ID: 1167633214

View in Genome Browser
Species Human (GRCh38)
Location 19:50638696-50638718
Sequence CGGTCGAACGGGAGGATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167633214 Original CRISPR CGGTCGAACGGGAGGATGGA TGG Intronic
901342658 1:8509424-8509446 CGGACGGACGGATGGATGGATGG - Intronic
901342659 1:8509428-8509450 CGGACGGACGGACGGATGGATGG - Intronic
902689507 1:18101366-18101388 CGGTTGGAAGGGAGGAAGGAAGG - Intergenic
903366124 1:22806492-22806514 CGGACGGACGGACGGATGGATGG + Intronic
903366125 1:22806496-22806518 CGGACGGACGGATGGATGGATGG + Intronic
903817199 1:26072877-26072899 GGACTGAACGGGAGGATGGATGG - Intergenic
905599788 1:39239898-39239920 CGGACGGACGGAAGGAAGGAAGG - Intronic
907912101 1:58835720-58835742 GGGTAGAAAGGGTGGATGGAAGG + Intergenic
912665770 1:111578199-111578221 CGGTGGAAGGGGAGGATTGGTGG + Intronic
915289745 1:154875430-154875452 CGGATGAATGGGAGGATAGATGG + Intergenic
916472940 1:165141614-165141636 GGGTGGAACAGGAGGAAGGAAGG - Intergenic
919794963 1:201316125-201316147 CGGACGGACGGACGGATGGACGG + Intronic
921565363 1:216711100-216711122 CGGTCGATAGGTAGGAGGGAGGG - Intronic
1064430167 10:15263907-15263929 CGGACGGACGGAAGGATGGACGG - Intronic
1065324748 10:24540800-24540822 CTGTCGCCCGGGAGGCTGGAGGG + Intronic
1065508975 10:26458381-26458403 CTGTCGAAAGGAAGGAAGGAAGG + Intronic
1072167291 10:92826449-92826471 CGGACGGACGGATGGATGGATGG - Intergenic
1074558407 10:114513054-114513076 CTGGGGAAAGGGAGGATGGATGG - Intronic
1076988400 11:256243-256265 CGGACGGACGGACGGATGGATGG + Intergenic
1078954506 11:16176062-16176084 CGGACGGACGGATGGATGGATGG + Intronic
1083626899 11:64076467-64076489 CGGACGAATGGATGGATGGACGG + Intronic
1083718968 11:64594734-64594756 CGGACGGACGGTTGGATGGATGG + Intronic
1083719202 11:64595826-64595848 CGGTTGAATGGATGGATGGATGG + Intronic
1084454902 11:69262860-69262882 CGGATGAATGGGTGGATGGATGG - Intergenic
1084658827 11:70535482-70535504 CGGACGGACGGATGGATGGATGG - Intronic
1084722424 11:70915714-70915736 GGGACGGACGGGATGATGGAGGG + Intronic
1088775780 11:113081296-113081318 CTGGCTAACTGGAGGATGGAAGG - Intronic
1090475080 11:127013021-127013043 CGGAAGAAAGGGAGGAAGGAGGG + Intergenic
1101814452 12:108135116-108135138 CGGACGGATGGAAGGATGGATGG - Intronic
1102998926 12:117370301-117370323 CGGACGGACGGACGGATGGACGG - Intronic
1103444927 12:120988396-120988418 TGGGCGAATGGGTGGATGGATGG - Intronic
1103941477 12:124503605-124503627 CGGACGGACGGATGGATGGATGG + Intronic
1107100209 13:36582249-36582271 TGGTCTAACGGCAGGATGTATGG - Intergenic
1107417952 13:40218934-40218956 CGGATGAATGGGTGGATGGATGG - Intergenic
1107507997 13:41054805-41054827 AGGTTGAACTGGTGGATGGAAGG - Intronic
