ID: 1167633131

View in Genome Browser
Species Human (GRCh38)
Location 19:50638288-50638310
Sequence TAGGGTAGGAAAGCAGTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 198}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167633131 Original CRISPR TAGGGTAGGAAAGCAGTTGG AGG Intronic
902393664 1:16120476-16120498 TAGGGTGGCATAGCAGATGGAGG + Intergenic
903011325 1:20332735-20332757 CAGGGTCAGAATGCAGTTGGGGG - Intronic
904207128 1:28862662-28862684 AAGGGTGGGCAAGCAGGTGGGGG + Intronic
904713331 1:32448021-32448043 TAGGGAAAGAAAGCCGTGGGGGG - Intergenic
904928668 1:34068732-34068754 TGGGGTAGGAACCCAGTGGGAGG + Intronic
905799927 1:40836895-40836917 AAGGGGAGGAAAGGAATTGGAGG + Intronic
905802753 1:40855889-40855911 GAGGGTGGGAAGGCACTTGGAGG + Intergenic
908478667 1:64514542-64514564 TGGGGGAGGAATGCAGTTGTAGG + Intronic
908486523 1:64599537-64599559 AAGTGTAGGATAGGAGTTGGTGG + Intronic
908558887 1:65285226-65285248 TAGGCTGGGAAACCAGATGGTGG - Intronic
911124712 1:94330377-94330399 CAGGGAAGGAAAGAAGTGGGTGG - Intergenic
911357472 1:96840059-96840081 GAGGTTAAGAAAGCAATTGGAGG + Intergenic
912439846 1:109689426-109689448 TAGTATGGGAAAGCACTTGGAGG - Intronic
912443205 1:109714109-109714131 TAGTATGGGAAAGCACTTGGAGG - Intronic
912447990 1:109751957-109751979 TAGGCTAGAAAAGGAGGTGGTGG - Intronic
912609525 1:111029088-111029110 CAGGGAGGGAAAACAGTTGGAGG + Intergenic
913171049 1:116232482-116232504 GAGGGCAGGAAAGGAGGTGGTGG + Intergenic
918586404 1:186193513-186193535 TAGGGTAGGAAAAGGTTTGGAGG - Intergenic
918623630 1:186633579-186633601 TGGGTTAGGAATGCAGCTGGTGG + Intergenic
923619300 1:235565021-235565043 CATGGTAGGAAAGAAGTTGCAGG - Intronic
1063140906 10:3255805-3255827 TTGGGTAGGAACACAGTGGGAGG + Intergenic
1063507949 10:6618596-6618618 TAGAGTTGGAATTCAGTTGGAGG + Intergenic
1065810475 10:29438455-29438477 TAGGGAAAGAAAGCAGTGGGGGG - Intergenic
1065843748 10:29727908-29727930 TAGAGTAGGATGGTAGTTGGAGG - Intronic
1066043900 10:31579806-31579828 TAGGGTAGGAAAGAGGTGGATGG + Intergenic
1066995657 10:42560420-42560442 TCAGGTTGGAAAGCAGATGGGGG - Intergenic
1069363083 10:67666347-67666369 TAGGGAAGGAATGCAGTAGGGGG - Intronic
1072027838 10:91480287-91480309 TAGGATAGGAAAGGACTTGGAGG + Intronic
1073059811 10:100726688-100726710 TAGGTTAGGGAGGCAGTAGGTGG + Intergenic
1073438590 10:103537934-103537956 TAGTGACGGAAAGCAGCTGGCGG - Intronic
1073760081 10:106619900-106619922 TAGGGTAAGAAGGCCATTGGGGG + Intronic
1073926435 10:108521597-108521619 TAGGGGAGGAAAGCAGACAGAGG - Intergenic
