAAAATGTGTCTGG + Intronic
1017262482 6:152403167-152403189 ATGCAGCAGAAACCTGAGCCTGG + Intronic
1017481804 6:154864876-154864898 CTGCAGAAGAAGAATTAGGCTGG - Intronic
1018836430 6:167487724-167487746 CAGCAGGGGAAGAAGGAGCCTGG - Intergenic
1019060085 6:169251401-169251423 CTGCAGGAAAATAAAGAGGCAGG - Intronic
1019233810 6:170591588-170591610 CTACAGAAGAAAAAAGAGCACGG + Intergenic
1019283109 7:210436-210458 GGGCAGGAGACAAATGAGCCTGG + Intronic
1020291029 7:6722294-6722316 CTCCAGGACAAAGATCAGCCTGG - Intergenic
1021124643 7:16837082-16837104 CTGCAGATGAAAAATGAGAGTGG + Intergenic
1022254271 7:28640661-28640683 ATGCTGGAAGAAAATGAGCCTGG + Intronic
1025211494 7:57021490-57021512 CCCCAGGAGAGAAACGAGCCAGG + Intergenic
1025660461 7:63555357-63555379 CCCCAGGAGAGAAACGAGCCAGG - Intergenic
1025948496 7:66123882-66123904 CTGTACTAAAAAAATGAGCCGGG + Intronic
1026376175 7:69753383-69753405 AGGCATGAGAAAAATGAGTCAGG + Intronic
1026480878 7:70778382-70778404 ATACAGGAGACCAATGAGCCAGG + Intronic
1026511077 7:71027762-71027784 CTAGAGGAGAAAACTGAGCTGGG + Intergenic
1026725855 7:72869422-72869444 TTGAAGGACAAAAATGAGCTGGG - Intergenic
1027622189 7:80502762-80502784 ATGCAGGATAAATATGAGGCTGG - Intronic
1029949198 7:104564819-104564841 CTGTGGGAGAAAAGTGTGCCGGG + Intronic
1030072495 7:105710031-105710053 CTACAAAAGAAAAATTAGCCAGG - Intronic
1030966354 7:115996910-115996932 CTGCAGTAGAAAAGAGAACCAGG + Intronic
1031821214 7:126504086-126504108 CTCCATGAGAAAAATGAGATGGG - Intronic
1033041252 7:137920314-137920336 CAGCATGAGAAGAATGAGCTAGG + Intronic
1034180616 7:149134706-149134728 CTGAAGGAAAAAAAACAGCCTGG - Intronic
1034728293 7:153360887-153360909 CTGGATGAGAACACTGAGCCTGG - Intergenic
1035280184 7:157773502-157773524 CTGATGGAGAAAACTGAGCACGG - Intronic
1035681114 8:1488829-1488851 CTGCAGGACAAGAGTCAGCCTGG - Intergenic
1035811333 8:2493819-2493841 TTGCAGGTGAAAACTGAGCTGGG - Intergenic
1035908173 8:3536530-3536552 CTCCATGAGAAGGATGAGCCTGG + Intronic
1036203946 8:6791736-6791758 ATCCAGGAGAAAAATCAGCAAGG - Intergenic
1036575832 8:10027011-10027033 CTGTAGGGGAAAAATGAGCCAGG + Intergenic
1037212748 8:16411906-16411928 CTGAAGCAGAAAAAGCAGCCAGG + Intronic
1037228095 8:16620185-16620207 CTGCAGGACAACAAGTAGCCTGG - Intergenic
1037653173 8:20859117-20859139 CTGCATGAGAAAGATAAGCATGG - Intergenic
1038923691 8:32114254-32114276 CTGCAGGAGAAAGATGTTGCAGG - Intronic
1039164427 8:34661345-34661367 CTTTTGGAGAAAAATGAGCAAGG - Intergenic
1039558450 8:38494148-38494170 CTGAGGAAGAAAAATGGGCCAGG + Intergenic
1039968756 8:42303801-42303823 ATGCAGAAGAAAAATGGGGCTGG - Intronic
1041696294 8:60740436-60740458 CTGCGGGTGAATAATGAGCCTGG + Intronic
1042949337 8:74184916-74184938 AGGAAGGAGAAAAAAGAGCCAGG - Intergenic
1043039716 8:75247308-75247330 CTGAAGGAGAAAAATGAATAGGG - Intergenic
1043054916 8:75425243-75425265 CTGAAGTACAAAAATTAGCCAGG - Intronic
1043381270 8:79704783-79704805 CTTCAGGAGAATAATTAGGCTGG - Intergenic
1043425326 8:80142539-80142561 CTGAAGTACAAAAATGAGCCAGG + Intronic
1043926107 8:86039243-86039265 CTGCCAGAGAAAAATAAGCCTGG + Intronic
1044540019 8:93398328-93398350 CTGAAGGATAAAAATGATTCAGG + Intergenic
1044642424 8:94397542-94397564 CTGCAGTAGAAAATTGATCTAGG - Intronic
1045025694 8:98084474-98084496 AGGCAGGAGAAAATTGAACCCGG - Intronic
1045082304 8:98640212-98640234 CTACAGTACAAAAATTAGCCTGG - Intronic
1045621729 8:103985924-103985946 CTGAAGCAGAGAAAAGAGCCTGG + Intronic
1045873543 8:106952429-106952451 ATGCAGAAGAGAAAAGAGCCTGG + Intergenic
1047652650 8:126940126-126940148 CTGCAGGAGGAAACAGAGCATGG - Intergenic
1048614195 8:136056619-136056641 CTGAAGGAAAAGAAGGAGCCAGG - Intergenic
1049244012 8:141551844-141551866 CTGCAGGAGGGACATGGGCCAGG - Intergenic
1049812725 8:144582681-144582703 CTGCAGGAGGAGGATGAGGCGGG + Intronic
1050705670 9:8394106-8394128 TTTCAGTGGAAAAATGAGCCTGG + Intronic
1051978660 9:22986042-22986064 CCACAAGAGAAAAAGGAGCCAGG - Intergenic
1051996274 9:23221250-23221272 CTTCAGGAGAAAATTCACCCAGG + Intergenic
1052088946 9:24303263-24303285 CAGAAGGAGAAAAATGAGAAAGG - Intergenic
1052329099 9:27248915-27248937 CTGCATGTGACAAATGAGACTGG - Intergenic
1055648307 9:78381765-78381787 TTGCTGGAGAAAAATAACCCTGG - Intergenic
1058465594 9:105223899-105223921 CAGCAAGAGAAAAATGAGCCAGG - Intergenic
1059466663 9:114473072-114473094 CTGCTGGAGACACATGAGCTTGG + Intronic
1062575428 9:137205037-137205059 CTGCAGGAGAATGAAGAGCGGGG + Exonic
1062676205 9:137745983-137746005 ATCCAGAAGAAAAATGAGCAGGG - Intronic
1203433362 Un_GL000195v1:113340-113362 CTGTAGGAGAAAAATTAGGCTGG + Intergenic
1185601329 X:1341705-1341727 CTGCAGGAGAAACGAGAGTCAGG - Intronic
1185989849 X:4881488-4881510 CAGCAGGAGAGAAGGGAGCCTGG - Intergenic
1186684010 X:11905351-11905373 TTGAAAGAAAAAAATGAGCCTGG + Intergenic
1187738025 X:22324242-22324264 CTGCAGGAAGCAAATGAGCAGGG - Intergenic
1188736952 X:33728534-33728556 TTTAAGGAGAAAAATGGGCCTGG + Intergenic
1189248266 X:39580246-39580268 AGGCAGGAAAACAATGAGCCAGG - Intergenic
1189271621 X:39755947-39755969 CTGCCAGACAAGAATGAGCCAGG + Intergenic
1189644442 X:43112038-43112060 GTGCAGGAAAAATATGAGGCTGG - Intergenic
1191190209 X:57658473-57658495 CTGGAAGAGGAAAATGACCCTGG + Intergenic
1191709982 X:64139444-64139466 CTGAAGGAGGAGAAAGAGCCAGG - Intergenic
1192072669 X:67957752-67957774 ATGGAGGAGAATAATGAGCCAGG - Intergenic
1192339051 X:70247178-70247200 CTACAGAAGAAAAATTAGCAAGG + Intergenic
1193369759 X:80680638-80680660 CTGCAGTAAAAATATGAGTCTGG - Intronic
1196817007 X:119673207-119673229 CTCTACGAAAAAAATGAGCCCGG + Intronic
1197449066 X:126588570-126588592 CTGGAAGAGAAAACCGAGCCTGG - Intergenic
1198201326 X:134422087-134422109 CTGCACAAAAAAAATTAGCCGGG - Intronic
1198334768 X:135655580-135655602 CTGAAATACAAAAATGAGCCAGG + Intergenic
1198780438 X:140229459-140229481 CTGCAGCACAAATATGGGCCTGG + Intergenic
1200293834 X:154897521-154897543 GCGCAGGAGAAAAATGAAGCAGG + Intronic
1200826494 Y:7650211-7650233 CCTGAGGAGAAAAATGAGCAAGG + Intergenic
1201060854 Y:10045400-10045422 CCTGAGGAGAAAAATGAGCAAGG + Intergenic
1202106793 Y:21379280-21379302 CCTGAGGAGAAAAATGAGCAAGG + Intergenic
1202200088 Y:22337126-22337148 CCTGAGGAGAAAAATGAGCAAGG - Intronic