1110607243 13:77447315-77447337 CGGACGGACGGATGGATGGATGG - Intergenic
1117448438 14:55827448-55827470 CAGTGTAACGGGTGGATGGAAGG - Intergenic
1118040053 14:61906741-61906763 CGGACGGACGGAAGGATGGATGG - Intergenic
1118293894 14:64550660-64550682 CAGTAGAACGGCAGGAAGGAGGG - Intronic
1121169536 14:91841955-91841977 AGGTGGAAGGGAAGGATGGATGG - Intronic
1121790499 14:96696050-96696072 CGGACGGACGGATGGATGGATGG - Intergenic
1126436902 15:48645864-48645886 GAGTGGAAAGGGAGGATGGATGG - Intergenic
1129848187 15:78777593-78777615 AGATGGGACGGGAGGATGGAGGG + Intronic
1130253737 15:82316343-82316365 AGATGGGACGGGAGGATGGAGGG - Intergenic
1131682318 15:94737080-94737102 CGGACGGACGGATGGATGGATGG - Intergenic
1131682319 15:94737084-94737106 CGGACGGACGGACGGATGGATGG - Intergenic
1132547485 16:540111-540133 CGGGCGAAGCGGAGCATGGAGGG - Intronic
1132653695 16:1032738-1032760 TGGATGGACGGGAGGATGGAAGG - Intergenic
1133111683 16:3551639-3551661 CGGTTGAATGGATGGATGGATGG - Intronic
1134859406 16:17547750-17547772 CGGACGGACGGATGGATGGATGG - Intergenic
1134859407 16:17547754-17547776 CGGACGGACGGACGGATGGATGG - Intergenic
1134859408 16:17547758-17547780 CGGTCGGACGGACGGACGGATGG - Intergenic
1135190292 16:20348863-20348885 CGGGCTACCGGGGGGATGGATGG - Exonic
1136071837 16:27792037-27792059 TGGTGGAAGGGAAGGATGGAGGG - Intronic
1138543931 16:57705389-57705411 TTGGCGAATGGGAGGATGGATGG - Intronic
1138544236 16:57706462-57706484 CGGATGGATGGGAGGATGGATGG - Intronic
1139908212 16:70380942-70380964 CGGGTGAACGGGAGGGTCGAGGG + Exonic
1140913064 16:79470769-79470791 CTGTTGAATGGGTGGATGGATGG + Intergenic
1143761384 17:9106516-9106538 CTGTCGAAAGGAAGGAAGGAAGG - Intronic
1144523014 17:15966941-15966963 CTGGCGAACGGAAGGACGGAAGG + Intronic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1151036397 17:70805175-70805197 CGGACGGACGGAAGGAAGGAAGG + Intergenic
1157745703 18:50133572-50133594 CGGACGGACGGAGGGATGGAGGG - Intronic
1161090296 19:2356829-2356851 CGGACGGACGGATGGATGGATGG - Intergenic
1162062887 19:8107462-8107484 TGGTCGAGTGGAAGGATGGATGG + Intronic
1162388784 19:10377313-10377335 CGAATGAACGGGTGGATGGATGG + Intronic
1164642373 19:29835738-29835760 TGGACGAACGGACGGATGGATGG + Intergenic
1165469859 19:35996934-35996956 CAGACCAAAGGGAGGATGGACGG + Intergenic
1167567561 19:50266552-50266574 CTGTCGAAAGGAAGGAAGGAAGG + Intronic
1167633214 19:50638696-50638718 CGGTCGAACGGGAGGATGGATGG + Intronic
1167767727 19:51495298-51495320 CGGACGGACGGGTGGGTGGATGG + Intronic
925290169 2:2742609-2742631 AGGAAGAAAGGGAGGATGGATGG + Intergenic
925323426 2:2995685-2995707 CGGACGGACGGACGGATGGATGG + Intergenic
926641863 2:15245596-15245618 CTGTTGAATGGAAGGATGGATGG + Intronic