1074786578 10:116847513-116847535 TAGGGTGGAAAAGTAGTTTGAGG - Intergenic
1074861766 10:117515302-117515324 TAAGGTATGAAATGAGTTGGGGG + Intergenic
1077010819 11:378537-378559 TGGGGAAGGACAGGAGTTGGAGG + Intronic
1078055194 11:8003557-8003579 TAGGGTGGGCAGGCAGCTGGGGG - Intergenic
1079500760 11:21098782-21098804 GAGGGTAGCAAAGGAATTGGGGG - Intronic
1081126263 11:39326814-39326836 TAGGGGAGGAAACTAGTAGGAGG - Intergenic
1081623359 11:44632240-44632262 TGGGGAAGGAATGCAGCTGGGGG + Intergenic
1083564916 11:63705820-63705842 TAGGGAAGGGAATCAGTTTGTGG + Intronic
1084010170 11:66343645-66343667 AAGAGAAGGAAAGCAGCTGGGGG + Intronic
1088989211 11:114937219-114937241 TAGGCTCAGAATGCAGTTGGTGG - Intergenic
1097224135 12:57467143-57467165 TGGAGAAGGGAAGCAGTTGGAGG - Intronic
1097937706 12:65272143-65272165 TATGGTAGGAAAAAAGTTGCCGG - Intergenic
1102139380 12:110602038-110602060 TAGGCCTGGAAAGCAATTGGTGG + Intergenic
1102410821 12:112716744-112716766 TAGGGGAGGAAAGATGTTGGGGG + Intronic
1103635697 12:122303403-122303425 TAAGGTAGGAAGGGTGTTGGGGG - Intronic
1103897556 12:124283508-124283530 TAGGCTAGAAAAACAGTTGTAGG + Intronic
1108009037 13:45984706-45984728 GAGGGGAGAAAAGCAGGTGGAGG + Intronic
1108157728 13:47603713-47603735 TAGTGTAGAAAATGAGTTGGGGG - Intergenic
1110240839 13:73264931-73264953 AAGGGAAGGATTGCAGTTGGGGG + Intergenic
1111107922 13:83670075-83670097 TGGGGGAGGGAACCAGTTGGAGG + Intergenic
1111437148 13:88225346-88225368 TAGGATAGGAAAGAAACTGGGGG + Intergenic
1111737252 13:92158243-92158265 GAGGCTGAGAAAGCAGTTGGTGG + Intronic
1113566190 13:111320978-111321000 TGGGGTGGGGGAGCAGTTGGGGG + Intronic
1116262755 14:42652779-42652801 ACTGGTAGGTAAGCAGTTGGGGG - Intergenic
1118000229 14:61516162-61516184 TAGGGGAGGGAAGCAGATTGAGG + Intronic
1118299866 14:64605761-64605783 TTGGGTTGGGAAGCAGATGGAGG + Intergenic
1120242077 14:81960936-81960958 TAAGGCAGGGAAGCTGTTGGCGG + Intergenic
1120920174 14:89747764-89747786 TATGATATGAAAACAGTTGGAGG - Intergenic
1121136375 14:91502561-91502583 TAGGGTGGAAAAGCTTTTGGGGG - Intronic
1121181777 14:91934757-91934779 GAGGGAAGGAAACCAGATGGGGG - Intronic
1124242100 15:28037263-28037285 GAGGGCAGGAAGGCAGCTGGTGG + Intronic
1125250069 15:37691212-37691234 GAGGTTTGGAAAGCAATTGGTGG - Intergenic
1125553445 15:40565074-40565096 TCGGGTGGGAAGGTAGTTGGAGG - Intergenic
1126196484 15:45937296-45937318 TGGGGCAGTAAAGCAGTTGGAGG - Intergenic
1126204788 15:46033644-46033666 TTGGTTAGGAAATCAGTCGGGGG - Intergenic
1126415079 15:48409454-48409476 AAGGGCAGGAAAGCATTTCGTGG - Exonic
