ID: 1167623059

View in Genome Browser
Species Human (GRCh38)
Location 19:50569284-50569306
Sequence TCTTCTCTTCATGAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167623059_1167623067 19 Left 1167623059 19:50569284-50569306 CCCTCCACCTCATGAAGAGAAGA No data
Right 1167623067 19:50569326-50569348 AGAAGAGACCACTGAGCTCTTGG No data
1167623059_1167623070 29 Left 1167623059 19:50569284-50569306 CCCTCCACCTCATGAAGAGAAGA No data
Right 1167623070 19:50569336-50569358 ACTGAGCTCTTGGAGGAGCCAGG No data
1167623059_1167623068 22 Left 1167623059 19:50569284-50569306 CCCTCCACCTCATGAAGAGAAGA No data
Right 1167623068 19:50569329-50569351 AGAGACCACTGAGCTCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167623059 Original CRISPR TCTTCTCTTCATGAGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr