ID: 1167629169

View in Genome Browser
Species Human (GRCh38)
Location 19:50613312-50613334
Sequence CCAGCCTCGTGGATCACTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167629164_1167629169 8 Left 1167629164 19:50613281-50613303 CCAAATACACCTTTTTCTCTTTA No data
Right 1167629169 19:50613312-50613334 CCAGCCTCGTGGATCACTTTAGG No data
1167629163_1167629169 24 Left 1167629163 19:50613265-50613287 CCAGAAGAATCATAAGCCAAATA No data
Right 1167629169 19:50613312-50613334 CCAGCCTCGTGGATCACTTTAGG No data
1167629162_1167629169 28 Left 1167629162 19:50613261-50613283 CCAGCCAGAAGAATCATAAGCCA No data
Right 1167629169 19:50613312-50613334 CCAGCCTCGTGGATCACTTTAGG No data
1167629165_1167629169 -1 Left 1167629165 19:50613290-50613312 CCTTTTTCTCTTTATAAATTACC No data
Right 1167629169 19:50613312-50613334 CCAGCCTCGTGGATCACTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167629169 Original CRISPR CCAGCCTCGTGGATCACTTT AGG Intergenic
No off target data available for this crispr