1134904592 16:17969487-17969509 TAGGGTAGGAAGGAAGTTGTAGG - Intergenic
1135653274 16:24225635-24225657 TAGGGTAGGAATTGAATTGGAGG + Intergenic
1136235296 16:28910195-28910217 GAGGGTAGGAGGGCAGTAGGCGG - Intronic
1136399431 16:30009838-30009860 TAGGGGAGGAGGGCAGTGGGGGG - Intronic
1137484717 16:48881685-48881707 TAGGGCAGGAGTGGAGTTGGTGG - Intergenic
1139914329 16:70418863-70418885 TGGGGCAGGAAATCAGCTGGTGG + Intronic
1140199128 16:72880182-72880204 GAGGGTAGGACAGAAGGTGGTGG - Intronic
1140490963 16:75335505-75335527 TAAAGTAGGAAATCAGTTGAAGG - Intronic
1140711797 16:77685748-77685770 GAGGGTAGGGAAGGAGTGGGGGG - Intergenic
1141152553 16:81574276-81574298 CAGGGTGGCCAAGCAGTTGGAGG - Intronic
1141612866 16:85192971-85192993 TAGGGCAGGAGGGCTGTTGGAGG + Intergenic
1146455288 17:33004810-33004832 TAGGGTAGGGAAACTGTGGGAGG + Intergenic
1150645711 17:66976386-66976408 GAGGGATGGAAAGAAGTTGGAGG - Intronic
1153550732 18:6258969-6258991 TAGGGTAAGAAAGGAGTGGTTGG + Intronic
1153671807 18:7418989-7419011 TAGGTAAAGAAAGCAGTAGGGGG - Intergenic
1153968882 18:10206615-10206637 GAGGGTAGGAAAAGAGTGGGAGG + Intergenic
1155005803 18:21728126-21728148 AAGGGCAGGGAAGCGGTTGGGGG - Intronic
1155052724 18:22162937-22162959 TATGGTAGGAAAGGAGGTGAAGG - Intergenic
1155070767 18:22314026-22314048 CAGGGAAGGGAAGGAGTTGGGGG + Intergenic
1156039055 18:32798458-32798480 TAGGGTAGAAAAGCAATGGTCGG + Intergenic
1158045541 18:53150690-53150712 CAGGGCAGCAAAGCAATTGGAGG + Intronic
1160158801 18:76455328-76455350 TGGGGTAGGAGAGAAGTTGCAGG - Intronic
1161225474 19:3142921-3142943 GAGGGTTGGAAGGCAATTGGGGG + Intronic
1162842526 19:13366816-13366838 CTGGGTAGGAAAGCGGTTGGCGG + Intronic
1162950112 19:14066372-14066394 TGAGGTGGGAATGCAGTTGGGGG + Intergenic
1163072039 19:14851761-14851783 TAGGGTTGGAAATAAGGTGGAGG - Intergenic
1164743734 19:30595622-30595644 TTGGGTGGGAGAGCAGTTCGAGG - Intronic
1165663366 19:37602791-37602813 TATGGCAGGAAAGAAGCTGGTGG + Intronic
1166916511 19:46199122-46199144 CAGGGTAGGGCAGCAGTTGGAGG + Intergenic
1167633131 19:50638288-50638310 TAGGGTAGGAAAGCAGTTGGAGG + Intronic
926459123 2:13106546-13106568 AAGGTTAGGCAAGCAGTTGCCGG - Intergenic
928164193 2:28957762-28957784 TAGGATAGGGAAGGAGTAGGGGG + Intronic
929620881 2:43352873-43352895 TAGGATAGGAAATCAGATGTAGG - Intronic
931472540 2:62553448-62553470 GAGGGTAGGGAATCAGCTGGGGG + Intergenic
932067630 2:68583266-68583288 TAGGGTAGTAAAGCTGTTGCAGG - Intronic
932954627 2:76337247-76337269 TAGGGAAGGACATCAGGTGGGGG + Intergenic
933510972 2:83241260-83241282 GAGGTTATAAAAGCAGTTGGTGG - Intergenic
