ID: 1167632322

View in Genome Browser
Species Human (GRCh38)
Location 19:50632655-50632677
Sequence GGGCCTAGGTCTTTGCGCAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 67}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167632308_1167632322 10 Left 1167632308 19:50632622-50632644 CCTCCGCCTACCAGGCCTGCCAG 0: 1
1: 0
2: 1
3: 23
4: 259
Right 1167632322 19:50632655-50632677 GGGCCTAGGTCTTTGCGCAGGGG 0: 1
1: 0
2: 0
3: 5
4: 67
1167632307_1167632322 13 Left 1167632307 19:50632619-50632641 CCGCCTCCGCCTACCAGGCCTGC 0: 1
1: 0
2: 0
3: 49
4: 456
Right 1167632322 19:50632655-50632677 GGGCCTAGGTCTTTGCGCAGGGG 0: 1
1: 0
2: 0
3: 5
4: 67
1167632314_1167632322 -5 Left 1167632314 19:50632637-50632659 CCTGCCAGCCCGACACCAGGGCC 0: 1
1: 0
2: 3
3: 35
4: 341
Right 1167632322 19:50632655-50632677 GGGCCTAGGTCTTTGCGCAGGGG 0: 1
1: 0
2: 0
3: 5
4: 67
1167632306_1167632322 14 Left 1167632306 19:50632618-50632640 CCCGCCTCCGCCTACCAGGCCTG 0: 1
1: 0
2: 4
3: 84
4: 676
Right 1167632322 19:50632655-50632677 GGGCCTAGGTCTTTGCGCAGGGG 0: 1
1: 0
2: 0
3: 5
4: 67
1167632303_1167632322 27 Left 1167632303 19:50632605-50632627 CCGCCAGGTGGTGCCCGCCTCCG 0: 1
1: 0
2: 0
3: 15
4: 154
Right 1167632322 19:50632655-50632677 GGGCCTAGGTCTTTGCGCAGGGG 0: 1
1: 0
2: 0
3: 5
4: 67
1167632304_1167632322 24 Left 1167632304 19:50632608-50632630 CCAGGTGGTGCCCGCCTCCGCCT 0: 1
1: 1
2: 0
3: 29
4: 201
Right 1167632322 19:50632655-50632677 GGGCCTAGGTCTTTGCGCAGGGG 0: 1
1: 0
2: 0
3: 5
4: 67
1167632311_1167632322 0 Left 1167632311 19:50632632-50632654 CCAGGCCTGCCAGCCCGACACCA 0: 1
1: 0
2: 2
3: 26
4: 237
Right 1167632322 19:50632655-50632677 GGGCCTAGGTCTTTGCGCAGGGG 0: 1
1: 0
2: 0
3: 5
4: 67
1167632310_1167632322 4 Left 1167632310 19:50632628-50632650 CCTACCAGGCCTGCCAGCCCGAC 0: 1
1: 0
2: 1
3: 19
4: 414
Right 1167632322 19:50632655-50632677 GGGCCTAGGTCTTTGCGCAGGGG 0: 1
1: 0
2: 0
3: 5
4: 67
1167632309_1167632322 7 Left 1167632309 19:50632625-50632647 CCGCCTACCAGGCCTGCCAGCCC 0: 1
1: 0
2: 3
3: 59
4: 574
Right 1167632322 19:50632655-50632677 GGGCCTAGGTCTTTGCGCAGGGG 0: 1
1: 0
2: 0
3: 5
4: 67
1167632315_1167632322 -9 Left 1167632315 19:50632641-50632663 CCAGCCCGACACCAGGGCCTAGG 0: 1
1: 0
2: 2
3: 17
4: 196
Right 1167632322 19:50632655-50632677 GGGCCTAGGTCTTTGCGCAGGGG 0: 1
1: 0
2: 0
3: 5
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167632322 Original CRISPR GGGCCTAGGTCTTTGCGCAG GGG Exonic
901021686 1:6259273-6259295 GGCTCTAGGTCTGTGGGCAGGGG + Intronic
902799463 1:18820218-18820240 GGGCCAGGGTCTCTGCGCACTGG + Intergenic
904787564 1:32994125-32994147 AGGCCTGGGTCTCTGCCCAGTGG + Intergenic
905951413 1:41954575-41954597 GGCCCTATGTCTCTGAGCAGGGG + Intronic
915522549 1:156456423-156456445 TGGCCTGGGTCTTTGTGCAGAGG - Intergenic
918084853 1:181236947-181236969 AGGCCCAGGTCTTTCCACAGAGG + Intergenic
920050270 1:203160523-203160545 GTGCCTAGGGCTGGGCGCAGTGG + Intronic
1072191457 10:93079949-93079971 GGGCCAAGGGCATTGCGCAAGGG - Intergenic
1072249191 10:93568310-93568332 GGACTTAGGTCTGTGCGCTGGGG + Intronic
1074524397 10:114251626-114251648 GTGCCTATGTGTTTACGCAGAGG + Intronic
1077631832 11:3816406-3816428 GGGTCAAGGTGTTTGGGCAGTGG + Intronic
1083027110 11:59560172-59560194 GGGGATAGGCCTTTGTGCAGAGG - Intergenic
1087923046 11:103889051-103889073 TGGCGTAGGTCTTTGAGAAGAGG - Intergenic
1100690363 12:97032982-97033004 TGGACTAGGTCTTTGCCCTGAGG + Intergenic
1103008105 12:117437983-117438005 GGGCCTAGGTCCTGGCACAGAGG + Intronic
1104224014 12:126813415-126813437 AGGCCCAGGGCTTTGGGCAGGGG + Intergenic
1106786159 13:33109968-33109990 GGGACGAGGACTTTGTGCAGTGG - Exonic
1107622981 13:42252692-42252714 TGCCATAGGTCTCTGCGCAGTGG - Intronic
1119751912 14:77084696-77084718 GGGCCTAGGGCTGGGTGCAGTGG - Intergenic
1122371044 14:101229200-101229222 GGGCCAAGGTCTCTGGGCAAGGG - Intergenic
1125760488 15:42092987-42093009 GGGCCTGGGGCTGTGCCCAGGGG - Intronic
1127838312 15:62808662-62808684 GGGCCTGTGTCTTCCCGCAGTGG + Intronic
1128086757 15:64891921-64891943 GGGTCTAGGTGTTTCCACAGTGG + Intronic
1128607244 15:69046239-69046261 GGCCCTAGGGCTTTGCTCTGGGG - Intronic
1139492769 16:67295438-67295460 GAGGCTAGGTCTTTGCGAAGGGG + Intronic
1139580646 16:67871882-67871904 GGGCCTGGCTCTGTGGGCAGTGG - Exonic
1142910142 17:3082434-3082456 GGGCCAAGGCCTTTGCTCTGAGG + Intergenic
1146273234 17:31498106-31498128 GGGCCTGGTTCTGTGGGCAGTGG + Intronic
1147961557 17:44170762-44170784 GGGCCCAGGGGTTTGGGCAGTGG - Exonic
1150336587 17:64334792-64334814 GGGCCCAGGGCCGTGCGCAGTGG - Intronic
1152410655 17:80120856-80120878 GGGCCTAAGACTTTAGGCAGAGG + Intergenic
1152888495 17:82866607-82866629 GGCCCCAGGACTTTGCGCTGTGG + Intronic
1160719457 19:590855-590877 GGGCCAGGGTCTGAGCGCAGAGG + Intronic
1161560539 19:4970111-4970133 GGGCCCAGGTCTGCGCTCAGTGG + Intronic
1163184660 19:15629119-15629141 GGGCCTGGTTCCTGGCGCAGTGG + Intronic
1165810245 19:38607684-38607706 GGGCCTAGGTAGCTGGGCAGAGG + Intronic
1167632322 19:50632655-50632677 GGGCCTAGGTCTTTGCGCAGGGG + Exonic
927712569 2:25334716-25334738 CAGCCTAGGCCTTTGCTCAGAGG + Intronic
928366364 2:30706314-30706336 GGCCTTAGGTCTGTGCCCAGTGG - Intergenic
929605054 2:43227963-43227985 AGGCCTAGTTCTTTCCCCAGCGG - Intergenic
930028611 2:47044882-47044904 GAGCCCAGGTCTTAGGGCAGAGG + Intronic
932625585 2:73293406-73293428 GCGCCTAGGTCTGTGCGCTGCGG - Exonic
937479029 2:122240300-122240322 TGTCCTGGGTCTTTGCACAGTGG + Intergenic
948424891 2:237880937-237880959 GGGCAGAGGTCTCTGCGCAAAGG + Intronic
948805613 2:240452535-240452557 GGGCCCAGGCCTTGGTGCAGGGG - Intronic
949029883 2:241788887-241788909 TGGCCTAGGTTTTTGTGTAGTGG - Intronic
1169669561 20:8081154-8081176 GGGACCAGGTCTTTGTGCTGTGG + Intergenic
1175090031 20:56494938-56494960 GGGCCTAGCTGTTGGTGCAGAGG + Intronic
1175165204 20:57038697-57038719 CCCCCTAGGTCTTTGCACAGTGG - Intergenic
1176248281 20:64107769-64107791 GTGCCCAGGTCTTCGGGCAGAGG + Intergenic
1182695874 22:32199064-32199086 GGGCCTAGTCCTTTGGGCTGTGG + Intronic
960978927 3:123203137-123203159 AGGCCTAGGTCTTATCACAGGGG + Intronic
961828961 3:129613498-129613520 GGGGCTGGGTCTTTCCTCAGTGG + Intergenic
961832706 3:129632358-129632380 GGGCCTTGGGCTTTGACCAGGGG + Intergenic
974312771 4:60233999-60234021 GTGCATAGGTCTTGGTGCAGTGG - Intergenic
989404777 5:41048289-41048311 GGGGCCAGGTCTTTACCCAGGGG - Intronic
997354644 5:133254479-133254501 GGGACTAGGTGTTTGGGCTGGGG + Intronic
997583415 5:135031010-135031032 GGGCACAGGTCTTTGGGCTGGGG + Intronic
1018968900 6:168511666-168511688 GAGCCTTGGTCTTTGCCCGGTGG + Intronic
1019352445 7:561227-561249 GTGCCTAGGTGTGTGCGCACAGG - Intronic
1023829190 7:44029211-44029233 GGGCCTAGGTCTCTTCCAAGTGG - Intergenic
1026505586 7:70979933-70979955 GAGCCTAGGTCTTGGCACAGTGG - Intergenic
1026941676 7:74290695-74290717 TGGCCTAGGGCTGTGGGCAGAGG + Intronic
1031574628 7:123400441-123400463 GGCCTTAGGTTTTTGCACAGTGG + Intergenic
1033318217 7:140316040-140316062 GTGCCTAGGGCTTAACGCAGAGG + Intronic
1043684070 8:83066198-83066220 GGGCCTAGGTAATTGCCCTGAGG - Intergenic
1048983568 8:139716518-139716540 GGGTCAAGGTCTTTGCTGAGTGG - Intergenic
1049775110 8:144400527-144400549 GGGCCTGGGTCTCTGCGGGGAGG - Intronic
1060896974 9:127224742-127224764 GGGCCTGGGTCTGTGCCGAGGGG + Intronic
1061220085 9:129245471-129245493 GGGCCTTGGCGTTTGAGCAGGGG - Intergenic
1190060156 X:47205624-47205646 GGGCCGAGGTCTTTGAGCTCAGG + Intronic
1196438458 X:115695392-115695414 GCCCCTAGGTGTTTGGGCAGAGG - Intergenic
1197702212 X:129607968-129607990 GGGCCTGGGTCGATGCCCAGTGG - Intergenic