ID: 1167644384

View in Genome Browser
Species Human (GRCh38)
Location 19:50697761-50697783
Sequence TACCCCACCCCCATTAGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 144}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167644371_1167644384 22 Left 1167644371 19:50697716-50697738 CCAGCCCTAGAGCTCCTGGCCCA 0: 1
1: 0
2: 3
3: 29
4: 339
Right 1167644384 19:50697761-50697783 TACCCCACCCCCATTAGGAAGGG 0: 1
1: 0
2: 0
3: 20
4: 144
1167644378_1167644384 -8 Left 1167644378 19:50697746-50697768 CCATCTACCTCCCAGTACCCCAC 0: 1
1: 0
2: 3
3: 33
4: 516
Right 1167644384 19:50697761-50697783 TACCCCACCCCCATTAGGAAGGG 0: 1
1: 0
2: 0
3: 20
4: 144
1167644374_1167644384 8 Left 1167644374 19:50697730-50697752 CCTGGCCCAAGTCTTCCCATCTA 0: 1
1: 0
2: 2
3: 40
4: 315
Right 1167644384 19:50697761-50697783 TACCCCACCCCCATTAGGAAGGG 0: 1
1: 0
2: 0
3: 20
4: 144
1167644376_1167644384 2 Left 1167644376 19:50697736-50697758 CCAAGTCTTCCCATCTACCTCCC 0: 1
1: 1
2: 1
3: 28
4: 388
Right 1167644384 19:50697761-50697783 TACCCCACCCCCATTAGGAAGGG 0: 1
1: 0
2: 0
3: 20
4: 144
1167644368_1167644384 30 Left 1167644368 19:50697708-50697730 CCACAATCCCAGCCCTAGAGCTC 0: 1
1: 0
2: 3
3: 17
4: 335
Right 1167644384 19:50697761-50697783 TACCCCACCCCCATTAGGAAGGG 0: 1
1: 0
2: 0
3: 20
4: 144
1167644373_1167644384 17 Left 1167644373 19:50697721-50697743 CCTAGAGCTCCTGGCCCAAGTCT 0: 1
1: 0
2: 0
3: 23
4: 290
Right 1167644384 19:50697761-50697783 TACCCCACCCCCATTAGGAAGGG 0: 1
1: 0
2: 0
3: 20
4: 144
1167644370_1167644384 23 Left 1167644370 19:50697715-50697737 CCCAGCCCTAGAGCTCCTGGCCC 0: 1
1: 0
2: 2
3: 32
4: 315
Right 1167644384 19:50697761-50697783 TACCCCACCCCCATTAGGAAGGG 0: 1
1: 0
2: 0
3: 20
4: 144
1167644372_1167644384 18 Left 1167644372 19:50697720-50697742 CCCTAGAGCTCCTGGCCCAAGTC 0: 1
1: 0
2: 0
3: 8
4: 166
Right 1167644384 19:50697761-50697783 TACCCCACCCCCATTAGGAAGGG 0: 1
1: 0
2: 0
3: 20
4: 144
1167644377_1167644384 -7 Left 1167644377 19:50697745-50697767 CCCATCTACCTCCCAGTACCCCA 0: 1
1: 0
2: 3
3: 17
4: 242
Right 1167644384 19:50697761-50697783 TACCCCACCCCCATTAGGAAGGG 0: 1
1: 0
2: 0
3: 20
4: 144
1167644375_1167644384 3 Left 1167644375 19:50697735-50697757 CCCAAGTCTTCCCATCTACCTCC 0: 1
1: 0
2: 0
3: 32
4: 358
Right 1167644384 19:50697761-50697783 TACCCCACCCCCATTAGGAAGGG 0: 1
1: 0
2: 0
3: 20
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167644384 Original CRISPR TACCCCACCCCCATTAGGAA GGG Intronic
901234036 1:7657946-7657968 TGCCGCACCCCCATCAGGACTGG + Intronic
903236775 1:21955680-21955702 TTCCCCTCCCCCACCAGGAAAGG - Intergenic
904926381 1:34051925-34051947 ACCCCCACCCCCATTAGTGAGGG - Intronic