933900220 2:86844327-86844349 TAGGGAAGGAAAGCAATGGCTGG + Intronic
935431598 2:102981787-102981809 TTGAGTAGGAATGCAGTAGGAGG - Intergenic
935560045 2:104550199-104550221 TAATGTAGGAAAGAATTTGGTGG - Intergenic
935780335 2:106504896-106504918 TAGGGAAGGAAAGCAATGGCTGG - Intergenic
936435624 2:112502800-112502822 TGGGGTAGGTAAGGAGTGGGAGG - Intronic
939762502 2:146199911-146199933 TAGGGAAGGACAGAAATTGGTGG + Intergenic
941509492 2:166387890-166387912 TTGGGTAGGAGAGTAGATGGAGG + Intergenic
942044649 2:172093089-172093111 GGGGGTAGGAAAGCGGTGGGTGG - Intergenic
942471468 2:176265081-176265103 AAGGGGAGGAAAGGAGTTGAGGG + Intergenic
942884891 2:180911199-180911221 TTGGGGAGGAAAGCGGATGGAGG - Intergenic
944169779 2:196761766-196761788 CAGGGTAGGAAAGGAGTTAATGG - Intronic
945062937 2:205924571-205924593 GAGGCAAGGAAAGCAGGTGGGGG + Intergenic
945783933 2:214210122-214210144 GAGGGTAAGGAAGAAGTTGGGGG + Intronic
1170956065 20:20980452-20980474 TAGCCTAGGAAAGAAGTTAGGGG + Intergenic
1171749806 20:29038030-29038052 TATGGGAGGAACCCAGTTGGAGG - Intergenic
1172027327 20:31957402-31957424 TAGGACAGGAAGGCAGGTGGAGG + Intergenic
1172921555 20:38487181-38487203 TAGGGTAAGAAAGGATTTGCTGG + Intronic
1175704118 20:61163141-61163163 CAGGGAAGGAAAGCGGGTGGAGG - Intergenic
1176315431 21:5237971-5237993 TATGGGAGGAACCCAGTTGGAGG + Intergenic
1177434621 21:21034954-21034976 TAGGTTAGGAAACCAGGAGGAGG + Intronic
1180393219 22:12303926-12303948 TATGGGAGGAACCCAGTTGGAGG + Intergenic
1180406530 22:12560842-12560864 TATGGGAGGAACCCAGTTGGAGG - Intergenic
1180738687 22:18037825-18037847 TTGGGTAGGAGAGCTGGTGGCGG + Intergenic
1183717287 22:39540799-39540821 CAGGGAAGGAAACCAGCTGGGGG + Intergenic
949307126 3:2654730-2654752 TAGGGTAAGAAAGGACTGGGGGG - Intronic
950479994 3:13238202-13238224 CAGGAGAGGAAAGCAGGTGGAGG - Intergenic
951991521 3:28680389-28680411 TAGAGTGGGTAAGCAGTTGAAGG - Intergenic
952012657 3:28918314-28918336 TAGGGTTGGAAGGCACATGGAGG - Intergenic
952108916 3:30099975-30099997 CAGGCTTGGAAAGCATTTGGGGG - Intergenic
953931012 3:47005656-47005678 TAGGGATGGAGAGCAGATGGTGG + Intronic
956062383 3:65360667-65360689 TGGGGTAAGACACCAGTTGGGGG + Intronic
957691778 3:83580167-83580189 AAGGGTTGAAACGCAGTTGGTGG - Intergenic
959555189 3:107708982-107709004 AAGGATAGGCAAGCAGTTGGAGG + Intronic
961484091 3:127205390-127205412 AAGGGGAGGAAAGCAGATGTGGG + Intergenic
962179571 3:133191792-133191814 GAGGGCAGGAAACCAGTGGGAGG + Intronic
962774848 3:138649646-138649668 AAGGGCAGGATTGCAGTTGGTGG + Intergenic
965074979 3:163964329-163964351 TAGCTTATGAAAGCAGCTGGAGG + Intergenic
966120426 3:176513794-176513816 CAAGGAAGGAAAACAGTTGGGGG - Intergenic
972859252 4:43147045-43147067 TAGGGCAAGGAAGTAGTTGGAGG + Intergenic
975910512 4:79260557-79260579 TAGGCTAGGAAAGCATGTGCAGG + Intronic
976145999 4:82043578-82043600 TGGGGGAGGGGAGCAGTTGGAGG + Intronic
976966825 4:91053531-91053553 TAGGATTGCAAAGTAGTTGGTGG - Intronic
985759208 5:1736319-1736341 TGGGGCAGGAAAGCAATTGTAGG + Intergenic
986415044 5:7519843-7519865 TAGGGATGGAAAGCAGATTGGGG - Intronic
986542369 5:8859510-8859532 TTGGGCAGGAACGCAGATGGAGG + Intergenic
986805054 5:11301315-11301337 TAGAGTAAGAAAGCAGATGGGGG - Intronic
987387861 5:17347349-17347371 TATGGGAGGAAGGCAGGTGGGGG - Intergenic
988499975 5:31776361-31776383 CAGGGCAGGGAGGCAGTTGGAGG - Intronic
988825125 5:34928775-34928797 TAGGTTAAGAAAGCAGTTAAAGG - Intergenic
989669567 5:43899682-43899704 AAGGGTAAGAAAGTTGTTGGTGG - Intergenic
990053164 5:51533705-51533727 TAGGGTAGGAGACCGGTTGATGG - Intergenic
990563322 5:57004901-57004923 TAGTTAAGGAAAGCTGTTGGTGG - Intergenic
990644180 5:57825126-57825148 TAAAGTAGAAAAGCAGTTGCTGG + Intergenic
990875210 5:60476617-60476639 AAGGGTAGGAAATGAGGTGGGGG - Intronic
992692184 5:79251663-79251685 AAGGGTAGGAAGGAAGTTGAGGG - Intronic
995581496 5:113607296-113607318 TAGGGAGGGAAAACAGGTGGGGG + Intergenic
997926488 5:138035108-138035130 TAGGGTAGGAATGCTGCTGGAGG - Intronic
998159069 5:139802995-139803017 GAGAGAAGGAAAGCAGGTGGGGG + Intronic
998389864 5:141780455-141780477 TAGGGGAGGAAAGGAGTCTGGGG - Intergenic
998432796 5:142080944-142080966 TGGGTCAGGAAAGCAGATGGAGG + Intergenic
998838401 5:146226945-146226967 TAGAGTAGGAAAGGAGTCTGAGG + Intronic
999841711 5:155434855-155434877 GAGGGTAAGAAATCAGTTTGAGG - Intergenic
1001720024 5:173849271-173849293 TCAGGTAGGAACTCAGTTGGGGG + Intergenic
1002132378 5:177089542-177089564 TATTTTAGGAAGGCAGTTGGTGG + Exonic
1007774248 6:44215998-44216020 TGAGGGAGGAAAGCAGGTGGAGG + Intergenic
1008623113 6:53291364-53291386 TAGGGGAGGAAGGAAGTGGGTGG - Intronic
1009448023 6:63766465-63766487 TGGGATAAGAAAGCAGATGGAGG + Intronic
1009848152 6:69160460-69160482 TAGGTTAGGAATGCAGTTTGTGG - Intronic
1010966346 6:82213732-82213754 ATGGATAGGAAAGCTGTTGGTGG - Intronic
1011321555 6:86099454-86099476 TTGGGTAGGAAAACAGTAGCAGG + Intergenic
1011650992 6:89506022-89506044 TAGAGTAGGAAGGTAGTTGCGGG + Intronic
1012988171 6:105897214-105897236 TGGGGTTGGAAAGCAGTGGATGG - Intergenic
1013376053 6:109515340-109515362 GTGGGTAGGAATGAAGTTGGAGG + Intronic
1014656188 6:124107345-124107367 TAGGGTAGAAAACCAATTGTAGG + Intronic
1015051059 6:128840442-128840464 TAGGGGAGGAAATCAGATGTAGG + Intergenic
1015169387 6:130234681-130234703 TAGGGGAGGAAACCAGTGGTAGG - Intronic
1016779762 6:147944495-147944517 TAGGGGAGGAAACCGGTGGGAGG - Intergenic
1017829378 6:158112017-158112039 TAGGTGAGGAATGCAGGTGGTGG + Intronic
1022102850 7:27179487-27179509 TAAGGTTGGAAAGCAGGGGGAGG - Intronic
1027170162 7:75866300-75866322 TAGTGTAGGCAAGCCCTTGGAGG - Intronic
1027340559 7:77203162-77203184 AGGGGTAGGAAAGGAGATGGAGG + Intronic
1028213208 7:88100922-88100944 TTTGGTAGGAAAGCACCTGGTGG + Intronic
1028343269 7:89748367-89748389 TAGGGTGGGAGAGCTGTTGGGGG + Intergenic
1029519122 7:101049030-101049052 TAGGGTAAGAAGGTAGCTGGGGG + Intronic
1029933411 7:104397611-104397633 TAGAGTAGGTATGCAGTGGGAGG - Intronic
1030039860 7:105439860-105439882 TTGGGAAGGAAAGAAGATGGAGG + Intronic
1036685270 8:10905225-10905247 TTTGGGAGGAAAGCAGGTGGTGG - Intronic
1037469265 8:19191441-19191463 TAGGGTTGGTAAGTAGGTGGGGG - Intergenic
1037810214 8:22082314-22082336 CAGGTGAGGAAAGCAGCTGGGGG - Exonic
1038046743 8:23771991-23772013 TAGGGTAGGAAAAAAGAGGGAGG + Intergenic
1040882996 8:52228781-52228803 TAGTGTTTGAAAGCAGATGGTGG - Intronic
1043437357 8:80247633-80247655 TGGAGGAGGAAAGCAGTAGGAGG + Intergenic
1045480140 8:102585255-102585277 GCTGGCAGGAAAGCAGTTGGGGG + Intergenic
1046818055 8:118607093-118607115 TAGGGTAGGAATGGAATAGGAGG - Intronic
1055017243 9:71632137-71632159 AAGGGAAGGAAAGCAAGTGGAGG + Intergenic
1055617742 9:78090687-78090709 TAGGGGAGGGAGGTAGTTGGCGG + Intergenic
1056469062 9:86887261-86887283 TTGGGTAGGAAATGAGCTGGGGG + Intergenic
1056884155 9:90424052-90424074 TGGGGTAGGAAGGCCGTGGGAGG - Intergenic
1057491217 9:95521356-95521378 AGGAGTAGGAAGGCAGTTGGAGG + Intergenic
1186508167 X:10110428-10110450 TTGGAGAGGAAAGCAGTAGGTGG - Intronic
1188725613 X:33578391-33578413 TAGGGGAGGCCAGCAGATGGGGG + Intergenic
1191862872 X:65680100-65680122 GAAGGTAGGCAAGCAGGTGGAGG + Intronic
1195203149 X:102568507-102568529 GAGGGTAGGCAAGGAGCTGGAGG - Intergenic
1195280186 X:103325559-103325581 TATGGTAGGAAAGAAGTGGGTGG - Intergenic
1196829003 X:119761702-119761724 AAGGCCAGGAAAGCAGTTGCTGG + Intergenic
1198400139 X:136260878-136260900 CAGGGTAAGACAGCACTTGGGGG + Intergenic
1198454266 X:136800407-136800429 AAGGCTAGGACAGGAGTTGGAGG + Intergenic
1199183427 X:144886296-144886318 TTGGGTAAGAAATCAGTTTGTGG - Intergenic
1199567967 X:149235874-149235896 TGGGGTGGGGATGCAGTTGGGGG + Intergenic