ID: 1167643623

View in Genome Browser
Species Human (GRCh38)
Location 19:50694843-50694865
Sequence CGGCAGGCCCCGGCCCGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 5, 3: 33, 4: 290}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167643623_1167643629 -5 Left 1167643623 19:50694843-50694865 CCACCGCGGGCCGGGGCCTGCCG 0: 1
1: 0
2: 5
3: 33
4: 290
Right 1167643629 19:50694861-50694883 TGCCGGCCGGCCCGCAAAGCAGG 0: 1
1: 0
2: 0
3: 2
4: 68
1167643623_1167643631 -2 Left 1167643623 19:50694843-50694865 CCACCGCGGGCCGGGGCCTGCCG 0: 1
1: 0
2: 5
3: 33
4: 290
Right 1167643631 19:50694864-50694886 CGGCCGGCCCGCAAAGCAGGAGG 0: 1
1: 0
2: 0
3: 9
4: 48
1167643623_1167643633 1 Left 1167643623 19:50694843-50694865 CCACCGCGGGCCGGGGCCTGCCG 0: 1
1: 0
2: 5
3: 33
4: 290
Right 1167643633 19:50694867-50694889 CCGGCCCGCAAAGCAGGAGGCGG 0: 1
1: 1
2: 1
3: 23
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167643623 Original CRISPR CGGCAGGCCCCGGCCCGCGG TGG (reversed) Intronic
900243302 1:1626831-1626853 CCGCAGGCCCTGGGCCGCGTCGG + Exonic
900458632 1:2789672-2789694 CTGCAGGCTGCGGCCCGAGGAGG - Intronic
900630646 1:3633421-3633443 GGGCCGGCCCCGGCCCGGGGCGG + Exonic
900640366 1:3685484-3685506 AGGCAGGCCCAGGCCTGCGTGGG + Intronic
901680960 1:10912653-10912675 GGGCAGGGCCAGGCCGGCGGAGG - Intergenic
902224633 1:14988832-14988854 CTGCAGGCCACGGCCCTCCGGGG + Intronic
902876861 1:19345609-19345631 TGGCAGGCCCAGGCCCACGCTGG + Intronic
903324731 1:22563437-22563459 GGGCCGGCCCCCGCCCGGGGCGG + Intergenic
903652537 1:24930441-24930463 CGGAAGGCGCCACCCCGCGGAGG + Intronic
903777161 1:25800408-25800430 CGGCAGGTCCGGGCCCGAGCTGG + Exonic
903925135 1:26826628-26826650 CGGGAGGCCGCGGCGGGCGGTGG + Intergenic
904483296 1:30807394-30807416 CGGCGGGCGGCGGCCCGGGGCGG - Intergenic
904563441 1:31413509-31413531 CGGCAGGCGCCGGGCAGCTGCGG + Intronic
904769018 1:32870762-32870784 CGGCAGGCCCGGGGCGGCGCAGG + Exonic
905269902 1:36781033-36781055 TGGCAGGCCCCAGCCCGGGCTGG + Intergenic
905399566 1:37691844-37691866 CGGGAGTGGCCGGCCCGCGGGGG + Intronic
906102595 1:43272745-43272767 GGGCAGCCCCCGGCCCCCTGGGG - Exonic
907277943 1:53327381-53327403 CCGCAGACCCCTGCGCGCGGCGG - Intronic
908401329 1:63774709-63774731 GGGCGCGCCCCGGCCCGCCGCGG - Intronic
909569169 1:77088499-77088521 CTGCAGGCTCCGCCCCCCGGAGG + Intergenic
912576177 1:110674660-110674682 CGGCAGCTCGCGGCCTGCGGCGG + Exonic
912798641 1:112707260-112707282 CCCCAGTCCCCGGCCTGCGGAGG - Intronic
913109173 1:115642235-115642257 AGGGAGCCCCCGGCCCGAGGCGG - Intronic
915325259 1:155078749-155078771 CGACAGGCCCCGTCCCGCTCCGG - Intergenic
916588285 1:166166584-166166606 CGGGGGGCTCCGGCCCGGGGTGG - Exonic
917565375 1:176207247-176207269 CGGCCGGCCACGGCGCGCCGGGG - Exonic
918423524 1:184386894-184386916 CCGCAGGCCCCGCCCCGGGGAGG + Intergenic
921866701 1:220094234-220094256 CGGCCGCGCCCGGCCCGCGAGGG - Exonic
922505036 1:226121535-226121557 CGCCAGGCCCCCCCCCGCAGGGG + Intergenic
