ID: 1167634966

View in Genome Browser
Species Human (GRCh38)
Location 19:50649100-50649122
Sequence ACGTGGGGACAGAGGGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 872
Summary {0: 1, 1: 0, 2: 10, 3: 80, 4: 781}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167634966 Original CRISPR ACGTGGGGACAGAGGGGAGG AGG Intronic
900582432 1:3415721-3415743 CCGTGGGGGCAGCGGGCAGGAGG - Intronic
900591864 1:3463685-3463707 TCGTGTGGACCGTGGGGAGGGGG + Intronic
900608742 1:3535590-3535612 ATGTGAGGGCAGAGGGGAGGTGG - Intronic
901126745 1:6934681-6934703 AAGAGGGGAGAGAGGGGAGGGGG - Intronic
901229538 1:7634156-7634178 ACGTGAGGACACCCGGGAGGAGG + Intronic
901264912 1:7903025-7903047 AGGAGGGGAAGGAGGGGAGGAGG - Intergenic
901458018 1:9374837-9374859 ACAGAGGCACAGAGGGGAGGAGG - Intergenic
901849516 1:12006718-12006740 AGGTGGGGGCGGAGGGCAGGTGG + Intronic
902191208 1:14764486-14764508 ATGGGGGGGCAGAGGGGCGGCGG - Intronic
903018898 1:20379891-20379913 GGGTGGGGAAAGAGGGCAGGTGG - Intergenic
903034250 1:20484594-20484616 ACGCAGGGATGGAGGGGAGGGGG - Intronic
903071584 1:20729463-20729485 AGATGGGGACAGAATGGAGGAGG + Intronic
903463404 1:23534922-23534944 ACATGGGGATGGAGGGGAGGAGG - Intergenic
903539773 1:24090344-24090366 AAGTGGAGACAGAGAGGAGGAGG + Intronic
903541429 1:24098556-24098578 CCCTGGTGACAGAGAGGAGGTGG + Intronic
903629157 1:24753454-24753476 ACATGGGGAAAGATGGAAGGAGG + Intronic
903956868 1:27031864-27031886 AAGTGGGGAGAGACGGAAGGAGG - Intergenic
904010767 1:27388885-27388907 AGGTAGGGACAGAGGGCATGAGG + Intergenic
904037588 1:27567138-27567160 TGGAGGGGACAGAGAGGAGGAGG - Intronic
904267102 1:29324435-29324457 ACGTGGAGTCACAGGGAAGGAGG + Intronic
904383334 1:30125784-30125806 AGGTGGGGAGAGAGGGGAGGGGG + Intergenic
904477149 1:30772752-30772774 ATGTGGGGACTAAGGGCAGGGGG - Intergenic
904496690 1:30891228-30891250 CCATGGGGACAGAGGGCAGATGG - Intronic
904528481 1:31152641-31152663 AGGTGTGGACTGAGTGGAGGAGG + Intergenic
904644878 1:31958185-31958207 CAGTGGAGACAGAGGGGAGAGGG - Intergenic
904672992 1:32179965-32179987 ACGTGGGGCCTGAGGGGCGGGGG + Intronic
904706497 1:32394751-32394773 AGCTGGGAGCAGAGGGGAGGAGG + Intergenic
904842097 1:33379358-33379380 AGGGGGGGACAGGGGGGATGGGG - Intronic
905580640 1:39081191-39081213 ACGCGGGGTCAGTGAGGAGGGGG + Intergenic
905659391 1:39709794-39709816 AAATGGGGCCAGAGGTGAGGTGG - Intronic
905923321 1:41733210-41733232 ACATAGTGACAGAGTGGAGGGGG + Intronic
906104294 1:43282803-43282825 AGCTGGGGACAGAGGGTAGCAGG - Exonic
906238745 1:44228672-44228694 ACTTGGGGGCAGTGGGGTGGAGG + Intronic
906607550 1:47182509-47182531 AAGTGGGGCCAGAAGGTAGGAGG - Intergenic
906997689 1:50815226-50815248 TAGAGGGGAGAGAGGGGAGGTGG - Intronic
907114086 1:51953333-51953355 ATGTGGGGAGAGAAGTGAGGTGG + Intronic
907283847 1:53367948-53367970 ACTTGGGGACAGAGGGCATGGGG - Intergenic
907823982 1:57997687-57997709 AAGTGGGGTCTGAGGGGAGAAGG + Intronic
907923131 1:58931557-58931579 ACTTGGGGACACAGGGGATGTGG - Intergenic
907954145 1:59212518-59212540 ACATGGGGAGTGAGGGGAAGAGG + Intergenic
908587594 1:65588595-65588617 CCCTGGGGACAGAGGTGGGGTGG - Intronic
908715317 1:67063638-67063660 ACGTGGGGTGGGAGGGGAGTAGG + Intergenic
908730065 1:67216940-67216962 ACTTGGGCAGAAAGGGGAGGAGG + Intronic
909474312 1:76064858-76064880 AAGTGGGGAGTGAGGGGTGGGGG + Intergenic
909784848 1:79598229-79598251 GAGTGGGGGCTGAGGGGAGGGGG + Intergenic
910982745 1:92975064-92975086 AGGAGGGGACAGAGGACAGGAGG - Intergenic
911351963 1:96763588-96763610 CCGTGGGGAGAGGAGGGAGGGGG + Intronic
911529329 1:99025614-99025636 GCGTGGGGGGAGGGGGGAGGGGG - Intergenic
912334258 1:108847556-108847578 ACGTGGTGACATGGGGGTGGGGG - Intronic
912379937 1:109241907-109241929 AGGTCGGGACTGAGGGGAAGTGG - Intergenic
912412533 1:109488629-109488651 AGGTGGGAACAGTGGGAAGGAGG + Intronic
914428541 1:147600003-147600025 ACGTCGGGCCGGTGGGGAGGGGG + Intronic
915103149 1:153515128-153515150 AGGTGGGTGCAGAGGGAAGGAGG - Intergenic
915325177 1:155078391-155078413 AGGTGGGCACAGAAGGGTGGTGG - Intergenic
915467634 1:156106638-156106660 GGGTGGGGACAGAGGCGTGGGGG - Intronic
915525981 1:156476566-156476588 CTGTGGGGACAGAGGTGTGGGGG - Intronic
917598375 1:176552353-176552375 GCGTGGGGAAAGAGGGAAAGGGG - Intronic
917959906 1:180133822-180133844 ATTTGGGGACTGAGAGGAGGAGG - Intergenic
918307764 1:183262838-183262860 AGATGGGGGAAGAGGGGAGGAGG + Intronic
919170670 1:193949610-193949632 AAGAGAGGACAGTGGGGAGGAGG + Intergenic
919935106 1:202246006-202246028 AGGGAGGGACAGAGGGAAGGAGG - Intronic
919937625 1:202265112-202265134 AATTGAGGAGAGAGGGGAGGTGG - Intronic
920000775 1:202797137-202797159 AGATGGGGAAAGAGGGGAGGAGG + Intronic
920174672 1:204093113-204093135 ACGTGGGGACGTGGGGGAGGTGG + Intronic
920269925 1:204755100-204755122 AAGTGGGGGCTGAGGGGTGGTGG + Intergenic
920387809 1:205580640-205580662 ACCTGGGGACAGAGGAGAGGTGG - Exonic
920912653 1:210232990-210233012 CCGCGGGGTCAGCGGGGAGGCGG - Exonic
921090441 1:211836854-211836876 ACGTGGGGAGGGAGGGGAGCAGG - Intergenic
921432900 1:215083452-215083474 GCGTGCGGCCAGAGGGGTGGGGG - Intronic
921683278 1:218059876-218059898 AGCTGGGGGCAGAGGGAAGGAGG - Intergenic
922239748 1:223748017-223748039 ACCTGTGGTCAGAGGGGTGGGGG - Intronic
922346301 1:224699538-224699560 ACGTGGAGACAGTGAGAAGGTGG - Intronic
922435369 1:225599987-225600009 ACATGGGGAGAGAGAAGAGGAGG - Intronic
922551665 1:226498698-226498720 TCTTGGGGACAGAGGGATGGAGG - Intergenic
922555650 1:226530169-226530191 AAGCGGGGACAGAGGGGCTGGGG + Intergenic
922594178 1:226801027-226801049 AGGTGGGGACACAGAGGAGAGGG - Intergenic
922887209 1:229029275-229029297 AAGTGAGGACGGTGGGGAGGGGG - Intergenic
923338784 1:232990952-232990974 ATGTGGGGAGAGTGGGGAAGAGG + Intronic
923482518 1:234397603-234397625 AGGTGGGGGAAGAGGGGAGGAGG + Intronic
923482529 1:234397623-234397645 AGGTGGGGGAAGAGGGGAGGGGG + Intronic
923882630 1:238120146-238120168 ACTTGGTGACAGAGAGGAGTAGG - Intergenic
924048983 1:240061283-240061305 ACCTGGGGCCAGAGGGGAACAGG + Intronic
1063099360 10:2935978-2936000 ACGGGGAGACAGAGGGGAGTGGG - Intergenic
1063460602 10:6212923-6212945 ACATGGGGACAGAGGGGCAGGGG - Intronic
1063606786 10:7529625-7529647 ACCTGGGGGCATGGGGGAGGGGG + Intergenic
1063981019 10:11451886-11451908 AGGTGGGAACAGACGGGAGTGGG - Intergenic
1064586029 10:16840068-16840090 GGGTGGGGGAAGAGGGGAGGGGG + Intronic
1065134984 10:22659077-22659099 ACCTGAGGCCAGAGGGGTGGTGG - Intronic
1065488599 10:26258542-26258564 TCCTGGGGATAGTGGGGAGGGGG - Intronic
1066302498 10:34109197-34109219 ACCTGAGGAGAGAGGGGAAGGGG - Intergenic
1067250751 10:44584683-44584705 ATGTGGGAAAAGAGGAGAGGGGG - Intergenic
1067760180 10:49039128-49039150 AGTGGGGGGCAGAGGGGAGGAGG + Intronic
1069197484 10:65570935-65570957 TCCCGGGCACAGAGGGGAGGGGG - Intergenic
1069293271 10:66810434-66810456 ATGTGGGGACAGATTGGATGTGG - Intronic
1069783613 10:70974048-70974070 ACTTGGGGAGAAAGGGTAGGGGG + Intergenic
1069893210 10:71664819-71664841 AAGAGGGGAGAGAAGGGAGGAGG - Intronic
1070079092 10:73168162-73168184 AGGTGGGGACCCTGGGGAGGTGG + Exonic
1070440879 10:76441934-76441956 ACGAGGTGGCAGATGGGAGGTGG - Intronic
1070531821 10:77343484-77343506 AGGGGGTGGCAGAGGGGAGGGGG + Intronic
1070819116 10:79344630-79344652 ATGTAGGGAGTGAGGGGAGGTGG - Intergenic
1070842269 10:79495403-79495425 CAGTGGGGGCAGAGGGGAAGCGG + Intergenic
1073508768 10:104028281-104028303 ACTCAGGGAAAGAGGGGAGGAGG - Exonic
1074170636 10:110931985-110932007 AAGTGGGAACACAGAGGAGGTGG + Intronic
1074507364 10:114083333-114083355 TGGTGAGGACAGAGAGGAGGTGG - Intergenic
1074867013 10:117550652-117550674 ATGGGGGGAAAGAGGGGAGGTGG - Intergenic
1075108738 10:119560519-119560541 AGGTGGAGGGAGAGGGGAGGGGG + Intergenic