926641876 2:15245648-15245670 CGGACGGACGGACGGATGGATGG + Intronic
926641877 2:15245652-15245674 CGGACGGACGGATGGATGGATGG + Intronic
927177666 2:20421950-20421972 TGGTGGAGGGGGAGGATGGATGG - Intergenic
928708807 2:33981483-33981505 TGGTGGAAAGGGAGTATGGAAGG + Intergenic
932711256 2:74065590-74065612 CGGACGGACGGAAGGAAGGACGG - Intronic
936615943 2:114047955-114047977 CGGACGGACGGACGGATGGATGG - Intergenic
936844641 2:116816142-116816164 AGGAAGAAAGGGAGGATGGAAGG + Intergenic
946281865 2:218671760-218671782 CTGGGGAACGGGAGGGTGGAGGG - Intronic
946525811 2:220518980-220519002 TGGACGAATGGGTGGATGGATGG - Intergenic
948156183 2:235783967-235783989 CGGACGGACGGACGGATGGACGG + Intronic
948224803 2:236300609-236300631 CGGACGGACGGAAGGAAGGAAGG - Intergenic
1169729518 20:8771884-8771906 CTGTCGAAAGGAAGGAAGGAAGG - Intronic
1171880330 20:30613883-30613905 CGGTAGAATGGGAGGAGGGAAGG + Intergenic
1172107084 20:32523206-32523228 GGGTGGAAGGGGAGGATAGAAGG + Intronic
1172184945 20:33025713-33025735 CGGACGGACGGATGGATGGATGG - Intergenic
1172184946 20:33025717-33025739 CGGACGGACGGACGGATGGATGG - Intergenic
1172975599 20:38903553-38903575 CGGACGGACGGATGGATGGATGG - Intronic
1172975600 20:38903557-38903579 CGGACGGACGGACGGATGGATGG - Intronic
1175606220 20:60314476-60314498 AGGATGAATGGGAGGATGGATGG - Intergenic
1175739501 20:61410837-61410859 CGGACGGACGGATGGATGGATGG - Intronic
1178304405 21:31479430-31479452 CGGATGAATGGAAGGATGGATGG + Intronic
1178684226 21:34698542-34698564 CAGACGGAAGGGAGGATGGAAGG + Intronic
1179256598 21:39721770-39721792 GGGTGGAATGGAAGGATGGATGG - Intergenic
1181536708 22:23550070-23550092 AGGATGAATGGGAGGATGGAAGG - Intergenic
1181536820 22:23550603-23550625 CGAGAGAATGGGAGGATGGAAGG - Intergenic
1181536871 22:23550892-23550914 AGGATGAATGGGAGGATGGAAGG - Intergenic
1181537164 22:23552424-23552446 TGGATGAATGGGAGGATGGATGG - Intergenic
1183731272 22:39619939-39619961 CGGACGGACGGATGGATGGATGG - Intronic
1183933861 22:41250687-41250709 AGGTCTATCGGGAGGAGGGATGG - Intronic
950200628 3:11040487-11040509 CGGACGGATGGCAGGATGGATGG + Intergenic
956097979 3:65737342-65737364 TGGACGGACGGGTGGATGGATGG + Intronic
961736426 3:129004558-129004580 TGGATGAACAGGAGGATGGATGG - Intronic
963913029 3:150831038-150831060 CGGACGGAAGGAAGGATGGAGGG - Intergenic
966256714 3:177925414-177925436 TGGTTGAATGGTAGGATGGATGG + Intergenic
966256718 3:177925434-177925456 TGGTTGAATGGTAGGATGGATGG + Intergenic
967898211 3:194417950-194417972 CGGACGGACGGAAGGAAGGAAGG + Intronic
968765744 4:2468362-2468384 CGGTCGGACTGGAGAATGGGCGG - Intronic
969462926 4:7338273-7338295 CGGTTGGATGGAAGGATGGATGG + Intronic
969462956 4:7338409-7338431 CGGTTGGATGGAAGGATGGATGG + Intronic
974792264 4:66707435-66707457 CAATCCAACGGGAGGATAGAAGG - Intergenic
981731175 4:147900776-147900798 GGGTGGAAAGGGAGGAAGGAGGG - Intronic
985560690 5:584498-584520 AGGTTGAATGGGTGGATGGATGG + Intergenic
985869169 5:2540294-2540316 CGGATGGACGGGTGGATGGATGG - Intergenic
985884891 5:2670153-2670175 CAGTGGAAGGGGAGGCTGGAGGG - Intergenic
986105774 5:4658116-4658138 AGGCAGAAGGGGAGGATGGAGGG - Intergenic
997346884 5:133198622-133198644 CGGTCCCACGCGAGGACGGATGG + Exonic
1000279818 5:159773052-159773074 TGATCGAACGGGTGGATGGGTGG + Intergenic
1001970023 5:175948016-175948038 AGGACGAATGGGGGGATGGATGG + Intronic
1002247414 5:177895748-177895770 AGGACGAATGGGGGGATGGATGG - Intergenic
1004816748 6:19319323-19319345 CGGAAGAATGGAAGGATGGAAGG - Intergenic
1016370840 6:143372351-143372373 CGGACGGATGGGTGGATGGATGG - Intergenic
1017404195 6:154099278-154099300 CTGTCGAAAGGAAGGAAGGAAGG + Intronic
1018563592 6:165128066-165128088 CGGACGGACGGACGGATGGATGG + Intergenic
1018563593 6:165128070-165128092 CGGACGGACGGATGGATGGATGG + Intergenic
1019549305 7:1594248-1594270 TGGATGAATGGGAGGATGGAGGG - Intergenic
1019549508 7:1595003-1595025 TGGATGAACGGGAGGGTGGATGG - Intergenic
1019919960 7:4157247-4157269 CGGACGGACGGAAGGAAGGAAGG + Intronic
1022323145 7:29305786-29305808 GGAAGGAACGGGAGGATGGAGGG - Intronic
1029098373 7:98107112-98107134 CGGGCGAACGGACGGACGGACGG + Exonic
1031982255 7:128135675-128135697 CGGGCCAAAAGGAGGATGGAGGG + Intergenic
1031995280 7:128226541-128226563 TGGATGAATGGGAGGATGGAAGG - Intergenic
1032685672 7:134231563-134231585 AGGGAGAACGGGAGGAAGGAAGG - Intronic
1032685719 7:134231699-134231721 AGGGAGAACGGGAGGAAGGAAGG - Intronic
1032685728 7:134231731-134231753 AGGGAGAACGGGAGGAAGGAAGG - Intronic
1039846668 8:41330350-41330372 CGGATGAACAGAAGGATGGATGG + Intergenic
1048200005 8:132364682-132364704 CGGACGGACGGACGGATGGATGG + Intronic
1048200006 8:132364686-132364708 CGGACGGACGGATGGATGGATGG + Intronic
1049287359 8:141783084-141783106 TGGTTGAACAGGTGGATGGATGG - Intergenic
1051726801 9:20096075-20096097 CGGACGGACGGATGGATGGATGG - Intergenic
1051726802 9:20096079-20096101 CGGACGGACGGACGGATGGATGG - Intergenic
1057828341 9:98388326-98388348 GGGTCATACGGGATGATGGAAGG + Intronic
1057947008 9:99338563-99338585 TGGATGAACGGGGGGATGGATGG + Intergenic
1061245087 9:129397472-129397494 GGGACGAATAGGAGGATGGATGG + Intergenic
1061993428 9:134172445-134172467 CGGACGTACGGGAGGGAGGAGGG + Intergenic
1062480324 9:136748036-136748058 CTGTAGAACTGGAGGCTGGAGGG - Intronic
1185616204 X:1423744-1423766 CGGATGGATGGGAGGATGGATGG - Intronic
1199342534 X:146698302-146698324 CGGACGGACGGAAGGAAGGAAGG + Intergenic