ID: 1167628400

View in Genome Browser
Species Human (GRCh38)
Location 19:50607525-50607547
Sequence CAGGGGACTGAGAAAGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167628400_1167628409 8 Left 1167628400 19:50607525-50607547 CCATCCTCTTTCTCAGTCCCCTG No data
Right 1167628409 19:50607556-50607578 GGCGCTCCACCTGTGACCGTGGG No data
1167628400_1167628414 28 Left 1167628400 19:50607525-50607547 CCATCCTCTTTCTCAGTCCCCTG No data
Right 1167628414 19:50607576-50607598 GGGGTCTTTTTCTGTCCCCTCGG No data
1167628400_1167628408 7 Left 1167628400 19:50607525-50607547 CCATCCTCTTTCTCAGTCCCCTG No data
Right 1167628408 19:50607555-50607577 GGGCGCTCCACCTGTGACCGTGG No data
1167628400_1167628410 9 Left 1167628400 19:50607525-50607547 CCATCCTCTTTCTCAGTCCCCTG No data
Right 1167628410 19:50607557-50607579 GCGCTCCACCTGTGACCGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167628400 Original CRISPR CAGGGGACTGAGAAAGAGGA TGG (reversed) Intergenic
No off target data available for this crispr