1075360354 10:121826760-121826782 GAGTGGGGAGAGAGGGAAGGTGG - Intronic
1075658946 10:124180157-124180179 AGGTGGGGACAGAGTGGGAGGGG - Intergenic
1075737761 10:124674551-124674573 ACGAGGAGACAGAGGGCTGGTGG - Intronic
1075988003 10:126804808-126804830 ACGTGTGGGCTGAGGGAAGGAGG - Intergenic
1076547426 10:131254627-131254649 AGGTGGGCAAAGAGAGGAGGAGG + Intronic
1076704414 10:132293467-132293489 TCATGGGGACACAGGGCAGGCGG + Intronic
1076733643 10:132449626-132449648 ACGTGGGGTCAGCGGGGGTGGGG + Intergenic
1077198490 11:1293401-1293423 GTGTGGGCAGAGAGGGGAGGAGG + Intronic
1077223383 11:1427118-1427140 CTGTGGGGAGAGAGGGGATGGGG - Intronic
1077460189 11:2705240-2705262 ACGTGAGGCCAGACGGGTGGGGG + Intronic
1077503182 11:2918360-2918382 ACGTGGGGCCACAGGGTATGAGG - Intronic
1077539676 11:3140640-3140662 GCTGGGGGACAGAGGGGAGCCGG - Intronic
1078088830 11:8251354-8251376 ACGTGGGAGCAGGGTGGAGGAGG - Intronic
1078103214 11:8342140-8342162 AGGTGGGGAGGAAGGGGAGGTGG + Intergenic
1078488561 11:11747686-11747708 AGGGAGGGACAGAGGGAAGGAGG + Intergenic
1079312131 11:19376445-19376467 ACGAGGGCACAGAGGGGACGAGG + Intronic
1080037224 11:27722247-27722269 AAATGGGGACTGGGGGGAGGGGG + Intergenic
1080099904 11:28447998-28448020 GCATGGGGACAGAGTGGAGGGGG - Intergenic
1081693583 11:45094549-45094571 ACGGGAGGAAAGAGGAGAGGAGG + Intergenic
1081774483 11:45667950-45667972 CCGTGGGGAAAAGGGGGAGGGGG + Intergenic
1081779004 11:45696919-45696941 AAGTGGTGTCAGAGGGGAGGAGG - Intergenic
1081804176 11:45881288-45881310 ACGTGAGGAGGGAGGGAAGGAGG - Exonic
1082711879 11:56562145-56562167 ACATGGCGACAGAGGAGAGAGGG - Intergenic
1082880592 11:58033603-58033625 AAGGAGGGAGAGAGGGGAGGGGG + Intronic
1083041053 11:59687901-59687923 ACGTGGGGTTGGAGGGAAGGTGG + Intergenic
1083439412 11:62665953-62665975 AGGTGGGGGCAGAGTGGAGAGGG + Intronic
1083691105 11:64409517-64409539 GCGGGGGGACGGAGGGGCGGAGG - Intergenic
1083775310 11:64891710-64891732 ACTTGGGGACAGAGGGCGTGGGG - Intergenic
1083826742 11:65208184-65208206 TCCTGGGGAGAGAGAGGAGGTGG - Exonic
1084266797 11:68009167-68009189 AAGTGGGGGCAGAGAGGGGGTGG - Intronic
1084338578 11:68476448-68476470 CCGTGGGGAGAGGGGGGAGGGGG + Intronic
1084563354 11:69916199-69916221 GCTGGGGGAAAGAGGGGAGGGGG - Intergenic
1084739476 11:71129985-71130007 ACCTGGGGACACAGAGAAGGTGG - Intronic
1085053769 11:73392645-73392667 CCGTGGGGGCAGAGCAGAGGTGG + Intronic
1085103908 11:73825517-73825539 ACTTGGGGTCGGCGGGGAGGGGG + Intronic
1085265937 11:75238105-75238127 AAGTGGGAAGAGAGGAGAGGAGG + Intergenic
1085305253 11:75482112-75482134 TCGTGGGGACAGGGGAGGGGCGG - Intronic
1085534032 11:77207485-77207507 ACTGGGGGAGAGAGGGGAAGAGG + Intronic
1085625053 11:78065384-78065406 AGGTGGTGGCAGAGGGTAGGAGG + Intronic
1087952395 11:104239198-104239220 AAGGAGGGAGAGAGGGGAGGAGG - Intergenic
1087985054 11:104668458-104668480 ACGTTGGTACAGAGGAAAGGAGG + Intergenic
1088491535 11:110393132-110393154 ACTGGGGAGCAGAGGGGAGGTGG - Intergenic
1088797427 11:113275176-113275198 CCTTGGGGACAGCAGGGAGGAGG - Intronic
1088990085 11:114946104-114946126 AGGTGGGGAAAGGGAGGAGGAGG - Intergenic
1089347351 11:117798979-117799001 ACGGGGGGACAGACTGCAGGGGG + Intronic
1089551282 11:119280667-119280689 ACGAGGGGACAGAGAGGTGCTGG - Intronic
1090748659 11:129727298-129727320 ACATGGGGATGGAGGGCAGGGGG + Intergenic
1091399031 12:171682-171704 ACTTGGGGGCAGGTGGGAGGGGG + Intronic
1091789092 12:3261029-3261051 TTGTGGTGACAGAGAGGAGGTGG + Intronic
1092031702 12:5291718-5291740 ACGTGAGGACATAGAGAAGGTGG + Intergenic
1092092713 12:5816766-5816788 CAGTTGGGACACAGGGGAGGAGG - Intronic
1092203725 12:6603199-6603221 AGGTGGAGCCAGATGGGAGGAGG - Intronic
1092659283 12:10722173-10722195 CCGTGGGCACAGAGAGGGGGAGG + Intronic
1094083820 12:26566437-26566459 AGGAGAGGAAAGAGGGGAGGAGG + Intronic
1094240163 12:28213142-28213164 AAGGAGGGGCAGAGGGGAGGTGG - Intronic
1095130964 12:38541763-38541785 CAGAGGGGCCAGAGGGGAGGTGG + Intergenic
1096239887 12:49954134-49954156 AGCTGGGGACAGAGAAGAGGCGG - Exonic
1096611307 12:52803811-52803833 ACGTGGGGAAATAGTTGAGGGGG - Intergenic
1096873244 12:54607975-54607997 AGGTGGGGGCAGTGGCGAGGAGG + Intergenic
1097044574 12:56177973-56177995 ATGTGGGGACAGGAGGGAGAAGG + Intronic
1097054264 12:56240466-56240488 CGGTGGGGAGAGGGGGGAGGGGG + Exonic
1098094863 12:66944521-66944543 ACGTGGGGGTGGAGGGGTGGGGG + Intergenic
1098480050 12:70947405-70947427 GGGTGGGGAGAGGGGGGAGGGGG - Intergenic
1098772866 12:74576706-74576728 AGGTGAGGACAGAGAGAAGGTGG + Intergenic
1098773110 12:74579977-74579999 AACTGGGGGCAGAGTGGAGGAGG - Intergenic
1098853227 12:75622958-75622980 ATGTTGGGACAAAGGGCAGGAGG - Intergenic
1100329312 12:93570261-93570283 ACGTTGGAGCAGAGGGGAGGAGG + Intronic
1100553758 12:95672215-95672237 GCGGGGGGAGGGAGGGGAGGCGG + Intronic
1100911407 12:99367127-99367149 ACGTGGGGAGAGGAGTGAGGAGG + Intronic
1101073885 12:101107875-101107897 AAGTGGGGACAGTGGAGAGGAGG + Intronic
1101324258 12:103700992-103701014 GGGTGGGGGCAGGGGGGAGGGGG - Intronic
1101525307 12:105523211-105523233 AAGTGGGAACAGAGGGAGGGAGG + Intergenic
1101837333 12:108304673-108304695 ACATGGGAAGAGAGAGGAGGAGG - Intronic
1101952434 12:109187127-109187149 ACGAAGGGAGAGAGGGAAGGAGG + Intronic
1102149224 12:110677295-110677317 GAGTGGGGACAGAGGTGAGAGGG - Intronic
1102670935 12:114618212-114618234 AAGTGGGGAGGGAGGGGAGGAGG + Intergenic
1102677507 12:114668572-114668594 GCGGGGGGAGAGAAGGGAGGAGG + Intergenic
1103102295 12:118188966-118188988 GCGTGGGGGCCGAGGGGAGGAGG + Intronic
1103175170 12:118857152-118857174 AGGTGGGGAAGGATGGGAGGAGG - Intergenic
1103239068 12:119398115-119398137 AAGGGGTGGCAGAGGGGAGGAGG + Intronic
1103415246 12:120738755-120738777 TCCAGGGGACAGAAGGGAGGGGG - Intronic
1103415951 12:120741559-120741581 GCCCGGGGACAGTGGGGAGGGGG + Intergenic
1103999146 12:124849326-124849348 CCGTGGGCAGAGAGGGGATGAGG - Intronic
1104012384 12:124940835-124940857 ACGTGGGGAGATCGGGAAGGAGG + Intergenic
1104254442 12:127124886-127124908 AGGGGGGGACAGAGGGAGGGGGG + Intergenic
1104553139 12:129775742-129775764 CTGTGGGGACAGAGTGTAGGAGG - Intronic
1104691643 12:130830439-130830461 CCGTGGGTTCAGAGTGGAGGAGG - Intronic
1104715122 12:131011194-131011216 AGGTGGGGACAGAGGTGAGGTGG - Intronic
1104962909 12:132496708-132496730 ATGTGGGGAAACAGGGAAGGAGG - Intronic
1105294250 13:19074260-19074282 ACCTGTGGAGAGAGGGGAAGAGG + Intergenic
1105326029 13:19371178-19371200 ACATGGGGATGTAGGGGAGGAGG + Intergenic
1105766096 13:23560767-23560789 ACCTGGGAACACAGGAGAGGTGG - Intergenic
1105867479 13:24473895-24473917 ACGTGGAGACGTAGGGGAGGAGG - Intronic
1105900230 13:24746666-24746688 GCGTGGGGAGAGCGGGGAGGCGG + Intergenic
1106254209 13:28007985-28008007 AGGTGGAGAGAGAGAGGAGGAGG - Intronic
1108332681 13:49405760-49405782 ACGGAGGGACAGAGGGAGGGAGG + Intronic
1110491799 13:76118306-76118328 GCTTGGGGACAGAGCGGAGAGGG - Intergenic
1111968584 13:94886351-94886373 ACATGGGGGTAGGGGGGAGGGGG - Intergenic
1112423796 13:99277797-99277819 GGGTGGTGACAGAGGGGATGGGG - Intronic
1112495202 13:99898588-99898610 ATGTGGGTACACAGGGGCGGGGG - Intergenic
1113179784 13:107612080-107612102 TGGGGGGGAGAGAGGGGAGGGGG + Intronic
1113492139 13:110700439-110700461 GCGTGTGCAGAGAGGGGAGGCGG + Intronic
1113528418 13:111000800-111000822 ATGTGAGGACAGTGGGAAGGTGG + Intergenic
1113571667 13:111362363-111362385 ACCTGGGTGCAGAGGAGAGGAGG + Intergenic
1113576833 13:111400971-111400993 GCGTGGTGAGAGAGGTGAGGCGG - Intergenic
1113595403 13:111528281-111528303 ATGTGGGGGCAGAGTGGTGGTGG + Intergenic
1113694302 13:112333057-112333079 GCGTGGGGACAGACGCCAGGTGG - Intergenic
1113754965 13:112804332-112804354 ACGAGGGCAGAGAGGGGATGGGG - Intronic
1114270329 14:21097226-21097248 GAGTGAGGACAGAGGGAAGGAGG - Intronic
1114522168 14:23346682-23346704 ACGTGGTCACAGCGGGTAGGGGG + Exonic
1114532291 14:23403512-23403534 CCATGGGGGCAGAGGGCAGGGGG + Intronic
1114587483 14:23827372-23827394 ACCTGGGGGCAGAGATGAGGAGG + Intergenic
1114852246 14:26395141-26395163 AGCTGGGGACTGAGGGGAAGTGG - Intergenic
1116426814 14:44800440-44800462 GAGTGGGGAGAGAGGGAAGGGGG + Intergenic
1117378473 14:55137105-55137127 TAGTGGGGACAGAGGGCAGATGG + Intronic
1118171883 14:63396012-63396034 AGGGGGGAAGAGAGGGGAGGGGG + Intronic
1118725884 14:68628688-68628710 GCGTGGAGGCAGAGGGTAGGGGG + Intronic
1118796940 14:69152665-69152687 GGGTGGGGACAGAGGGCAGGAGG + Intronic
1119109388 14:71957423-71957445 ACGTGAGGACAGAGGGCTGTAGG + Intronic
1119192418 14:72691985-72692007 ACGAGGGGAAAGTGGGGTGGAGG + Intronic
1119483865 14:74975889-74975911 AAGGGGGCACAGAGGGGAGATGG - Intergenic
1119544001 14:75458913-75458935 ACGTGGCTGGAGAGGGGAGGAGG + Intronic
1119562595 14:75603056-75603078 ATGTGGAGATGGAGGGGAGGTGG - Intronic
1119640424 14:76310455-76310477 ACTTGGGGTCACAGGGGAGCTGG - Intergenic
1119762065 14:77158693-77158715 CCGTGGAGACAAAGGAGAGGCGG + Intronic
1119834566 14:77736762-77736784 AGGTAGGGACAGAGAGGAGATGG - Intronic
1119931453 14:78551656-78551678 AGGTGAGGAGGGAGGGGAGGAGG - Intronic
1120234735 14:81876918-81876940 ATTTGGGAAAAGAGGGGAGGTGG + Intergenic
1120759765 14:88274949-88274971 AGGTTGGATCAGAGGGGAGGAGG - Intronic
1121238922 14:92413910-92413932 AGGTAGGGACAGAGGAGAAGGGG + Intronic
1121325666 14:93018273-93018295 ACCTGGAGCCATAGGGGAGGCGG - Intronic
1121714810 14:96066032-96066054 AGGTGGGGATAAGGGGGAGGAGG - Intronic
1121760638 14:96441898-96441920 CAGTGGGGACAGAGGGGTGATGG - Intronic
1122028728 14:98896975-98896997 GACTGGGGACAGAGGGGAGTGGG - Intergenic
1122074667 14:99228456-99228478 ACATGGTGGCAGAGGGCAGGAGG + Intronic
1122093100 14:99352907-99352929 GCGCGGGAACAGTGGGGAGGAGG + Intergenic
1122180261 14:99949470-99949492 AGGTGGGGCCTGACGGGAGGTGG - Intergenic
1122530136 14:102419488-102419510 TGGTGGGGACAGAGTGCAGGCGG + Intronic
1122540472 14:102495254-102495276 AGGTGGGGGCAGGAGGGAGGGGG + Intronic
1122631404 14:103109261-103109283 ACATGGGGACAGGGTGGAGAGGG - Intronic
1122631502 14:103109514-103109536 ACATGGGGACAGGGTGGAGAGGG - Intronic
1122917567 14:104865905-104865927 AAATGAGGAGAGAGGGGAGGAGG - Intronic
1123043662 14:105500835-105500857 CTATGGGGACAGAGGGGATGGGG - Intergenic
1123065300 14:105616083-105616105 ACGTGGGTGCTGAGGGGAGGAGG + Intergenic
1123088595 14:105731304-105731326 ACGTGGGTGCTGAGGGGAAGAGG + Intergenic
1123183275 14:106489681-106489703 ACGTGGGGAGACACGGGATGAGG - Intergenic
1123448491 15:20345872-20345894 ACATGGGGAGAGAGAGGATGGGG + Intergenic
1123893983 15:24809765-24809787 ATGTTGGCACAGAGGGGATGGGG - Intergenic
1124900272 15:33816152-33816174 ATGTGAGGACAGTGGTGAGGAGG - Intronic
1125218808 15:37309428-37309450 ATCGGGGGCCAGAGGGGAGGGGG - Intergenic
1125484295 15:40101760-40101782 AAGTAGGGTCAGTGGGGAGGAGG + Intronic
1125501392 15:40242027-40242049 AGTTGGGGTCAGAGGGGCGGAGG + Intronic
1125767402 15:42144754-42144776 AGGTGGGGTCAGGGAGGAGGAGG - Intronic
1127507557 15:59610892-59610914 AGGGGGAGGCAGAGGGGAGGGGG - Intronic
1127507565 15:59610909-59610931 AGGGGGAGGCAGAGGGGAGGGGG - Intronic
1127507573 15:59610926-59610948 AGGGGGAGGCAGAGGGGAGGGGG - Intronic
1127827287 15:62715861-62715883 AGGTGGGGACAGAGGGAAGAGGG - Intronic
1127993518 15:64137726-64137748 TCGTGGGGACAGGGAGGAAGGGG - Intronic
1128108803 15:65063360-65063382 AACTGAGGACAGAGGTGAGGTGG - Intronic
1128145689 15:65331299-65331321 CCGGGGGGACAGCGGGGAGAAGG + Intronic
1128355528 15:66923843-66923865 ACGGTGGGACACAGGGGATGTGG + Intergenic
1129161670 15:73751364-73751386 AGGTGAGGACACAGGAGAGGAGG + Exonic
1129255079 15:74329900-74329922 AGGTGTGGACACAGGGGAGGAGG - Intronic
1129296819 15:74604335-74604357 CCCTGTGGGCAGAGGGGAGGTGG + Intronic
1129359446 15:75015440-75015462 AGGTGGGGACAGAGGGGGGGGGG + Intronic
1129427395 15:75473637-75473659 GCCTAGGGACAGAGTGGAGGTGG + Intronic
1129523864 15:76201929-76201951 AACTGGGGACAGAGGGGAAGGGG + Intronic
1129719778 15:77871787-77871809 ACGTGGGCACTGAGAGGAAGAGG + Intergenic
1130042131 15:80413817-80413839 AGGTGGGGCCAAAGGAGAGGAGG + Intronic
1130118558 15:81026860-81026882 ACATGGGGAAAGAGAGGTGGAGG - Intronic
1130362018 15:83197947-83197969 ACCTGGGGGCGGCGGGGAGGGGG + Intronic
1130844883 15:87735147-87735169 AGGTGGGGAGGGAAGGGAGGAGG + Intergenic
1131870237 15:96756738-96756760 AGGTGGGGACCCTGGGGAGGTGG + Intergenic
1132090835 15:98946831-98946853 ACGTGGGGCAAGAGGAGAAGTGG + Intronic
1132114104 15:99123498-99123520 ACCAGGGAACAGAAGGGAGGGGG - Intronic
1132478202 16:153056-153078 GAGTGGGGACAGTGGGGAGGGGG + Intronic
1132480151 16:163268-163290 GAGTGGGGACAGTGGGGAGCGGG + Intronic
1132781670 16:1629969-1629991 TGGAGGGGCCAGAGGGGAGGTGG - Intronic
1132847374 16:2006721-2006743 ACGTGGGGGCAGGGGGGAGATGG + Intronic
1132854585 16:2039060-2039082 CCGTGGGGTGAGAGGGGTGGAGG + Intergenic
1133277143 16:4645848-4645870 ACCTGGGGACCCAGGGGATGTGG + Intronic
1134073176 16:11273151-11273173 ACGTGGGGCCAGAAGGGATAGGG + Intronic
1134219903 16:12345721-12345743 ATGTGGGCACAGTGGGAAGGTGG + Intronic
1134685832 16:16157557-16157579 AGGTGGGGACACTGTGGAGGTGG + Intronic
1135932241 16:26747907-26747929 ATGTGGGAGCAGAGAGGAGGGGG - Intergenic
1135955355 16:26952324-26952346 AAGTGGGGAAAGCAGGGAGGCGG - Intergenic
1136039211 16:27564700-27564722 ACGTGGGGAATGAAGGGAAGGGG + Intronic
1136271621 16:29152110-29152132 ACTTGGGCACAGAGAGGTGGAGG - Intergenic
1136413714 16:30091396-30091418 GGGTGGGGAGGGAGGGGAGGAGG - Intronic
1136568095 16:31081729-31081751 AGGTGGGCACACAGTGGAGGGGG + Intronic
1136911336 16:34146974-34146996 AAGCGGGGACAGGGGGGAGAGGG - Intergenic
1138529090 16:57625396-57625418 AGGTGGGGACCGAGGAGAGGGGG - Intronic
1138925475 16:61585142-61585164 ACTTGGCAAGAGAGGGGAGGAGG + Intergenic
1139377433 16:66508982-66509004 ACGTGGGGGCAGAGGGGAGAGGG + Exonic
1139411223 16:66762266-66762288 ACGTGGGGACAGAGCTGAGTAGG - Intronic
1139485352 16:67253116-67253138 ATGTGGTAACAGAGGGCAGGAGG - Intronic
1139750460 16:69106518-69106540 AGGAGGGGTCAGTGGGGAGGGGG - Intronic
1140477661 16:75247086-75247108 AGGTGGGGGCAGAGGGGAGAAGG - Intronic
1141056197 16:80816937-80816959 CCTTGGGGACAGTGGGTAGGAGG - Intergenic
1141094485 16:81153404-81153426 ACCTGGGAACAGAGGGAAGGAGG - Intergenic
1141309793 16:82902586-82902608 ACGTGAGAAAAGAGGGGTGGGGG - Intronic
1141599308 16:85115576-85115598 ACGGGGGCACACAGGAGAGGGGG - Intergenic
1141768181 16:86072361-86072383 ACAGAGGGACAGAGGGGAAGCGG - Intergenic
1141838978 16:86562162-86562184 AGGTGGGGTCAGAGGGGAGAAGG - Intergenic
1141896719 16:86963155-86963177 ATGAGGGAACAGAGGGGATGGGG - Intergenic
1142075236 16:88114094-88114116 ACTTGGGCACAGAGAGGTGGAGG - Intronic
1142142672 16:88479542-88479564 CGGTGGGGACAGAGAGGAGACGG - Intronic
1142750625 17:1985361-1985383 CCCTGGGGACAGAGAGTAGGAGG - Intronic
1142804666 17:2365109-2365131 ACGTGGGGAAGGAAGGGAGGCGG - Intronic
1142978111 17:3657088-3657110 AGGAGGGCACAGAAGGGAGGAGG + Intronic
1142978119 17:3657112-3657134 AGGAGGGCACAGAAGGGAGGAGG + Intronic
1142992164 17:3738773-3738795 ACGTGCTGACAGAATGGAGGCGG - Intronic
1143263961 17:5621685-5621707 ATGTGGGGACTGATGGGATGGGG + Intergenic
1143477677 17:7211869-7211891 ACGTTGGGAGAGAGGGGTGAGGG + Intronic
1143580306 17:7821765-7821787 GCGCAGGGACAGAGGGGAAGAGG - Intronic
1143585272 17:7847693-7847715 AGGCGGGGACAGGGGGGTGGAGG - Exonic
1144247757 17:13384356-13384378 AAGGGGGGAGAGAGGGAAGGAGG + Intergenic
1144313521 17:14036825-14036847 AGGTGGGGCCTGATGGGAGGTGG - Intergenic
1144621498 17:16821375-16821397 ATGTGGGAGCAGGGGGGAGGGGG + Intergenic
1144652612 17:17017009-17017031 ACATGAGGACAGGGCGGAGGAGG - Intergenic
1144653296 17:17020155-17020177 AGGTGAGGTCAGAGCGGAGGTGG - Intergenic
1144711314 17:17403462-17403484 AGGTCTGGACAGAGGGGAGGAGG + Intergenic
1145214564 17:21042364-21042386 GGGAGGGGACAGAGAGGAGGGGG + Intronic
1145214572 17:21042384-21042406 GGGAGGGGACAGAGAGGAGGGGG + Intronic
1146625889 17:34435114-34435136 ATGTGGGGACAGGGTGGGGGAGG + Intergenic
1146638172 17:34521268-34521290 ATGTGGGGACAGAAAGGATGGGG - Intergenic
1146674291 17:34762366-34762388 ACATGAGGACAGCGGGTAGGTGG + Intergenic
1146946134 17:36874884-36874906 AGGTGGGGATAGGAGGGAGGAGG - Intergenic
1147168041 17:38603724-38603746 GGGTGGGGACAGCGGGGTGGAGG + Intronic
1147582719 17:41636221-41636243 ACGGGGAGGCAGAGGGGTGGTGG - Intergenic
1147661650 17:42120134-42120156 AAGGGGGCATAGAGGGGAGGGGG + Intronic
1148128546 17:45248855-45248877 ACCTGGGGAGAGAGGAGAGGGGG + Intergenic
1148146421 17:45367717-45367739 AGGCGGGGAGAGGGGGGAGGGGG + Intergenic
1148551413 17:48552582-48552604 AGGGGGGCAGAGAGGGGAGGTGG - Exonic
1148769318 17:50057687-50057709 AGGTGGGGGCAGAGGCTAGGTGG - Intronic
1149468435 17:56897611-56897633 AAATGGGGAAATAGGGGAGGGGG - Intronic
1149651462 17:58278925-58278947 ACCTGGGCACAGAAGGGAGATGG + Intronic
1150732901 17:67711307-67711329 GCATGGGCACAGAGGTGAGGGGG + Intergenic
1150952006 17:69813538-69813560 ATCTGGAGAGAGAGGGGAGGAGG + Intergenic
1151013849 17:70531284-70531306 AGGTGGGGGCGGAGGGGTGGAGG + Intergenic
1151567151 17:74905038-74905060 ACATGGGGACAGAAGGCAGCGGG + Intergenic
1151572223 17:74932562-74932584 AGGTGGGGCCAGAGGGCAGGGGG - Intronic
1151791238 17:76307346-76307368 TGGTGGGGACGGAGGGGATGGGG - Intronic
1151887115 17:76929644-76929666 AAGTGGGGACAAAAGGGAAGAGG + Intronic
1151951486 17:77356670-77356692 ATGTGGGGGGGGAGGGGAGGGGG - Intronic
1151979464 17:77499952-77499974 TCGTGGGGACAGAGGGTGAGGGG - Exonic
1151983683 17:77528743-77528765 ATGGAGGGAGAGAGGGGAGGAGG + Intergenic
1152070238 17:78130697-78130719 CCATGGGGTGAGAGGGGAGGAGG + Intronic
1152097596 17:78280961-78280983 GAGTGGGGACAGAGTGGGGGAGG + Intergenic
1152410514 17:80120450-80120472 AGGTGGGGTGGGAGGGGAGGTGG - Intergenic
1152598345 17:81249179-81249201 AAGAGGAGACAGAAGGGAGGAGG + Intronic
1152793287 17:82293362-82293384 ACGGGGGGAGGGAGGGGACGGGG + Intergenic
1152803901 17:82345648-82345670 ATGTGGGGACAGCGGCGAGCTGG - Intergenic
1152913025 17:83016419-83016441 GGCTGGGGACAGAGGGGAAGTGG + Intronic
1153666268 18:7369911-7369933 GTGTGGGGACAGAGGGCATGAGG + Intergenic
1154166051 18:12015291-12015313 AAGTGGGTCAAGAGGGGAGGCGG - Intronic
1154303971 18:13217718-13217740 GCGCGGGGAGAGAGGGGACGCGG - Intronic
1155374478 18:25140646-25140668 ATGGGGAGACAGAGGGGAGAAGG + Intronic
1155540418 18:26863499-26863521 AGGTGGGGAGAGATGGGAGTGGG + Intronic
1157492882 18:48136510-48136532 ACTTGGGGACGGGAGGGAGGGGG - Intronic
1157749755 18:50167845-50167867 CCGTGGGGCCAGAGGGCAGATGG - Intronic
1157766205 18:50298980-50299002 ACCTGGGGACAGGCGGGACGAGG + Intergenic
1158131059 18:54153147-54153169 TCGTGGGGATGGAGGAGAGGTGG + Exonic
1158514371 18:58119178-58119200 AGATGGGGACAAAGGGAAGGTGG - Intronic
1158675992 18:59518706-59518728 GTGTGAGGACAGAGGGGATGTGG - Intronic
1158796882 18:60856949-60856971 CGGTGGGGGGAGAGGGGAGGAGG - Intergenic
1159192900 18:65071336-65071358 ACTTGGGGAAAGGTGGGAGGTGG - Intergenic
1159330349 18:66986251-66986273 ACTTGAGGAAAGAGGGTAGGAGG + Intergenic
1159915417 18:74183236-74183258 AGGTGGGGAGAGAAGGGAAGAGG - Intergenic
1160072780 18:75643046-75643068 ACGTGGGTAGAGGGGAGAGGTGG + Intergenic
1160757939 19:767495-767517 ACTTGGGGACAGATGTGAGGTGG - Intergenic
1160922831 19:1528788-1528810 ATGTGGAGACAGAGCGGAGCAGG - Intronic
1161010787 19:1958585-1958607 ACGGGGGGACAGGGGGACGGGGG - Intronic
1161109480 19:2461442-2461464 AGGCGGGGCCAGAGGGGAGAAGG + Intergenic
1161231336 19:3176531-3176553 CTGGGGGGACAGAGGGCAGGTGG + Intronic
1161501647 19:4619515-4619537 ACGCAGAGACAGAGGAGAGGCGG - Intergenic
1161711574 19:5851462-5851484 AAGTGGGAACAGAGAAGAGGAGG + Exonic
1161853846 19:6752894-6752916 AGGCGGGGTCAGAGGGGAGGGGG + Intronic
1161913912 19:7214848-7214870 AGGTGGGGACGGAGGGAAGAAGG - Intronic
1161979488 19:7623288-7623310 ATCTGGGGACAGGAGGGAGGAGG + Exonic
1162495925 19:11023420-11023442 ATGTGGGGACAGGGTGGACGGGG - Intronic
1162736041 19:12747687-12747709 ATGTGGGGGCAAAGGGCAGGAGG - Intronic
1163021210 19:14481886-14481908 CTGTGGGGATAGATGGGAGGGGG - Intronic
1163169229 19:15519163-15519185 ATGTGGGCACAGAGGAAAGGGGG + Intronic
1163196241 19:15723171-15723193 ACGTGGGGAGAGGTGGCAGGCGG + Intergenic
1164292586 19:23881178-23881200 AGGAGGAGAAAGAGGGGAGGAGG + Intergenic
1164615050 19:29662813-29662835 GCGTGGGGACAGCTGGGTGGAGG - Intergenic
1164668184 19:30056237-30056259 AGGTGGGGACATAGAGAAGGGGG - Intergenic
1164850659 19:31480577-31480599 AAGAGGGGACGGAAGGGAGGAGG + Intergenic
1165471709 19:36008159-36008181 TCCAGGGGACAGAGAGGAGGTGG + Intronic
1165747110 19:38236089-38236111 AAGATGGGTCAGAGGGGAGGGGG + Intergenic
1165773349 19:38390514-38390536 ACCTGGGGAGGGAGGGGAGAGGG + Intronic
1165793894 19:38507475-38507497 AGGTGGGGCCAAAGGGGAGGAGG + Intronic
1165834303 19:38744908-38744930 AAGTAGAGACAGAGGGGTGGCGG + Intronic
1166144805 19:40826480-40826502 GGGTGGGGTCAGATGGGAGGGGG + Intronic
1166182937 19:41121727-41121749 GGGTGGGGTCAGATGGGAGGGGG - Intronic
1166369177 19:42291919-42291941 AGGTGGGGACACAGAGAAGGAGG - Intronic
1166420447 19:42632322-42632344 ACCTGAGGGCAGTGGGGAGGGGG - Intronic
1166719298 19:44988238-44988260 ATGTGGGGAGGGAGGGGAGGAGG - Intronic
1166825690 19:45607530-45607552 AGGTGGGGAGTGAGGGGAGGAGG + Intronic
1166995891 19:46719550-46719572 AGATGGGGACAGAGGGGTTGGGG + Exonic
1167348943 19:48963211-48963233 AGGGGGGGACAGAGGTGGGGGGG - Intergenic
1167423530 19:49417454-49417476 AGGTGGGGCCAGGTGGGAGGTGG - Exonic
1167634905 19:50648841-50648863 AGGGGATGACAGAGGGGAGGGGG + Intronic
1167634966 19:50649100-50649122 ACGTGGGGACAGAGGGGAGGAGG + Intronic
1167689931 19:50979119-50979141 AAGAGGGAACAGAGAGGAGGTGG + Intronic
1168099663 19:54134262-54134284 AGGGAGGGAGAGAGGGGAGGTGG - Intergenic
1168289331 19:55349789-55349811 GGGTGGGGGCAGAGGAGAGGCGG - Exonic
1168309098 19:55451836-55451858 ATGTGGAGACAGAGGGGTGACGG - Intergenic
925541237 2:4970007-4970029 ACATGGCTACAGAGGAGAGGAGG - Intergenic
926125553 2:10269827-10269849 AGGTGGGGAGGGAGGAGAGGAGG - Intergenic
926240499 2:11081198-11081220 AGGAGGGGACAGAAGGGAGAAGG - Intergenic
926335510 2:11859648-11859670 ACGTGGGGACATGGAGAAGGTGG + Intergenic
926726747 2:16004594-16004616 AGGTGGGGGCAGAGGGGATAGGG - Intergenic
926860756 2:17306246-17306268 AACTGGGCACGGAGGGGAGGAGG - Intergenic
927035363 2:19169602-19169624 TGCTGGGGGCAGAGGGGAGGGGG - Intergenic
927345492 2:22033880-22033902 ATGTGGGTAAAGAGAGGAGGGGG - Intergenic
927868659 2:26609368-26609390 AGGTGGGGAGAGGAGGGAGGTGG - Intronic
929579345 2:43071788-43071810 AAGTGGGGAAAGAGGGGAAGAGG - Intergenic
929793869 2:45043520-45043542 ACGGAGGGACAGAGGGAGGGAGG - Intergenic
930752245 2:54945178-54945200 GGGAGGGGAGAGAGGGGAGGGGG - Intronic
931229844 2:60364959-60364981 ACCTGGGGCAAGAAGGGAGGGGG + Intergenic
932084757 2:68748099-68748121 GGGTGGAGACAGAGGGGAAGGGG - Intronic
932119203 2:69082696-69082718 AAGTGGGGATAGCTGGGAGGAGG - Intronic
932330221 2:70894487-70894509 AGGTGGGGTCAGGGAGGAGGAGG - Intergenic
932336183 2:70932694-70932716 AAGTGGGGGCAGGTGGGAGGAGG - Intronic
932411728 2:71551557-71551579 CAGGGGAGACAGAGGGGAGGAGG - Intronic
935071781 2:99700796-99700818 AGATGGGGACAGGGGGAAGGAGG + Intronic
935194266 2:100802701-100802723 GAGGGGGGACAGAGGGGTGGGGG + Intergenic
935422783 2:102887044-102887066 AGGGAGGGACTGAGGGGAGGGGG - Intergenic
936059291 2:109283947-109283969 GTGTGGGGACAGGAGGGAGGCGG - Intronic
936925782 2:117735307-117735329 AAGTGGGGAGAGAGGGAAGGAGG + Intergenic
937324418 2:120981785-120981807 AGGTGGGGAGAGAGGGAAGAAGG - Intronic
937818170 2:126276297-126276319 AAGGAGGGACAGAGGGAAGGAGG + Intergenic
937818181 2:126276329-126276351 AAGGAGGGACAGAGGGAAGGAGG + Intergenic
937818192 2:126276361-126276383 AAGGAGGGACAGAGGGAAGGAGG + Intergenic
937818203 2:126276393-126276415 AAGGAGGGACAGAGGGAAGGAGG + Intergenic
937907745 2:127060641-127060663 CTGTGGGGACGGACGGGAGGTGG + Intronic
939419791 2:141951989-141952011 GGGTGGGGGGAGAGGGGAGGGGG - Intronic
939859947 2:147407138-147407160 AAGTGGGGACAGGTGGGAAGTGG + Intergenic
941548843 2:166889305-166889327 GAGTGGGGAGAGAGTGGAGGAGG - Intronic
942114100 2:172711317-172711339 AGGTAGGGACAGAGTGGAAGAGG - Intergenic
942315438 2:174693007-174693029 ACGTGGTGACTGGGGGGGGGGGG - Intergenic
942496049 2:176541086-176541108 AGGAGGGGAGGGAGGGGAGGAGG + Intergenic
942541275 2:177017771-177017793 CCCTGGGGACAGAGGGTGGGAGG + Intergenic
942650616 2:178163553-178163575 AAGTGGGGAAAGAGGGAAGGAGG + Intergenic
943092653 2:183392867-183392889 ACGAGGAGAAAGAGGAGAGGAGG + Intergenic
945988770 2:216375656-216375678 AGGTGGGAAGAGGGGGGAGGTGG + Intergenic
946221832 2:218234195-218234217 AAGTAGAGACAGAGGGGAAGTGG - Intronic
946403761 2:219482412-219482434 ACATGGAGACAGAGGGGAGCTGG + Intronic
946519034 2:220446500-220446522 AAGTGGGGAAAGAGGGAAGGAGG - Intergenic
946706452 2:222463155-222463177 AAGTGGGGACAGAATGGAAGAGG - Intronic
947971865 2:234331546-234331568 ACGTGGGGAGGGAGGGAAAGAGG - Intergenic
948154639 2:235771387-235771409 ACGTGGGCACAGCTGGGAGCAGG + Intronic
948566004 2:238886667-238886689 GGGTGGAGACAGAGGGCAGGTGG + Intronic
948617854 2:239212972-239212994 ACGTGGGTACAGAGGCTAGAGGG - Intronic
948674388 2:239588545-239588567 ATGTGGGGACAGAGAGGAGTGGG - Intergenic
948814361 2:240502357-240502379 ATGTTGGGCCAGAGGGGAGAAGG - Intronic
1168812660 20:715858-715880 ATGTGGGGAAAGTGGGGAGAGGG + Intergenic
1171199881 20:23232343-23232365 ACATGGGGAGGGAGGGGAAGGGG - Intergenic
1171393491 20:24816189-24816211 AGGAGGGGACTGAGGGGACGAGG - Intergenic
1171878840 20:30601676-30601698 ACCTGTGGAGAGAGGGGAAGAGG + Intergenic
1171907568 20:30912378-30912400 ACGTGGGTAGTGAGGGGAGCTGG - Intergenic
1171950235 20:31414939-31414961 ACTCAGGGACAGTGGGGAGGTGG + Intergenic
1172089258 20:32416386-32416408 AGGTGGGGACAGAGGGATTGGGG - Intronic
1172163713 20:32885996-32886018 ACGTGGGGACAGCGTGGGAGTGG - Intronic
1172442865 20:34978099-34978121 AAGTGGAGACAGAGGGGGAGGGG + Intronic
1173134089 20:40423942-40423964 ATGTGTGTGCAGAGGGGAGGAGG - Intergenic
1173438339 20:43053255-43053277 ATCTGGGGACAGAGTGGAGGGGG - Intronic
1173621644 20:44441395-44441417 ACCAAGGGACACAGGGGAGGGGG + Intergenic
1173653104 20:44680060-44680082 ACCTGGGGCCAGAGGGGGGTCGG - Intergenic
1174020826 20:47526771-47526793 CCATGGGGAGAGAGGGGAGAGGG + Intronic
1174193416 20:48756273-48756295 AGGTGGGAACAGAGTGGAGAGGG - Intronic
1174570736 20:51499295-51499317 CCCAGGTGACAGAGGGGAGGAGG + Intronic
1174832706 20:53827743-53827765 AGGGAGGGACAGAGGGAAGGAGG - Intergenic
1174843437 20:53920972-53920994 AGGTGGAGGCAGAGAGGAGGAGG - Intergenic
1175197051 20:57251303-57251325 AGGTGGGGGCAGAGCGGTGGGGG + Intronic
1175210425 20:57350840-57350862 ACGGGGGGACGGGGGGGCGGGGG + Intergenic
1175249096 20:57598172-57598194 GGGTGGGGAAAGGGGGGAGGGGG - Intergenic
1175335853 20:58195921-58195943 AGGTGGAGGCAGAGGGGATGGGG - Intergenic
1175338235 20:58210319-58210341 AAGTAGGGAAAGAGGGGAGTTGG + Intergenic
1175734404 20:61375319-61375341 TGGTGGTGACAGTGGGGAGGTGG + Intronic
1175800444 20:61798252-61798274 ACGCAGCAACAGAGGGGAGGGGG + Intronic
1175831566 20:61967620-61967642 AGGTGGGGAAAGGGAGGAGGGGG - Intronic
1175831575 20:61967637-61967659 AGGGGGGAACGGAGGGGAGGTGG - Intronic
1175948856 20:62571815-62571837 AGGTGGGGCCTGTGGGGAGGTGG + Intergenic
1175948888 20:62571900-62571922 AGGTGGGGTCTGTGGGGAGGCGG + Intergenic
1176024087 20:62977085-62977107 CCTTGGGGACTGAGGGGTGGTGG + Intergenic
1176053888 20:63134671-63134693 AGGCGGGGCCACAGGGGAGGCGG + Intergenic
1176053954 20:63134813-63134835 AGGCGGGGCCACAGGGGAGGCGG + Intergenic
1176054025 20:63134972-63134994 AGGCGGGGCCACAGGGGAGGCGG + Intergenic
1176054042 20:63135007-63135029 AGGCGGGGCCACAGGGGAGGCGG + Intergenic
1176054151 20:63135272-63135294 AGGCGGGGCCACAGGGGAGGCGG + Intergenic
1176054168 20:63135307-63135329 AGGCGGGGCCACAGGGGAGGCGG + Intergenic
1176054192 20:63135360-63135382 AGGCGGGGCCACAGGGGAGGCGG + Intergenic
1176054248 20:63135484-63135506 AGGCGGGGCCACAGGGGAGGCGG + Intergenic
1176054281 20:63135555-63135577 AGGCGGGGCCATAGGGGAGGCGG + Intergenic
1176056245 20:63150737-63150759 ACGTGGGCACAGATGAGGGGTGG - Intergenic
1176076412 20:63250377-63250399 AACTGGGGACAGAGGGGATGGGG - Intronic
1176223774 20:63982628-63982650 ACTTGGGGACAGACAGGATGGGG + Intronic
1176287777 21:5027839-5027861 AGGCTGGGTCAGAGGGGAGGCGG - Intronic
1177345127 21:19857182-19857204 AAGTGGGGACAGAGAAGATGAGG - Intergenic
1178635456 21:34298390-34298412 AGGAGAGGACAGATGGGAGGTGG - Intergenic
1178741498 21:35206314-35206336 CCTTGGGGACAGTGAGGAGGTGG + Intronic
1178960481 21:37060185-37060207 ACTTGGGGACTGATGTGAGGAGG - Intronic
1179170704 21:38970733-38970755 CCGTGGGAAGAGAGGGCAGGTGG - Intergenic
1179460168 21:41529243-41529265 ATGTGGGGACTGAGGGGAACTGG + Intronic
1179473921 21:41631393-41631415 ACATCGAGACAGAGAGGAGGAGG - Intergenic
1179540327 21:42079485-42079507 ACGTGAGGCATGAGGGGAGGTGG + Intronic
1179555285 21:42171343-42171365 AGGTGAGGACAGAGGGGAGGAGG - Intergenic
1179714496 21:43280332-43280354 AGGTGGAGGTAGAGGGGAGGTGG + Intergenic
1179714707 21:43280815-43280837 AGGTGGAGGTAGAGGGGAGGTGG + Intergenic
1179714713 21:43280832-43280854 AGGTGGAGGTAGAGGGGAGGTGG + Intergenic
1179714741 21:43280897-43280919 AGGTGGAGGTAGAGGGGAGGTGG + Intergenic
1179714762 21:43280940-43280962 AGGTGGGGGCAGAGGGGAGGTGG + Intergenic
1179869404 21:44235636-44235658 AGGCTGGGTCAGAGGGGAGGCGG + Intronic
1180113146 21:45675196-45675218 ATGTGGGGGCAGTGGGGTGGAGG + Intronic
1180156926 21:45982462-45982484 CGGTGGGGACGGTGGGGAGGGGG - Intronic
1180876759 22:19178408-19178430 AGGGGGTGACAGACGGGAGGCGG + Intronic
1181057634 22:20267672-20267694 ACGTGGGTACCGAGGGTGGGTGG - Intronic
1181172153 22:21015796-21015818 AAGTGGGGCCAGAGAGGAGGTGG + Intronic
1181459947 22:23079925-23079947 ACATGGAGGCAGAGGGCAGGAGG + Intronic
1181530152 22:23512815-23512837 AGGTGGGGTCAGAGGGCAGATGG + Intergenic
1181712693 22:24700541-24700563 ATTTGGTGACAGAGGGAAGGAGG - Intergenic
1181807064 22:25381331-25381353 ACCTGGGGGCAAAGGGGAAGGGG + Intronic
1182067818 22:27442916-27442938 ACAGGGTGCCAGAGGGGAGGTGG + Intergenic
1182735398 22:32529357-32529379 ACCTGGGGCCAAAGGAGAGGTGG - Intronic
1183099069 22:35572470-35572492 ACCTTGGGGCACAGGGGAGGAGG - Intergenic
1183182308 22:36268343-36268365 ACGTGAGGACAGACTGGATGGGG - Intergenic
1183410772 22:37653895-37653917 AGGAGGGGACAGAGGGTGGGCGG + Intronic
1183606141 22:38867641-38867663 TCGTGGTGACAGAAAGGAGGAGG + Intronic
1183795421 22:40113128-40113150 AGGAAGGGAAAGAGGGGAGGAGG + Intronic
1184320343 22:43737058-43737080 AGGAGAGGGCAGAGGGGAGGAGG - Intronic
1184373855 22:44099364-44099386 CCGTGGAGACAGTGGGGAGGCGG - Intronic
1184872527 22:47249999-47250021 ACATGGGGACAGAGGCTTGGAGG - Intergenic
1185188362 22:49417086-49417108 ATGAGGGGAAAGAAGGGAGGAGG + Intronic
1185251272 22:49802815-49802837 AGGTGAGGACAGAGGAGAGATGG + Intronic
949607468 3:5670100-5670122 AGGTGGGGAGAGAGGGGATAAGG + Intergenic
950164556 3:10784325-10784347 ACGTGGAGAGAGTGGGGAGAAGG + Intergenic
950534723 3:13572208-13572230 ACTCGTGGACAGAGGCGAGGTGG + Intronic
950677661 3:14564403-14564425 GCCTGGGGTCAGAGTGGAGGAGG - Intergenic
951630649 3:24716512-24716534 TCATGGGGCCAGTGGGGAGGGGG + Intergenic
952227588 3:31394763-31394785 ACGTGTGGGCAGAAGGGATGAGG - Intergenic
952422577 3:33145177-33145199 ACGTGGTGTCAGAAGGGATGAGG - Exonic
953786782 3:45917060-45917082 CGGTGGGGAGAGAAGGGAGGAGG + Intergenic
953849430 3:46454794-46454816 GCGTGGGGGCAGAGAGGATGGGG + Intronic
953888968 3:46736428-46736450 ATGTGGAGGCAGAGGGGATGGGG + Exonic
953920675 3:46949261-46949283 CAGTGGGGACAGAGGGACGGAGG + Intronic
955193894 3:56787223-56787245 ATGTTGGGGCAGAGGGAAGGAGG - Intronic
955591948 3:60546522-60546544 AAGTGGGGAGAGAGGGATGGTGG - Intronic
956610773 3:71120691-71120713 GCGTGGGGACGGTGGGGAAGAGG + Intronic
956769861 3:72516147-72516169 ACGTGGGGAAAGAAGGGAGGAGG - Intergenic
960223861 3:115147430-115147452 ACGGGGGGGCGGAGGGGAGAAGG - Intergenic
960940130 3:122928002-122928024 ACCTGGGGACAATGGGGAGAAGG + Exonic
960969569 3:123130019-123130041 AAGAGGGTACAGAGAGGAGGGGG - Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961615344 3:128175114-128175136 GCGTGGGAAGAGAAGGGAGGAGG - Intronic
961637471 3:128342397-128342419 ACCTGTGGACTGAGGGGAAGGGG + Intronic
961637484 3:128342444-128342466 ACCTGTGGACTGAGGGGAAGGGG + Intronic
962253750 3:133856241-133856263 ACGGGAGGACATAGGAGAGGAGG + Intronic
963092474 3:141497167-141497189 GGGTGGGGGGAGAGGGGAGGGGG + Intronic
964458666 3:156897043-156897065 ACTTGAGGATAGAGGGTAGGAGG + Intronic
965423839 3:168497352-168497374 TTGTGGGGACAGACGGGAAGAGG - Intergenic
965526489 3:169724813-169724835 GCGTGGGGACAGAGAGTATGTGG + Intergenic
966736912 3:183194101-183194123 GTGTGGGGGCAGAGAGGAGGGGG + Intronic
966883391 3:184361995-184362017 TCGGAGGGGCAGAGGGGAGGCGG - Intronic
967171045 3:186824066-186824088 AAGTGAGGTCAGAGTGGAGGAGG - Intergenic
967270451 3:187728411-187728433 ACGTGGGGCCAGCGGTGTGGAGG + Exonic
968133925 3:196208355-196208377 ACGTGGGGAAGCAGGAGAGGAGG - Intronic
968445579 4:650564-650586 CCGAGGGGACAGAGTGGAGGGGG + Intronic
968878288 4:3285732-3285754 GGGTGGGGGCAGAGGGGATGAGG - Intergenic
968910622 4:3475484-3475506 ACCTGGGAAGACAGGGGAGGTGG + Intronic
969139104 4:5053337-5053359 AGTTGTGGACAGAGGAGAGGTGG + Intronic
969160052 4:5248927-5248949 GGGTGGGGGGAGAGGGGAGGAGG + Intronic
969172710 4:5376834-5376856 GCATGGGGCCAGAGGGGATGTGG - Intronic
969619567 4:8272314-8272336 TCGAGGGGACAGAAGGGAGGAGG + Intronic
969662222 4:8536971-8536993 ACTGGGGGACGAAGGGGAGGAGG + Intergenic
970520858 4:16882474-16882496 AGGTGGGGAGAGAATGGAGGGGG - Intronic
971834820 4:31749281-31749303 ATGGAGGGACAGAGGGGAGGAGG - Intergenic
972336474 4:38111208-38111230 ACGTGGGTAGAGAGTGGATGAGG - Intronic
973277076 4:48321454-48321476 AGGTGGTGACAGAGAGGAAGCGG - Intergenic
974108933 4:57503768-57503790 ACTCAGGGACTGAGGGGAGGAGG - Intergenic
976586935 4:86809095-86809117 CCATGGGGAAAGAGAGGAGGAGG + Intronic
977165439 4:93689099-93689121 ACGTGAAGACAATGGGGAGGAGG + Intronic
978822977 4:112987262-112987284 CAGTGGGGACAGAGGGATGGTGG + Intronic
979088254 4:116442596-116442618 GGGTGGGGAGAGGGGGGAGGGGG + Intergenic
980563007 4:134502003-134502025 AGGTGGGGGCAGGGGGAAGGGGG - Intergenic
980807145 4:137828324-137828346 AAGTGGGGAAGGAGGGAAGGAGG + Intergenic
981615150 4:146638025-146638047 GGGTGGGGACAGCGGGGAGGGGG + Intergenic
984821939 4:183889753-183889775 AGGTGTAGAAAGAGGGGAGGTGG - Intronic
985030819 4:185787651-185787673 GGGTGGAGACAGATGGGAGGAGG - Intronic
985235640 4:187871063-187871085 ACGTGGGGAGAGAGAGGAGGAGG + Intergenic
985477728 5:89216-89238 GTGTGTGGACAGAGGGGAGGAGG - Intergenic
985536008 5:466079-466101 GGGTGGGGACAGTGGGGTGGGGG + Intronic
986151338 5:5133044-5133066 GCCTCGGGCCAGAGGGGAGGTGG - Intergenic
986669864 5:10133243-10133265 GTGTGGGGACAGAGGGGATAAGG - Intergenic
986994100 5:13586626-13586648 ATGTGGGGCAAGAGGGGAAGAGG - Intergenic
987096199 5:14552597-14552619 ACGTGAGGACACAGGGAAGATGG + Intergenic
987245163 5:16041525-16041547 CTGTGGGGGCAGAGGGGAGGGGG - Intergenic
987289400 5:16494404-16494426 AGGTGGGGCCTGATGGGAGGTGG + Intronic
987962678 5:24830724-24830746 GGGTGGGGGGAGAGGGGAGGGGG - Intergenic
988711935 5:33787709-33787731 AGGTGGGGGCAGTGGGGATGTGG - Intronic
989442353 5:41488063-41488085 GCGTGGGGGGAGGGGGGAGGGGG - Intronic
990021990 5:51139124-51139146 ATGTGGGTACAGAGGGCATGTGG + Intergenic
991432433 5:66562357-66562379 AAGTGGAGACTGAGGGAAGGAGG - Intergenic
994366924 5:98928183-98928205 ACGTGGGGAGCGGCGGGAGGGGG - Intronic
995126935 5:108586885-108586907 GGGTGGGGAGAGAGGGAAGGGGG + Intergenic
995708157 5:115006672-115006694 ACATAGATACAGAGGGGAGGTGG + Intergenic
995738633 5:115330553-115330575 AGGTGGGGAAAGAGGGGAACAGG + Intergenic
996347391 5:122501768-122501790 TGGTGGGGACAGAAAGGAGGGGG + Intergenic
996424335 5:123296468-123296490 ATTTGGGGACAGAAGGGAGAGGG + Intergenic
997466266 5:134090106-134090128 ATGTGGGGACTGATGGAAGGAGG - Intergenic
997842671 5:137256477-137256499 ACATGGTGACAGAGGGCAAGAGG + Intronic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
999319356 5:150603811-150603833 TCCTGGGGCCAGAGGAGAGGTGG - Intronic
1000318813 5:160118415-160118437 ACGGGGGGACGGGGGGGCGGGGG - Intronic
1000987046 5:167872184-167872206 TTGTGGGGACTGAGGTGAGGTGG + Intronic
1001155850 5:169271976-169271998 AAGTGGGTACAGAGGAGAGTAGG + Intronic
1001441218 5:171744483-171744505 AAGTGGGGAGAGAAGAGAGGAGG + Intergenic
1001495586 5:172185947-172185969 GTGTGGGCTCAGAGGGGAGGTGG + Intronic
1001597655 5:172908311-172908333 GGGGGGGGAGAGAGGGGAGGGGG + Intronic
1001948702 5:175800992-175801014 GCATGGGGACAGATGGGAGGTGG + Intronic
1002006139 5:176236692-176236714 ACATGGGGAAAGGGGCGAGGTGG + Intergenic
1002105285 5:176876921-176876943 ACTTGGGGACAGAAGGTATGCGG - Intronic
1002220240 5:177673945-177673967 ACATGGGGAAAGGGGCGAGGTGG - Intergenic
1002460164 5:179369347-179369369 GTGTGGGGACAGAGCGAAGGCGG - Intergenic
1002646529 5:180659221-180659243 AGGTGGGGACTGGGGGGTGGGGG - Intergenic
1003073039 6:2959596-2959618 ACGTGGAGAAAGTGGGAAGGAGG + Exonic
1003539394 6:7004869-7004891 AGGTGTTGACAGCGGGGAGGAGG - Intergenic
1003847159 6:10185332-10185354 TGGTGGGGACAGAGAGGAGGAGG - Intronic
1004631003 6:17421230-17421252 ACTTGGGGAAAGGTGGGAGGGGG + Intronic
1005824444 6:29624323-29624345 GCTTGGTGACAGAGGGAAGGGGG - Intronic
1005842921 6:29756022-29756044 AAGTGGAGACAAAGGGGAGGGGG - Intergenic
1005852769 6:29834687-29834709 ACGTGGGGATTGGTGGGAGGGGG + Intergenic
1005871976 6:29981185-29981207 AAGTGGAGACAAAGCGGAGGGGG - Intergenic
1005966540 6:30730726-30730748 ACCTGTGGACAGAAGGGAAGTGG + Exonic
1005979338 6:30824431-30824453 GAGTGGGGACAGATGGGAGATGG + Intergenic
1006069860 6:31490536-31490558 AAGTGGAGACAAAGTGGAGGGGG + Intergenic
1006163364 6:32050493-32050515 AGGTGGGGGCCGAGGGCAGGGGG - Intronic
1006163984 6:32053883-32053905 AGGTGGGGGCTGAGGGCAGGGGG - Intronic
1006164614 6:32057081-32057103 AGGTGGGGGCTGAGGGCAGGAGG - Intronic
1006303694 6:33207194-33207216 AGGTGGAGAGAAAGGGGAGGGGG - Intergenic
1006402348 6:33825187-33825209 AGGAGGGGACAGAGAGGAGAGGG - Intergenic
1006491453 6:34392075-34392097 ACGTTGGGGCTGAGGGGAAGCGG - Intronic
1006871571 6:37256820-37256842 ATTTGGGGAAAGAGGGAAGGCGG - Intronic
1006990387 6:38210063-38210085 ACGTGGGGAGACAGGGGAAGGGG + Intronic
1007108883 6:39301583-39301605 TCCTGGTGACAGAGGGGAGGAGG + Intronic
1007337377 6:41163247-41163269 GGGTGGGGACAGAGGGGAGGAGG + Intergenic
1007357389 6:41331650-41331672 GAGCGGGGACAGAGGGGAGCCGG + Intergenic
1007766677 6:44164754-44164776 TCGTGGGGCCAGATGGCAGGTGG + Intronic
1008494002 6:52114504-52114526 AGGTGGTGACAGATGGGAGGAGG + Intergenic
1010449528 6:75987449-75987471 GGGTGGGGGCAGGGGGGAGGGGG - Intronic
1011531136 6:88322298-88322320 ATGTGGGAAAAGAGGAGAGGAGG + Intergenic
1011716106 6:90106923-90106945 ACTTGAGGAAAGAGAGGAGGCGG - Intronic
1012389934 6:98727027-98727049 ACATGGGGACACTGGGGATGGGG - Intergenic
1013408623 6:109864797-109864819 ACGGGGAGACAAAAGGGAGGGGG + Intergenic
1013582795 6:111552641-111552663 AGCTGGGGAGAGAGGGGAGAGGG - Intergenic
1013608507 6:111773302-111773324 AGGGAGGGAAAGAGGGGAGGGGG + Intronic
1013703639 6:112805710-112805732 ATGTGGGGAGAGATGGAAGGAGG - Intergenic
1014312640 6:119823637-119823659 ATTTGGAGACAGAAGGGAGGAGG - Intergenic
1014838183 6:126183824-126183846 ACGTGGGGAAGGAGGGTGGGAGG + Intergenic
1014951007 6:127556312-127556334 CTGTGGGGAGAGAGTGGAGGTGG - Intronic
1015013548 6:128381561-128381583 ACCTTGGGCCAGAGGGAAGGAGG + Intronic
1015493833 6:133859211-133859233 ACTTGGGGGTAGAGGGTAGGAGG - Intergenic
1015891960 6:137978368-137978390 ACGTGGGGAAGGAGGGGACCTGG + Intergenic
1016091322 6:139982883-139982905 ATCTGGGGAGAGGGGGGAGGAGG - Intergenic
1016599094 6:145836387-145836409 AAGTTGGCACAGAGGGGAGGCGG + Intergenic
1016799804 6:148157015-148157037 GCGTGGTGACAGAGGAGAGAGGG - Intergenic
1017064601 6:150517745-150517767 ACTTGGTGATAGAGGGAAGGGGG - Intergenic
1017592627 6:155993519-155993541 ACATGCAGACAGAGGGAAGGGGG + Intergenic
1017603420 6:156107808-156107830 AGGAGGGGACAGAAGGGAAGAGG + Intergenic
1018038709 6:159903337-159903359 ACATGGAGAAAGAGGAGAGGTGG - Intergenic
1018205763 6:161436033-161436055 ATGGGAGGACAGAGAGGAGGGGG + Intronic
1018670648 6:166174066-166174088 ATGGCGGGAGAGAGGGGAGGAGG + Intergenic
1018672987 6:166194922-166194944 TCATGGGGACAGAGGCCAGGAGG + Intergenic
1018812313 6:167307009-167307031 GCATGGGGACAAAAGGGAGGAGG - Intronic
1019008868 6:168825782-168825804 AGGCGGGGACAGAGGGTCGGGGG + Intergenic
1019008927 6:168825965-168825987 AGGCGGGGACAGAGGGTCGGGGG + Intergenic
1019051223 6:169185296-169185318 ACGTGGGGTGAATGGGGAGGTGG + Intergenic
1019102331 6:169641374-169641396 TCGTGGGGAGAGAGAGGAAGAGG - Intronic
1019311585 7:364437-364459 CAGTGGTGACAGTGGGGAGGGGG - Intergenic
1019621317 7:1993822-1993844 GAGTGGGGACAGGTGGGAGGAGG - Intronic
1019732231 7:2634560-2634582 GCGGGGGGATGGAGGGGAGGTGG + Intronic
1019845353 7:3494133-3494155 ATGTTGGGGCAGTGGGGAGGAGG - Intronic
1020080004 7:5282150-5282172 AGATGGGAGCAGAGGGGAGGAGG + Intronic
1020567302 7:9813925-9813947 ACTTTGGGAAAGAGGAGAGGGGG + Intergenic
1020852935 7:13379337-13379359 GGGTGGGGGGAGAGGGGAGGGGG + Intergenic
1021781750 7:24113671-24113693 GCGTGGGGGCAGGGGGGAGCGGG - Intergenic
1022207944 7:28180763-28180785 ACCGGGAGGCAGAGGGGAGGCGG + Intergenic
1022498584 7:30868517-30868539 ATGTATGGACAGAGGGCAGGTGG + Intronic
1022578972 7:31528740-31528762 AGGAGGGGAAAGAGGGGAGGAGG - Intronic
1022729266 7:33007338-33007360 ATGGGGGCACAGAGGGGATGGGG - Intergenic
1022786555 7:33643768-33643790 ACATGTAGACAGAGGTGAGGAGG + Intergenic
1023535367 7:41203112-41203134 AAGTGGGGACAGGCAGGAGGAGG + Intergenic
1023586860 7:41739797-41739819 AGGAGGGGAAAGAGAGGAGGAGG + Intergenic
1023666147 7:42525343-42525365 ATGTGGGGAGAAAGGGGAAGAGG + Intergenic
1023917029 7:44597137-44597159 AGGAGGGGGGAGAGGGGAGGGGG + Intergenic
1024354624 7:48402038-48402060 AGGTGGGGACAAAGTGCAGGGGG + Intronic
1024541662 7:50479916-50479938 AGGTGGGGAGAGGGGAGAGGTGG - Intronic
1024791316 7:52967832-52967854 ATGTGGGGATACAGGGAAGGGGG - Intergenic
1025044389 7:55680642-55680664 ATGGGGGCACAGAGGGGATGGGG + Intergenic
1025198910 7:56950066-56950088 AGATGGGAGCAGAGGGGAGGAGG - Intergenic
1025673036 7:63626867-63626889 AGATGGGAGCAGAGGGGAGGAGG + Intergenic
1026273100 7:68853386-68853408 ATGTGGGGGTGGAGGGGAGGGGG - Intergenic
1026360779 7:69599444-69599466 AGGGGCGGAGAGAGGGGAGGAGG - Exonic
1026479331 7:70764806-70764828 ACGGGGAGGCAGAGGGGTGGTGG - Exonic
1026769707 7:73187882-73187904 GAGTGGGGACAGAAGGAAGGCGG + Intergenic
1026823798 7:73568479-73568501 AGGTGGGGACAGAAGTGAGCTGG - Intergenic
1027010575 7:74741264-74741286 GAGTGGGGACAGAAGGAAGGCGG + Intronic
1027077467 7:75204776-75204798 GAGTGGGGACAGAAGGAAGGCGG - Intergenic
1028362281 7:89983764-89983786 TGGTGGGGGGAGAGGGGAGGGGG - Intergenic
1028464501 7:91135202-91135224 ACTGGGGGACAGAGGGTTGGGGG + Intronic
1028682957 7:93559304-93559326 TCTTAGGGACTGAGGGGAGGGGG - Intronic
1029325011 7:99799338-99799360 ATGTGGGGGCAGAAGGTAGGAGG + Intergenic
1029619553 7:101681339-101681361 AGGCGGGGACAGAGGGGTGGAGG + Intergenic
1030318343 7:108139175-108139197 ATGTGAGGACAGAGAGAAGGTGG - Intergenic
1031187368 7:118500088-118500110 AGGTGTGGACAGGAGGGAGGTGG - Intergenic
1032091853 7:128915240-128915262 GGGTGGGGGCGGAGGGGAGGGGG - Intergenic
1032096074 7:128939038-128939060 GGGTGGGGGCGGAGGGGAGGGGG + Intronic
1032189605 7:129756638-129756660 ACATGGGGAGAGCTGGGAGGAGG - Exonic
1033451007 7:141462469-141462491 ATGTGGGGAGAGAGGAGAGCTGG + Intronic
1033459580 7:141533225-141533247 ACTTGGGGACTGAGGGAAGGTGG + Intergenic
1033600370 7:142884735-142884757 GGGTGGGGACTGAGGGGAAGCGG - Intronic
1034309144 7:150071654-150071676 CCTCGAGGACAGAGGGGAGGTGG + Intergenic
1034316091 7:150134709-150134731 ACGTAGTGACAGATGGGATGTGG - Intergenic
1034427224 7:151020364-151020386 AGGAGGGGAAAGAAGGGAGGAGG + Intronic
1034442693 7:151094838-151094860 AGGGAGGGACAGAGGGAAGGAGG - Intronic
1034451305 7:151138621-151138643 GCCTGGGGACAAAGGGGAGGAGG - Intronic
1034452205 7:151143077-151143099 CCCTGGGGACAGTGGGGATGCGG - Intronic
1034572444 7:151967772-151967794 GCGTGGGGACGGGAGGGAGGTGG - Intronic
1034790800 7:153966072-153966094 ACGTAGTGACAGATGGGATGTGG + Intronic
1034797711 7:154028982-154029004 CCTCGAGGACAGAGGGGAGGTGG - Intronic
1034926763 7:155129064-155129086 AAGGTGGGACAGAGTGGAGGTGG + Intergenic
1034955653 7:155332833-155332855 ACGTGGGGACCGAGGGCACCGGG - Intergenic
1035230583 7:157463606-157463628 AGGTGGGGACAGATGGGGTGAGG - Intergenic
1035230611 7:157463695-157463717 AGGTGGGGATAGATGGGATGAGG - Intergenic
1035230636 7:157463767-157463789 AGGTGGGGACAGATGGGGTGAGG - Intergenic
1035359455 7:158300771-158300793 CCGTGTGGAGGGAGGGGAGGTGG + Intronic
1035441291 7:158903127-158903149 ACGTGGGGACTGAGGGGTTGAGG + Intronic
1035520376 8:271340-271362 ATGTGGGGACAGAGGTGGGCGGG - Intergenic
1035571487 8:675704-675726 TCGTGAGGACAGAGGCGCGGCGG + Intronic
1035571520 8:675841-675863 TCGTGAGGACAGAGGCGCGGCGG + Intronic
1035571540 8:675923-675945 TCGTGAGGACAGAGGCGCGGCGG + Intronic
1035571547 8:675950-675972 TCGTGAGGACAGAGGCGCGGCGG + Intronic
1035571681 8:676500-676522 TCGTGAGGACAGAGGCGCGGCGG + Intronic
1036588553 8:10147411-10147433 ACATGGGGACAGAGGTGGTGAGG - Intronic
1036602701 8:10276811-10276833 AGGTGGGGTCAAAGTGGAGGAGG - Intronic
1036746424 8:11413176-11413198 AGGTGGGGAGAGAGAGGGGGAGG - Intronic
1037098892 8:15018625-15018647 ATGCAGGGACAGAGGGGAGAAGG + Intronic
1037194209 8:16167644-16167666 AGGTAAGGACAGAGGGAAGGTGG - Intronic
1037296125 8:17402439-17402461 ACATGGAGACAGAGGGTAGAAGG - Intronic
1037584144 8:20264924-20264946 ACGTGTGGAAAGGGGGGATGTGG + Intronic
1037721706 8:21449933-21449955 ACGTGGTGACCAAGGGGACGTGG - Intergenic
1038060948 8:23912149-23912171 ATGTGGGGCCTGATGGGAGGTGG - Intergenic
1038435406 8:27532206-27532228 ATGTGGGGGCTGAGGGGAGAGGG - Intronic
1038529456 8:28306140-28306162 GAGTGGGGGCAGAGGGCAGGTGG - Intergenic
1038586782 8:28796824-28796846 GGGTGGGGACTGATGGGAGGAGG + Intronic
1038780993 8:30568432-30568454 ACGTGGGGACAGATGGGCCTGGG - Intronic
1039089335 8:33811979-33812001 AAGTGGGGGTAGAGGAGAGGAGG - Intergenic
1039839755 8:41285311-41285333 GCGTGGGGAACGAGGGGCGGAGG - Intronic
1039977677 8:42381191-42381213 GAGTGGGGAGGGAGGGGAGGAGG + Intergenic
1040072667 8:43201169-43201191 AAGTGGGGAACGAGGGAAGGAGG - Exonic
1041904157 8:63013302-63013324 ACGTGGGGAGCCTGGGGAGGAGG - Intergenic
1042643764 8:70963109-70963131 AGGTGGGGACTGGGGGAAGGGGG - Intergenic
1042942123 8:74118381-74118403 AGGTGGGGAGAGAGGGAAGAAGG - Intergenic
1043178202 8:77048137-77048159 GGGTGGGGAGAAAGGGGAGGGGG + Intergenic
1043372365 8:79610390-79610412 ACCTGGGGACATGGGGGAAGAGG - Intergenic
1043463662 8:80485886-80485908 GCGTGTGGGCAGCGGGGAGGCGG + Intronic
1043586451 8:81775491-81775513 ACTTAAGGATAGAGGGGAGGAGG - Intergenic
1044057287 8:87586904-87586926 ACGTGGGGAGAGAGAGGGAGAGG + Intronic
1044847068 8:96392468-96392490 AGGTGGGAACAGAGGGGTGAAGG - Intergenic
1045394033 8:101742859-101742881 ACACAGGGACACAGGGGAGGGGG - Intronic
1045468874 8:102493488-102493510 ACGTGAGGACACAGTGGAGAAGG + Intergenic
1046709416 8:117493039-117493061 ACTTGAGGACAGAGGGTAGAAGG - Intergenic
1047145891 8:122199068-122199090 AAGTGGGGGCGGGGGGGAGGGGG - Intergenic
1047211744 8:122846134-122846156 ATGTTGGCAGAGAGGGGAGGAGG + Intronic
1047415798 8:124663546-124663568 GTGTGGGGAGAAAGGGGAGGTGG - Intronic
1047967697 8:130058796-130058818 ACCAGGGGACAGAGAGGAAGAGG - Intronic
1047986774 8:130243554-130243576 GTGTGGGAACAGAGGGGAGAGGG - Intronic
1048754578 8:137723440-137723462 ACTTGAGGACAGAGGGTGGGAGG - Intergenic
1048999654 8:139816529-139816551 CAGAGGGGACAGAGGAGAGGTGG + Intronic
1049117223 8:140699459-140699481 CCTTGGGGACAGAGAGGAAGTGG - Intronic
1049409230 8:142465017-142465039 AGGTGGGCAGACAGGGGAGGCGG + Intronic
1049485487 8:142856987-142857009 CCGTGGGGAGGGGGGGGAGGGGG + Intronic
1049698751 8:143996970-143996992 ACTTGGGGGCAGCGGGAAGGGGG + Intronic
1050766266 9:9139094-9139116 AGGTGGGGGCGGGGGGGAGGGGG - Intronic
1050933796 9:11366903-11366925 GCGTGGGCAGAGAGGGGAGAGGG + Intergenic
1051128204 9:13829413-13829435 ATGTGGGGAAAAGGGGGAGGAGG + Intergenic
1051202441 9:14642661-14642683 ATGTGGGGACAGAGAGAAGGTGG + Intronic
1051502436 9:17792627-17792649 AGGTTTGGACAGAGGGAAGGAGG - Intronic
1051895152 9:21978774-21978796 GGGTGGGGGCAGAGGGGAGTAGG + Intronic
1052367411 9:27628461-27628483 AAGTGGTGAAAGAGGGGAAGTGG - Intergenic
1052382857 9:27790004-27790026 AGGTGGGGACTGGTGGGAGGTGG + Intergenic
1052495703 9:29220768-29220790 AGATAGGGACAGAGGGTAGGAGG + Intergenic
1052689537 9:31799944-31799966 AGCTGGAGACAAAGGGGAGGTGG + Intergenic
1052834515 9:33240574-33240596 CTGTGGGGACAGAAGGGAGCAGG + Intronic
1052916204 9:33925950-33925972 CTGTGGGGACAGAGGGGAATAGG - Intronic
1053205818 9:36185779-36185801 ATGTGAGGACAGAGTGAAGGTGG + Intergenic
1053329168 9:37188508-37188530 GGGTGGGGAGAGGGGGGAGGGGG - Intronic
1053412032 9:37922128-37922150 CCTGGGGGACAGAGTGGAGGAGG + Intronic
1053475849 9:38381695-38381717 CCGTGAGGACAGAGTGGAGGTGG - Intergenic
1055365975 9:75545174-75545196 AGGTGGGGAGAGAGGGAGGGAGG - Intergenic
1055449503 9:76418132-76418154 AAGTGGGCAGAGAGGGGAGGAGG + Intergenic
1055965217 9:81859332-81859354 AAGTGGGGAGGGAGGGGAGGGGG + Intergenic
1056201157 9:84278025-84278047 TGGTGGGGAGGGAGGGGAGGAGG + Exonic
1056497670 9:87176147-87176169 ACATGGGGGGAGAGGGGGGGGGG - Intergenic
1057274400 9:93668612-93668634 AGATGGGGACAGAGGTGGGGAGG + Intronic
1057343373 9:94224356-94224378 ACGAGGGGAAAGAGGGAAGGAGG - Intergenic
1058045504 9:100352949-100352971 ACGTGAGCACAGCAGGGAGGGGG - Intergenic
1058110840 9:101029370-101029392 ACGTGGAGACAAAGGGGGCGTGG + Intronic
1058879977 9:109277707-109277729 AAGTGAGGACACAGGTGAGGTGG + Intronic
1059172315 9:112137249-112137271 ATGTAGTGACACAGGGGAGGAGG + Intronic
1059557523 9:115296180-115296202 TGCGGGGGACAGAGGGGAGGAGG + Intronic
1059606138 9:115838540-115838562 AAGCGGGGAAAGAGGGCAGGAGG + Intergenic
1060189364 9:121582341-121582363 GCATGGGGACAGAAGGAAGGGGG - Intronic
1060319891 9:122548739-122548761 GGGTGGGGGTAGAGGGGAGGGGG - Intergenic
1060552254 9:124491227-124491249 ACCTGGGGGCAGAGGGCACGGGG + Exonic
1060569350 9:124623875-124623897 AAGTGTGGAGAAAGGGGAGGAGG - Intronic
1060948018 9:127581805-127581827 ACATGGGGAGAGAGGGAGGGAGG - Intergenic
1060948040 9:127581886-127581908 ACATGGGGAGAGAGGGAGGGAGG - Intergenic
1060948049 9:127581913-127581935 ACATGGGGAGAGAGGGAGGGAGG - Intergenic
1060948081 9:127582017-127582039 ACATGGGGAGAGAGGGAGGGAGG - Intergenic
1060948090 9:127582044-127582066 ACATGGGGAGAGAGGGAGGGAGG - Intergenic
1060973846 9:127753840-127753862 ACGTGGGCAAAGGAGGGAGGAGG + Intronic
1060991224 9:127850320-127850342 TGCTGGGGACAGAGGAGAGGTGG + Intronic
1061134402 9:128724913-128724935 CCCTGGGGACACAGGGAAGGAGG - Intergenic
1061250223 9:129422059-129422081 AGGTGGGGTCAGAGGGCAGATGG - Intergenic
1061263248 9:129491405-129491427 AGGAGAAGACAGAGGGGAGGTGG + Intergenic
1061346236 9:130027997-130028019 AGGTGGGGGTAGAGGTGAGGGGG - Intronic
1061428675 9:130517483-130517505 ACTTCGGGGCAGAGGGGAGAGGG - Intergenic
1061515425 9:131087219-131087241 ACAGAGGCACAGAGGGGAGGAGG - Intronic
1061587471 9:131578320-131578342 GCGTGGGGAGAGTGGGGAGAGGG + Exonic
1062194105 9:135263814-135263836 ACGGGGAGAGAGAAGGGAGGGGG - Intergenic
1062203860 9:135324644-135324666 AGGTGGGCACAGGAGGGAGGTGG + Intergenic
1062595341 9:137296628-137296650 AGGTTGGGACAGAGGGGTCGTGG - Intergenic
1062726451 9:138076655-138076677 ACTTGGGAGCAGAAGGGAGGTGG + Intronic
1062733643 9:138122428-138122450 ACCTCGGGACGGAGGGGATGGGG + Exonic
1203776355 EBV:75371-75393 TCGAGGGGAGACAGGGGAGGGGG - Intergenic
1185462835 X:340451-340473 GTGAGGGGACAGACGGGAGGGGG - Intronic
1186384440 X:9094527-9094549 ACTTGAGGGCAGTGGGGAGGAGG + Intronic
1186482537 X:9907035-9907057 GCGTTGGGGCAGGGGGGAGGCGG + Intronic
1188047360 X:25441721-25441743 AAGTAGGAATAGAGGGGAGGAGG + Intergenic
1190276878 X:48904692-48904714 ATGGGGGGACACAAGGGAGGGGG - Exonic
1190322450 X:49186951-49186973 ATGAGGGGAGAGAGGGGACGAGG - Intergenic
1190576725 X:51846851-51846873 AGGTGGGGCCTGATGGGAGGTGG - Intronic
1190732962 X:53236599-53236621 GCCTGGGGACAGAGGGAGGGAGG - Intronic
1190877925 X:54472697-54472719 AGGTGGGGCCAGAGAGGAGTGGG + Intronic
1190899938 X:54661788-54661810 GCGTGGGGACAGAGAGTAGGTGG - Intergenic
1191593542 X:62916348-62916370 ATGTGGGGAGAGAGGTGATGTGG - Intergenic
1191840347 X:65509346-65509368 ACATGAGGCCTGAGGGGAGGTGG - Intergenic
1191937704 X:66442911-66442933 AGGGTGGAACAGAGGGGAGGAGG - Intergenic
1192180448 X:68912607-68912629 AGACGGAGACAGAGGGGAGGAGG - Intergenic
1192363990 X:70455765-70455787 CCTAGGGGACAAAGGGGAGGAGG - Intronic
1192442417 X:71184423-71184445 ACGTGTGTTGAGAGGGGAGGAGG - Intergenic
1193049864 X:77088413-77088435 GCCTGGGGACAGAGGACAGGAGG + Intergenic
1193303476 X:79921182-79921204 ACGTGGGGAAAGGTGTGAGGTGG - Intergenic
1193746465 X:85288440-85288462 CAGTGGGCACTGAGGGGAGGTGG - Intronic
1195202536 X:102564761-102564783 AGGTGGGGAAGGAGGGAAGGTGG - Intergenic
1196997914 X:121404264-121404286 CAGTGGGGATAGAGGGGATGGGG - Intergenic
1197441795 X:126500538-126500560 TCGTGGGGAAGGATGGGAGGGGG - Intergenic
1197708516 X:129650503-129650525 TCTTGGGGAAAGAGGGAAGGAGG - Intronic
1198089242 X:133311596-133311618 ATGTTGGGACAGGGGAGAGGAGG + Intronic
1198532616 X:137560865-137560887 ACTTGGGGACAAAGGGTTGGTGG + Intergenic
1199257751 X:145735985-145736007 ACTTGAGGACAGAGGGTGGGAGG + Intergenic
1200081517 X:153579096-153579118 AGGTATGGACAGAGAGGAGGAGG + Intronic
1200135171 X:153871243-153871265 AGGTGGGGGCAGGGGGGTGGCGG + Intronic