ID: 1167622481

View in Genome Browser
Species Human (GRCh38)
Location 19:50567573-50567595
Sequence GACTCCCGCCCCAGAAAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167622474_1167622481 -1 Left 1167622474 19:50567551-50567573 CCATGGGGAGAGGAAGAACCTGG No data
Right 1167622481 19:50567573-50567595 GACTCCCGCCCCAGAAAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167622481 Original CRISPR GACTCCCGCCCCAGAAAGGG GGG Intronic