923055972 1:230426126-230426148 CCGCAGGCTGCGGGCCGCGGCGG + Intergenic
923056091 1:230426466-230426488 CGCCCCGCCCCGCCCCGCGGAGG - Intergenic
923119667 1:230978616-230978638 CAGGAGGCCCCGGCGGGCGGCGG - Exonic
923612014 1:235504262-235504284 CGGGAGAGCCCGGCTCGCGGCGG - Exonic
924759665 1:246972047-246972069 CAGCAGGCCCCTGCCCTCAGGGG - Intronic
1063657796 10:8009224-8009246 CAGCAGGGCAGGGCCCGCGGCGG - Exonic
1064011881 10:11742350-11742372 CGGCACGCCCCGCCCCGCCCCGG - Exonic
1065520593 10:26567335-26567357 CGCCAGGCCGCCCCCCGCGGTGG + Exonic
1065712548 10:28532467-28532489 CAGCAGCCCCTGCCCCGCGGAGG + Intergenic
1067116176 10:43437080-43437102 GCGCAGGCCCCGCCCCTCGGCGG + Intronic
1067711757 10:48656056-48656078 AGGCAGGCCCCGGGCGGCCGAGG - Intronic
1071579633 10:86757055-86757077 CCGCAGGCCTCGGCGCGCGCTGG + Intronic
1072784009 10:98268274-98268296 CCGCAGGCCCCGCCCCGGGCGGG + Intergenic
1073065991 10:100759492-100759514 AGGCAGGCCCCTGCCTGCTGGGG + Intronic
1073286737 10:102394246-102394268 CGGAAGCTCCCGGCCCGGGGTGG + Intronic
1074138054 10:110644552-110644574 CGGCACCCTCCGGCCCGCGAGGG + Exonic
1075119328 10:119652216-119652238 CCGGAGGCCCCGGCCCACCGTGG + Intronic
1076752069 10:132548269-132548291 CGGTAGTCCCCGGACCGTGGTGG + Intronic
1076850545 10:133090312-133090334 CGGGTGGCCCCGGGCCGAGGAGG - Intronic
1076892998 10:133293946-133293968 AGGCCGGCCCCGTCCTGCGGCGG - Intronic
1076909353 10:133379446-133379468 CTGGAGGCCACGGCCCGCGCCGG + Exonic
1077096703 11:802041-802063 CGGCAGCGCCGGGCCTGCGGTGG + Exonic
1077236746 11:1485583-1485605 CCGCAGCCCCCGGCCCTTGGAGG + Intronic
1077376790 11:2209020-2209042 GGGCAGGCCCAGGCCAGTGGAGG + Intergenic
1077459193 11:2700284-2700306 GCGCTGGCCCCGGCCCCCGGTGG - Intronic
1077466837 11:2737386-2737408 CAGCAGGCCCAGACCCACGGGGG + Intronic
1077491504 11:2862926-2862948 CGGCGGGCGCGGGCCCGGGGCGG + Intergenic
1079126239 11:17720329-17720351 CCGCTGCCCCCGGGCCGCGGCGG + Exonic
1083753670 11:64777992-64778014 CAGCCGGGCCCGGCCGGCGGCGG - Exonic
1083827572 11:65212041-65212063 CTGCAGGCCCCGGCCCATGGGGG + Intergenic
1084028397 11:66466930-66466952 GGGATGGGCCCGGCCCGCGGCGG - Exonic
1085332912 11:75668061-75668083 CGGCGGGCCCCGGCCGGAGCGGG - Exonic
1088223267 11:107591364-107591386 CAGCAGCTCCCGGCGCGCGGCGG - Exonic
1089499905 11:118925774-118925796 CGGCTGGCTCCGGGCGGCGGCGG + Intronic
1090194044 11:124800072-124800094 CGACATGCCCCGGCAGGCGGCGG + Exonic
1092524452 12:9301261-9301283 CGGCAGGCCCTGGCCTGGGGAGG - Intergenic
1092542812 12:9430551-9430573 CGGCAGGCCCTGGCCCGGGGAGG + Intergenic
1094510205 12:31091886-31091908 CAGCAGGCCCTGGCCCGGGGAGG - Intronic
1094624173 12:32107017-32107039 CGGCATGGCCCGGGCTGCGGCGG - Intronic
1095577695 12:43758936-43758958 CGGCAGGCCCCGCCCCTTCGCGG + Exonic
1096073578 12:48788950-48788972 CGGCCGGCCGGAGCCCGCGGGGG - Intronic
1096100905 12:48970017-48970039 CGGCAGGGCGAGGCGCGCGGAGG - Intronic
1096228220 12:49882725-49882747 GGGCAGGGCCAGGCCCACGGAGG - Intronic
1097648024 12:62260167-62260189 CGGCAGTCCCGGGCCAGAGGAGG + Intronic
1099202077 12:79689924-79689946 GGGCGGCCCCCGGCCCGCGGCGG - Exonic
1102035455 12:109768477-109768499 GGGCAGGCCCCGGCCCGGCAGGG - Exonic
1102854088 12:116277921-116277943 CGGCAGTCCGCCGCCCGCCGGGG - Intergenic
1102913773 12:116737942-116737964 CGGCAGGCCCGGGTCCCGGGCGG + Exonic
1103325320 12:120116542-120116564 CTGCCGGGCGCGGCCCGCGGGGG - Intronic
1103604888 12:122079031-122079053 CGGCCCGGCCCGGCCCGAGGCGG - Exonic
1103698574 12:122835734-122835756 CGGGAGGCGCCGGCCAGGGGCGG + Intronic
1104980061 12:132569725-132569747 CTCCAGGCCCCGCCCGGCGGAGG - Intronic
1105557362 13:21459415-21459437 GGGCGGCCCGCGGCCCGCGGCGG - Intergenic
1105851304 13:24338989-24339011 CAGCAGGCGCCGGCCAGCCGCGG - Intergenic
1107141069 13:36999193-36999215 CGGTAAGCCCCGGCCTGCGCGGG + Intronic
1107468023 13:40666644-40666666 CCGCCGCCCCCCGCCCGCGGCGG + Intergenic
1113803239 13:113097022-113097044 CGGAAGACCCCGGCCCGCTGGGG + Exonic
1114292593 14:21300992-21301014 CCGCAGGTCCCGGCCAGCAGCGG - Exonic
1114470392 14:22957172-22957194 CGGCAGGCCCCGCCCCTCGACGG + Intronic
1116435025 14:44887064-44887086 CGGCAGGGGCCGGCCCAGGGCGG - Intergenic
1117353484 14:54902563-54902585 CTGCTGGGCCCGGGCCGCGGCGG + Exonic
1118220897 14:63853523-63853545 GCCCAGGCCCCGGCCCTCGGGGG + Intronic
1118925534 14:70187806-70187828 CTGCAGCTCCCGACCCGCGGCGG + Intronic
1119219302 14:72893393-72893415 CGGCAGCCCCCGGATCTCGGAGG - Intronic
1119475200 14:74923007-74923029 CGGCAGGACCCTGCCCGGCGGGG - Intronic
1119602486 14:75985933-75985955 CGGCAGGCCTCGCGCCGCGCCGG + Intronic
1119731956 14:76956677-76956699 GCGCCAGCCCCGGCCCGCGGCGG - Intergenic
1120167846 14:81220230-81220252 CGGCCCGGCCCGGCCCGCGGCGG + Intronic
1120976883 14:90256768-90256790 TGGTCGGCCCCGGCCCGCGGTGG - Intronic
1121127589 14:91417916-91417938 CGGGCGGCCCCGCCCCTCGGCGG + Intergenic
1121247707 14:92474364-92474386 CAGCAGGCCCCTGCCTGCGAGGG + Intronic
1122354315 14:101114006-101114028 TGGCAGGGCTCCGCCCGCGGGGG + Intergenic
1122582354 14:102778234-102778256 CGGGAGTCGCCGGCCCTCGGCGG - Intronic
1122601241 14:102922969-102922991 CGGCCAGCCCCGGCCTCCGGCGG + Intronic
1122924201 14:104892275-104892297 CGGCAGGCCCCTGTCCTCGCTGG + Intronic
1123041292 14:105491318-105491340 ACGCAGGCCCCGGGCCGCGGCGG + Exonic
1124629473 15:31328256-31328278 GGGCCGGCCCCGGCGCGCGGCGG + Intronic
1129761438 15:78131318-78131340 CGGCTGGCAGCGGCCCACGGTGG + Exonic
1130531171 15:84748673-84748695 CCGCTCGGCCCGGCCCGCGGGGG - Intronic
1131144288 15:90001560-90001582 CGGCCCGGCCCGGCCCGCCGAGG + Exonic
1132500593 16:283042-283064 CGGCCGCCCCCGGCCCCCAGGGG - Intergenic
1132527856 16:426278-426300 CGCCGCGCTCCGGCCCGCGGGGG + Exonic
1132642287 16:983377-983399 GGGCAGGACCCAGCCGGCGGTGG - Intronic
1132737214 16:1392897-1392919 CGGCTGGCCGCTGCCCGTGGAGG + Intronic
1133121564 16:3611707-3611729 CGCCGGGCGCGGGCCCGCGGCGG + Intronic
1136261812 16:29082344-29082366 CGTCCGACCCCGGCCCGCCGCGG - Intergenic
1136473761 16:30499068-30499090 CTGCAGCTCCCGGCCCGTGGTGG + Exonic
1136634097 16:31508275-31508297 CTGCAGGCTCCCGTCCGCGGCGG + Exonic
1137056624 16:35749255-35749277 GGGAAGGTCCCGGGCCGCGGTGG - Intergenic
1137454846 16:48610193-48610215 CGGCGGGGCCCGGCCCGCGGCGG - Exonic
1137683146 16:50368601-50368623 CGGCAGGCCCAGGCCGGCGAAGG - Intronic
1139383631 16:66549963-66549985 CCTCAGGCCCCGGGCCGCGGAGG - Exonic
1139465193 16:67150573-67150595 CGGGAGGCCACGCCCCGGGGGGG + Exonic
1139489726 16:67279743-67279765 CTGCAGGCCCATGCCCGTGGGGG - Exonic
1141079229 16:81036008-81036030 CAGCCGGCCGCGGCCCGCGGGGG + Exonic
1141531453 16:84649105-84649127 CCGCAGGCCCCGTCCGGCCGGGG - Intronic
1141638618 16:85328810-85328832 CGGGAGGCCCCGGGGCGGGGAGG - Intergenic
1141959180 16:87392788-87392810 CGGCAGGCACCCCGCCGCGGAGG - Intronic
1142156009 16:88533199-88533221 CGCCAGGCCCAGGTCCGCGGAGG - Exonic
1142192938 16:88726187-88726209 TCTCAGGCCCCGGCCCGTGGAGG - Intronic
1142305686 16:89283631-89283653 CGGCAGGGCCAAGCCCGAGGAGG - Exonic
1142429777 16:90019636-90019658 CGGCGGGGCGCGGCCCGCGAGGG - Intronic
1143078496 17:4365488-4365510 CCGCAGGCTCTGGCCCGGGGCGG - Intronic
1143515478 17:7417480-7417502 TGGCAGCTCACGGCCCGCGGCGG - Exonic
1143598517 17:7929576-7929598 AGGCAGGATCGGGCCCGCGGGGG + Intronic
1144829012 17:18121480-18121502 CGCCAGGCCCCGGCCCTGGGCGG - Exonic
1145163103 17:20589117-20589139 CGGCAGGCGCCGGGCCGGGTGGG - Intergenic
1146654274 17:34626145-34626167 CGGCCAGCCCCAGCCCGCCGGGG + Exonic
1147258932 17:39197514-39197536 CGGCTGGGCCGGGCCGGCGGCGG - Exonic
1150310976 17:64129625-64129647 CAGAAGGCCCCGGCCTGAGGAGG - Intronic
1151557093 17:74852058-74852080 CGGCAGTCCCCGGCCGGGGCTGG + Exonic
1151759155 17:76090793-76090815 CGGGAGGCCTCGGCCAGCTGGGG + Intronic
1152223562 17:79082337-79082359 CAGGAGGCCCAGGCCCGCCGAGG - Intronic
1152649821 17:81487746-81487768 GGGCAGGCCCCGGCCAGGCGGGG + Intergenic
1152683928 17:81684362-81684384 CCGAATGCCCGGGCCCGCGGAGG - Intronic
1152757575 17:82093327-82093349 CGGCAGGGCACTGCCCGCTGTGG + Exonic
1155002923 18:21704356-21704378 CGGCAGCCCCCAGCGCGCGCGGG - Intronic
1157260932 18:46174689-46174711 CCGCAGTCCCCGGGCTGCGGGGG + Intronic
1157496753 18:48161942-48161964 CGGGAGGCCGCGGCCCGGCGCGG + Intronic
1157867122 18:51197014-51197036 CGGCCGGCCCGGGGCCCCGGAGG - Exonic
1158505554 18:58044055-58044077 CTGGAGGCCCCGGGCCGGGGTGG + Intergenic
1158579727 18:58671285-58671307 CGGCCAGCCCGGGACCGCGGGGG + Intergenic
1160152425 18:76405500-76405522 CAGCAGGCCCCAGCCCGGGAGGG + Intronic
1160861195 19:1237819-1237841 CGGCTGGCTCCGGCGCCCGGTGG + Exonic
1160877721 19:1304956-1304978 CCGCTGCCCCCTGCCCGCGGCGG - Intergenic
1160995706 19:1881125-1881147 CGGCAGGCTCGGGCCCTCGGGGG + Intronic
1161006733 19:1940966-1940988 CGCCGGGCCGCTGCCCGCGGGGG - Intergenic
1161108698 19:2456609-2456631 CGGCAGGCCCCGCCCACCGCGGG - Intronic
1161293224 19:3506694-3506716 CGGCAGGCCCCGACGTGGGGGGG - Intronic
1161550648 19:4910306-4910328 CGACCGGGCCCGCCCCGCGGTGG - Intronic
1163370019 19:16896636-16896658 CGGCAGGGCCCGACTCGCCGGGG + Exonic
1164834730 19:31349774-31349796 CGCCGAGCCCCGGGCCGCGGCGG - Intergenic
1164992109 19:32692066-32692088 CGGAAGCCCTCGGCCGGCGGCGG - Exonic
1165147864 19:33743375-33743397 CTGCAGGCTCCGCCCCCCGGGGG + Intronic
1165744473 19:38222539-38222561 CGGCGGTACCCGGCCCGCGGTGG + Exonic
1165812129 19:38617997-38618019 GGGGAGGCCACAGCCCGCGGAGG - Intronic
1167001110 19:46746256-46746278 AGGCAGCCCCGGGCCCACGGCGG - Exonic
1167103805 19:47419235-47419257 CGGCAGGCGCCGGGCCGGGTGGG + Exonic
1167258392 19:48443972-48443994 GCGCAGGCCACGGCCCGAGGGGG + Exonic
1167418779 19:49390729-49390751 AGGCAGGCCCCGACCCTTGGTGG + Intronic
1167643623 19:50694843-50694865 CGGCAGGCCCCGGCCCGCGGTGG - Intronic
1167649034 19:50719591-50719613 TGGCCAGGCCCGGCCCGCGGGGG - Intergenic
1167781430 19:51601503-51601525 GGGCAGGCGCCGGGGCGCGGGGG - Intergenic
1167885044 19:52493314-52493336 CAGCAGGGCCCGGCACGAGGAGG - Intronic
1167909419 19:52689948-52689970 CAGCAGGGCCCGGCACGAGGAGG + Intronic
1167913922 19:52725244-52725266 CAGCAGGGCCCGGCACGAGGAGG + Intronic
1167915128 19:52734502-52734524 CAGCAGGCCCCGGCATGAGGAGG + Intronic
1167946454 19:52992807-52992829 CAGCAGGGCCCGGCACGAGGAGG + Intergenic
1167955098 19:53058024-53058046 CAGCAGGGCCCGGCACGAGGAGG + Intergenic
1167960750 19:53102889-53102911 CAGCAGGGCCCGGCACGAGGAGG + Intronic
1167967312 19:53158239-53158261 CAGCAGGGCCCGGCACGAGGAGG + Intronic
1167971861 19:53192838-53192860 CAGCAGGGCCCGGCACGAGGAGG + Intronic
1168297351 19:55383878-55383900 CGGCGGGCGCCGACCAGCGGCGG + Exonic
929808653 2:45169895-45169917 GGTCAGGCCCCACCCCGCGGTGG + Intergenic
930730699 2:54725011-54725033 AGGACGGCCCCGGCGCGCGGGGG + Exonic
932191061 2:69741936-69741958 AGGCAGGCCTCGACCCCCGGCGG - Intronic
932432556 2:71684709-71684731 CGGCCGGCCCCGGCCTGCTGAGG + Intronic
932773226 2:74513288-74513310 CGGCCCGCCCCGGCCCCCGGGGG - Intergenic
934618374 2:95789474-95789496 CAGTCGGCCCTGGCCCGCGGTGG - Intergenic
934642519 2:96035085-96035107 CAGTCGGCCCTGGCCCGCGGTGG + Exonic
934761154 2:96857835-96857857 CACCAGGCCCCGGCCCAAGGAGG - Intronic
935653118 2:105398974-105398996 CGGGAGTCCCCGGCCCGCTGCGG - Intronic
936433264 2:112482232-112482254 CGGCGGGGGCCGGGCCGCGGCGG + Exonic
937518249 2:122680298-122680320 CTGCAGGCTCCGTCCCCCGGGGG - Intergenic
944703453 2:202265637-202265659 CGGCCCGCCCCAGCCCGCTGTGG + Intergenic
947549666 2:231037451-231037473 CGGCTGGGCTCGGCCCTCGGGGG + Intergenic
947840527 2:233204660-233204682 CGGCAAGCACCGGCCGGAGGAGG + Exonic
948205204 2:236159781-236159803 AGGCAGGGCCGGGCCCGGGGTGG - Intergenic
948467503 2:238159243-238159265 CCGCACGCCCCGGCTCGGGGCGG + Intronic
1168777841 20:462549-462571 CCGCTGGCCCCGCCCCGCGCCGG + Exonic
1169065488 20:2692627-2692649 CGGCCGGGCCCGGGCCGCGGCGG - Intergenic
1169143574 20:3238976-3238998 CCACCGGCCCCGGCCCGCGCAGG + Intronic
1169214745 20:3786535-3786557 CGGGGGGCCCGGGCCCGTGGCGG + Exonic
1169383258 20:5126984-5127006 CGGCCGGCCCCGCCCCGCCCGGG - Exonic
1171902441 20:30869881-30869903 TGGCAGGCCCCGACCCCAGGAGG + Intergenic
1171977654 20:31605737-31605759 CGGCAGCCCTCGGCCCCCGGGGG - Exonic
1172101236 20:32484623-32484645 CGTCAGGACCCGGCCCGGTGTGG - Intronic
1173801739 20:45898532-45898554 CGGCAGAACCCGGCCTGCAGGGG - Exonic
1175863553 20:62162953-62162975 AGGCAGGCCCAGGCCCCCCGGGG - Intronic
1176097027 20:63349015-63349037 GGGCTGGCCCCGGGCCCCGGGGG + Intronic
1176140194 20:63541598-63541620 ACGCAGGGCCCGGCCCTCGGGGG + Exonic
1176146527 20:63567961-63567983 GGGAAGGCCCCGGCCTGGGGAGG + Intronic
1176194455 20:63830948-63830970 CGCCACGCCCCGCCCCGCGGGGG - Intronic
1176550738 21:8219727-8219749 CCACCGGCCTCGGCCCGCGGTGG + Intergenic
1176550981 21:8221255-8221277 CCACCGGCCTCGGCCCGCGGTGG + Intergenic
1176569780 21:8403522-8403544 CCACCGGCCTCGGCCCGCGGTGG + Intergenic
1176569890 21:8404254-8404276 CCACCGGCCTCGGCCCGCGGTGG + Intergenic
1176577580 21:8446997-8447019 CCACCGGCCTCGGCCCGCGGTGG + Intergenic
1176577691 21:8447729-8447751 CCACCGGCCTCGGCCCGCGGTGG + Intergenic
1176577801 21:8448461-8448483 CCACCGGCCTCGGCCCGCGGTGG + Intergenic
1178327896 21:31660061-31660083 GCGCAGGCCCAGCCCCGCGGCGG - Intronic
1179647653 21:42785112-42785134 CCGCAGGCCCCGCCCTGTGGTGG + Intergenic
1180319376 22:11306722-11306744 TGGCAGGCCCCAACCCGAGGAGG - Intergenic
1180335826 22:11575851-11575873 TGGCAGGCCCCGACCCCAGGAGG + Intergenic
1180702424 22:17788913-17788935 CAGCTGGCCCCAGCCCACGGAGG + Exonic
1180997613 22:19973245-19973267 AGGCAGGCCCCCGGTCGCGGCGG + Exonic
1181536478 22:23548926-23548948 CGGCAGGCCTCTCCCTGCGGTGG - Intergenic
1182226169 22:28800414-28800436 CGGCAGGGCCTGGCCGGCCGGGG + Exonic
1183302508 22:37065280-37065302 CTGCAGGCCCCAGCCCTCAGTGG + Intergenic
1183546116 22:38455509-38455531 CGACAGAGCCCGGCCGGCGGGGG - Intergenic
1183939524 22:41285577-41285599 CAGCAGGCCCACGCCCGCGGGGG - Intronic
1184872152 22:47247694-47247716 CTGCACACCCCGGCCTGCGGAGG + Intergenic
1185418143 22:50721018-50721040 CAGCAGGTCGCGGCCGGCGGTGG - Intergenic
1203255639 22_KI270733v1_random:136070-136092 CCACCGGCCTCGGCCCGCGGTGG + Intergenic
1203255989 22_KI270733v1_random:138222-138244 CCACCGGCCTCGGCCCGCGGTGG + Intergenic
953027362 3:39152957-39152979 CGGGCGCCCCCGGCCGGCGGGGG - Intronic
953978815 3:47403126-47403148 CTGCAGGCTCCGCCCCCCGGGGG + Intronic
954210516 3:49094375-49094397 GGCCAGGCCCCGCCCCGCGTGGG - Intergenic
954247012 3:49340027-49340049 CGGCTGGGCCGGGGCCGCGGAGG - Exonic
961012927 3:123448169-123448191 CGGCGGGGCGCGGCCAGCGGGGG - Exonic
961340271 3:126212958-126212980 CTTCAGGCCCCGGCCTGTGGAGG + Intergenic
961787546 3:129356892-129356914 CTGGAGGCCCAGGCCCGCTGAGG - Intergenic
963259071 3:143176113-143176135 CAGGAGACCCCGGCCCCCGGCGG - Intergenic
963606798 3:147419500-147419522 ATGCAGCCCCCGGCCCTCGGCGG - Intronic
968090371 3:195895345-195895367 CCGCAGCCCCCGCCCCGCAGCGG + Exonic
968512705 4:1002602-1002624 CCCCAGGCCCCGCCACGCGGAGG - Intronic
970195634 4:13547766-13547788 GGGGAAGCCCCGGCCCTCGGGGG + Intergenic
971257961 4:25031000-25031022 TGGCGGGGCCCGCCCCGCGGGGG + Intergenic
978127160 4:105147821-105147843 AGGCAGGCGCAGGCCCGGGGAGG + Intronic
978795709 4:112705892-112705914 CGTCCGACCCCGGCCCGCCGCGG + Intergenic
979278198 4:118836206-118836228 CCGGTGGCCCCGCCCCGCGGCGG - Intronic
979455513 4:120922424-120922446 CCGCAGGGCCCGGGGCGCGGCGG - Intronic
979624284 4:122827608-122827630 CGCGAGGCCCCGGCGCGCCGCGG - Intronic
980694947 4:136342360-136342382 CTGCAGGCTCCGCCCCCCGGGGG - Intergenic
982235680 4:153249294-153249316 CAACAGGCCCCGCCCCGAGGCGG - Intronic
984889047 4:184474918-184474940 CGGGGGGCGCAGGCCCGCGGCGG + Intergenic
984992606 4:185396155-185396177 CGGCCGAGCCCGGCCCGCGCAGG - Intronic
984992694 4:185396573-185396595 CCGCGGGCCCCGCCCCGAGGTGG + Exonic
985549170 5:524493-524515 GGGCAGGCTCCGCCCCGGGGCGG - Intergenic
985627205 5:995258-995280 AGGCAGGCCCAGGCCCACTGAGG - Intergenic
985777564 5:1852686-1852708 CAGCAGGCCCCTGCAGGCGGTGG - Intergenic
985781987 5:1876396-1876418 GGGCAGGCCCCACCACGCGGGGG + Intergenic
988577767 5:32444030-32444052 CGGCCCGGCCCGGCCCGCGGCGG - Intronic
991371785 5:65926343-65926365 CAGCAGCACCCGGCCGGCGGGGG - Intergenic
992042377 5:72848556-72848578 CGGGAGCCCCCGGCCGCCGGGGG - Intronic
992866336 5:80960560-80960582 CGGGAGGCCGCGGCGCGCGGTGG - Intergenic
993905745 5:93621306-93621328 CGGCTGGCCCGCGCCCGCGAGGG - Intronic
995106354 5:108381417-108381439 GCGTAGGCCCCGTCCCGCGGCGG + Exonic
996298573 5:121954216-121954238 CGGCCGGCCCGCGCCCGCGCCGG - Intergenic
997425651 5:133800986-133801008 CGACAGGCCCTGGCACCCGGGGG + Intergenic
997485236 5:134225711-134225733 CGGCGGGCTCGGCCCCGCGGCGG + Intronic
998367587 5:141640929-141640951 GAGCAGGCCCCTGCCCGTGGTGG + Exonic
999300355 5:150486551-150486573 CGGCCGGGCCCCGCGCGCGGGGG + Intronic
1001413096 5:171524575-171524597 CGGCAGACCCCGGCCAGCCCTGG + Intergenic
1001553468 5:172620699-172620721 AGGCAGGCCCCGGCCCTCGGGGG - Intergenic
1001773410 5:174312013-174312035 AGGCAGACCCGGGCGCGCGGGGG + Intergenic
1002197287 5:177508408-177508430 CGGCAGGGCCTGGCCGGCGAGGG - Exonic
1004262063 6:14117533-14117555 CGCCCGGCCCGGGCGCGCGGGGG + Intronic
1004614931 6:17280958-17280980 CGTCGACCCCCGGCCCGCGGGGG + Intergenic
1005293747 6:24403336-24403358 CGGGAGGCCGAGGCCTGCGGAGG - Intronic
1005915169 6:30345147-30345169 CGGGAGGCCCTGGAGCGCGGCGG + Exonic
1006187684 6:32190106-32190128 CAGGAGACCCCGGCCCCCGGCGG + Exonic
1006351111 6:33521759-33521781 CGGCTGGCCCCGGGCAGCGAGGG - Intergenic
1011416270 6:87122827-87122849 CGCCAGGGCCCGCCCCGCGCCGG + Intergenic
1011418942 6:87152177-87152199 CCGCAGGCCTCGGGCCACGGAGG - Intergenic
1014272566 6:119349925-119349947 CGGCGGGGCCCGGCCGGCGGCGG + Intergenic
1018028991 6:159827213-159827235 TGGCACGCCCCGGCCAGCGGTGG + Intergenic
1019314052 7:376483-376505 CCGCAGGCCCCGGCCCACCCTGG + Intergenic
1019442298 7:1053477-1053499 CGCCAGGCCCTGGCACGCTGTGG + Intronic
1019524653 7:1475510-1475532 CTGCAGGTTCCGGCCTGCGGTGG + Intronic
1019536164 7:1530915-1530937 CAGCGGGGCCCGGGCCGCGGCGG + Intronic
1019712379 7:2523609-2523631 CGGCAGGCCCAGGCGGGCGCCGG + Intronic
1022090944 7:27108001-27108023 CCCCAGGCCCCGGCCCGTGGTGG + Exonic
1023848712 7:44138897-44138919 GGGCAGGGCCAGGCCCACGGGGG - Exonic
1023930154 7:44700527-44700549 CTGCAGGCCCCAGCCCGGTGGGG + Intronic
1024578361 7:50782581-50782603 CCGCAGGCCCCTGGCCGGGGCGG - Intronic
1026923734 7:74174537-74174559 CGGGAGGCGGGGGCCCGCGGAGG + Intronic
1027138188 7:75639181-75639203 CCGCCTGCCCCGGTCCGCGGGGG - Intronic
1027361790 7:77416570-77416592 CGCCAGGACCAGGCCCGCCGGGG + Intergenic
1029055311 7:97733973-97733995 AGGCACGCACGGGCCCGCGGGGG + Intronic
1032424523 7:131811337-131811359 CTGCAGGCTCCGCCCCGCCGGGG - Intergenic
1032781854 7:135170362-135170384 CGGCGGGTACCGGCCCGCAGAGG - Intronic
1032786273 7:135202947-135202969 CTGCAGGCCCTGGCCCACGTGGG - Intronic
1033794946 7:144835800-144835822 CCGGGGGCCCCCGCCCGCGGCGG - Intronic
1034618056 7:152436002-152436024 CGCCCGGCCCCTGCGCGCGGAGG - Exonic
1045336014 8:101205291-101205313 CGGCAGGGCCCGGCCCGGGGCGG - Intronic
1045564368 8:103298804-103298826 GGGCAGGTCCGGGCTCGCGGCGG - Intronic
1048923728 8:139252469-139252491 GGGCAGGCCACAGCCCGAGGGGG + Intergenic
1049802148 8:144522843-144522865 CAGCGAGCCCCGGCCCGAGGCGG - Exonic
1051449409 9:17178637-17178659 CGGCAGGCCCCGGGCAGTGAGGG - Intronic
1052996003 9:34551912-34551934 CGGCAGGCCCGGGCCCGCCGGGG + Exonic
1053114520 9:35489809-35489831 CGCCAGGCACCACCCCGCGGGGG + Intergenic
1057076629 9:92141515-92141537 CGGTAGGCCCCGGGCCGGGCTGG - Intergenic
1057383671 9:94589979-94590001 CAGCAGGCCCAGGCCTGCGGTGG + Intronic
1057463797 9:95292475-95292497 CAGCCGGCCGCGGCCCGCGGGGG + Intronic
1057773274 9:97984823-97984845 CGGCCGCCCCCGCCCCGCGCCGG + Intronic
1059036701 9:110761649-110761671 CTGCAGGCTCCGCCCCCCGGGGG + Intronic
1060468617 9:123929805-123929827 CTGCAGGCCGCGGGCCGCGCGGG - Intronic
1061015930 9:127980792-127980814 GGGCCGGCCCCGGGCAGCGGAGG + Intergenic
1061666098 9:132161851-132161873 GGGCAGCCCCCGGCCCGGGTGGG - Intronic
1061990725 9:134157246-134157268 GGGAAGGCCCAGGCCCGCCGTGG - Intronic
1062379786 9:136281686-136281708 TGGCAGGGCCAGGCCCGTGGAGG + Intronic
1062472492 9:136712590-136712612 CGGCCCGGCCCGGCCCGCAGCGG - Exonic
1062528028 9:136986045-136986067 CGGAAGGCCACGTCGCGCGGCGG - Intronic
1203472147 Un_GL000220v1:119921-119943 CCACCGGCCTCGGCCCGCGGTGG + Intergenic
1189821516 X:44873492-44873514 CTGCGGGCCCCGGTCCGAGGGGG + Exonic
1199846274 X:151694922-151694944 AGTCAGGCCCCGCCCCCCGGCGG + Intergenic
1200086890 X:153611424-153611446 CTGCCTGCCCCGGCCCGGGGGGG - Intergenic
1200951444 Y:8903035-8903057 CAGGAGGCCCCGGCCCGCAACGG - Intergenic
1201071082 Y:10147795-10147817 TGGCAGGCCCCAACCCGAGGAGG + Intergenic