905630215 1:39514386-39514408 TCCCTCACCTCCATCAGGAAGGG - Intronic
905667545 1:39771804-39771826 TCCCTCACCTCCATCAGGAAGGG + Intronic
907842505 1:58171097-58171119 TCCCACACCCTTATTAGGAAGGG + Intronic
908960623 1:69692901-69692923 GTCCCCACCCACATTAGGGAGGG - Intronic
910487461 1:87731334-87731356 CGCCCCACCCCCATGAGGTAGGG + Intergenic
911129619 1:94375352-94375374 TCCCACACCCTTATTAGGAAGGG - Intergenic
911203517 1:95070125-95070147 TACCCCACATCCAGAAGGAAAGG + Intronic
912701931 1:111884451-111884473 TCCCCCACCCCAGTCAGGAATGG - Intronic
915673793 1:157512555-157512577 GTCCCCACCCACATTAGGCAGGG - Intergenic
915931415 1:160062802-160062824 TTCCCCAACCCCAGCAGGAAGGG + Intronic
917035814 1:170745833-170745855 TTCTCCACACCCATTAGGAATGG - Intergenic
918722416 1:187870252-187870274 TACCCCACACCCAGAAGGAAAGG + Intergenic
921100700 1:211926461-211926483 CACCCCACCCCCAACAGGAATGG + Intergenic
922984814 1:229857973-229857995 TACCCTGGCCCCATTAGCAATGG - Intergenic
924599209 1:245473558-245473580 CCCCCAACCCCCATTAAGAATGG - Intronic
1063574470 10:7249260-7249282 TGCCAGACCCCTATTAGGAATGG - Intronic
1063574912 10:7252938-7252960 CACCCCACACCCACTAGGGAGGG + Intronic
1067016358 10:42758627-42758649 TACCCCATCGCCATTAGGACAGG - Intergenic
1078825745 11:14928806-14928828 TACCCCTCCCCCAGTTGTAAGGG - Intronic
1080171730 11:29311823-29311845 TACCCCTTCATCATTAGGAATGG + Intergenic
1081344742 11:41970420-41970442 TACACCACCACCAGTTGGAAAGG - Intergenic
1081421590 11:42878426-42878448 TCCCCCACCCTTATTAGGGAGGG + Intergenic
1081966617 11:47173934-47173956 TACTCCAAACCCATGAGGAAAGG + Intronic
1083480698 11:62943834-62943856 TACCTCACACCCACTAGGAATGG + Intronic
1084944149 11:72629847-72629869 TACAGCACCCCCATGAGGTAGGG - Intronic
1085672206 11:78477695-78477717 TAGCCCACCCACATTATGAAGGG - Intronic
1086031136 11:82357012-82357034 AAGCCCACCCACATTATGAAGGG - Intergenic
1087517413 11:99181419-99181441 TATCCCACCCCCATTGGTATTGG + Intronic
1088456406 11:110036972-110036994 AACCCCACCCACATTATGTAGGG - Intergenic
1089123438 11:116159432-116159454 AAGCCCACCCACATTAAGAAGGG + Intergenic
1092688181 12:11074408-11074430 GACCTCACACCCATTAGGAGGGG - Intronic
1093956605 12:25227636-25227658 TACCACATACCCATTAGGATTGG + Intronic
1095154776 12:38839157-38839179 TAGGCCACCCCCAGTAGGAAGGG - Intronic
1096322510 12:50627764-50627786 TATCCCTCCCCCAGTAGGGATGG + Intronic
1097681925 12:62657175-62657197 TTCCCCACCCCCATGAGAGAGGG + Intronic
1098807443 12:75037430-75037452 TTGCCCACCCACATTAAGAAAGG - Intergenic
1099376421 12:81899888-81899910 TCCCACACCCTCATTAGGGAGGG + Intergenic
1102474025 12:113176995-113177017 TACACCCCCACCACTAGGAAGGG + Intronic
1104767276 12:131338300-131338322 TACCACACCCTTATTAGGGAGGG + Intergenic
1106491022 13:30222154-30222176 AGGCCCACCCACATTAGGAAGGG - Intronic
1107596590 13:41969318-41969340 AGGCCCACCCACATTAGGAAGGG + Intergenic
1111605425 13:90532635-90532657 TACCTCATCACCATGAGGAAAGG - Intergenic
1113190458 13:107739684-107739706 AACCCCAGGTCCATTAGGAACGG + Intronic
1113684750 13:112275217-112275239 AGGCCCACCCCCATTAGGGAGGG - Intergenic
1114069088 14:19094149-19094171 TACCCCATCCCCACTAGGACAGG + Intergenic
1114093172 14:19305854-19305876 TACCCCATCCCCACTAGGACAGG - Intergenic
1115632637 14:35260761-35260783 TAGCCCACCCCCTTTTTGAAGGG + Intronic
1120977612 14:90263113-90263135 AACCCCATCCCCATTTTGAAGGG + Intronic
1121465993 14:94115883-94115905 AACTCCACCCCCATTGGCAATGG - Exonic
1127491989 15:59473614-59473636 TCCCCCACCCCCGTAAGCAAAGG - Intronic
1127760952 15:62138746-62138768 ACCCCCAACCCCATCAGGAAAGG + Intergenic
1128521184 15:68375893-68375915 AGGCCCACCCACATTAGGAAGGG - Intronic
1128878490 15:71221932-71221954 CACCCCACACCCATTAGGATGGG - Intronic
1129036876 15:72655369-72655391 TCCCCCACCCCCAGGAGGAGTGG + Intronic
1129213011 15:74081856-74081878 TCCCCCACCCCCAGGAGGAGTGG - Intronic
1129397391 15:75259230-75259252 TCCCCCACCCCCAGGAGGAGTGG + Intronic
1129401000 15:75283507-75283529 TCCCCCACCCCCAGGAGGAGTGG + Intronic
1129474604 15:75776218-75776240 TCCCCCACCCCCAGGAGGAGTGG + Intergenic
1130976557 15:88780682-88780704 CACCTCACACCCATTAGGATGGG + Intergenic
1131055021 15:89370015-89370037 TACCCCACCTCCATTTTGAAAGG + Intergenic
1131822308 15:96285672-96285694 TCCCCCACCCCCAATGTGAAAGG + Intergenic
1131960975 15:97789901-97789923 TAGCTCACCTCCATTAGGAAGGG + Intergenic
1132319775 15:100917759-100917781 TACCCCACCCACCTCAGGAGGGG + Intergenic
1133418042 16:5621728-5621750 TGCCCCACCCTTATTAAGAATGG + Intergenic
1137726028 16:50657358-50657380 TACCCCAAGCCCAGCAGGAAGGG + Intergenic
1138362525 16:56443642-56443664 TACCCTTCCTCCATCAGGAATGG + Intronic
1143882158 17:10038028-10038050 TAGCTCACACCCATTAGGACAGG + Intronic
1146068822 17:29660221-29660243 GTCCCCACCCACAGTAGGAAGGG - Intronic
1146452260 17:32983908-32983930 TGGCCCACCCACATTAGGGAGGG + Intronic
1150178016 17:63082757-63082779 TACCCTACCCTCATTAACAAAGG - Intronic
1151334582 17:73432350-73432372 CCCCCCACCCCCGTAAGGAAGGG + Intronic
1152069962 17:78129512-78129534 CACCCCAAGCCCATTTGGAAGGG + Intronic
1152516194 17:80826251-80826273 TACCCCAGCCCCATTTTGATGGG + Intronic
1152996094 18:407621-407643 AAACCCACCCGCATTAGGGAAGG + Intronic
1153695611 18:7637920-7637942 TACCAAAACCCCATTAGGTAAGG - Intronic
1157857402 18:51115407-51115429 TCCCACACCCCTATTAGGGAAGG - Intergenic
1159380061 18:67644825-67644847 TAACCCACCACCATTATGACTGG + Intergenic
1161571276 19:5032073-5032095 TAGCCCACCCCGACCAGGAAGGG - Intronic
1162401619 19:10450256-10450278 TCCCCCACCCCCAGAAGGACTGG - Intronic
1163063138 19:14774489-14774511 AAACCCACCCCCATGAGGACAGG - Intronic
1167644384 19:50697761-50697783 TACCCCACCCCCATTAGGAAGGG + Intronic
926021709 2:9502453-9502475 GACCTCACGCACATTAGGAAGGG - Intronic
926625584 2:15086905-15086927 AGGCCCACCCACATTAGGAAGGG - Intergenic
931665049 2:64604482-64604504 TATCCCAGCCCCATCAGGATTGG + Intergenic
932764008 2:74458732-74458754 TCCCCCACCCCCAAAAGGAAGGG - Intronic
937675426 2:124584929-124584951 AAAGCCACCCCCATTAGTAAGGG - Intronic
938100723 2:128496335-128496357 AGGCCCACCCCCATTTGGAAGGG - Intergenic
938763492 2:134445228-134445250 GACCCCAGCCCCATCAGGCAGGG + Intronic
944350095 2:198716214-198716236 GACCCCTCTGCCATTAGGAAAGG + Intergenic
948335211 2:237202086-237202108 TACCCCACCCCCAGAAGGGCCGG - Intergenic
1175690096 20:61058782-61058804 CACCCCACTCCCATCAGGAAAGG + Intergenic
1178504116 21:33149389-33149411 TGGCCCAGCCTCATTAGGAAGGG + Intergenic
1180342827 22:11631137-11631159 TCCCCCATCCCCATCACGAATGG - Intergenic
1180487562 22:15816712-15816734 TACCCCATCCCCACTAGGACAGG + Intergenic
952653919 3:35760811-35760833 TGTCCCACCCACATTAGGATTGG + Intronic
953925510 3:46980502-46980524 CACCCCACCCCCATTCTGAGGGG + Intronic
954749429 3:52805289-52805311 TGCCCCACCTCCATTTGGACTGG + Intronic
955703767 3:61707594-61707616 GATCCCACCCACATTAGGGAGGG + Intronic
956536325 3:70280836-70280858 TGCCCCACACCCAGAAGGAAGGG + Intergenic
962467112 3:135670729-135670751 TATCCCACCCCGAATAGGGAGGG - Intergenic
963032738 3:140995055-140995077 TGGCCCACCCACATTAGGAAGGG + Intergenic
966906132 3:184527102-184527124 TGCCCCATCCCCAGAAGGAAAGG - Intronic
968907350 4:3460720-3460742 CACCCCGCCCCCATCAGGTAAGG - Intergenic
968922709 4:3530921-3530943 TCCCCCCTCCCCATGAGGAATGG - Intronic
971002333 4:22337328-22337350 TATCCCACCCCCATTGGTATTGG + Intergenic
971317742 4:25581420-25581442 CTCCCCACCCCCATTAGGCCTGG + Intergenic
972403078 4:38723281-38723303 TCCCCAACCCCCAGTAGGGAAGG - Intergenic
972922312 4:43959307-43959329 AGGCCCACCCACATTAGGAAGGG - Intergenic
978665705 4:111178494-111178516 TAGCCCACCCACATTGGGAAAGG - Intergenic
980749416 4:137069892-137069914 TGCACCACCCCCATCAGGGATGG - Intergenic
981407417 4:144387266-144387288 ATGCCCACCCCCATTAGGGAGGG - Intergenic
981456728 4:144961777-144961799 CACCCCACCCCCATTAACATGGG + Intergenic
982342297 4:154313180-154313202 TCCCCCACTCCCAAGAGGAAAGG - Intronic
983250498 4:165340018-165340040 AAGCCCACCCTCATTATGAAGGG + Intronic
984939656 4:184919952-184919974 TCCCACACCCTTATTAGGAAGGG - Intergenic
989161726 5:38397785-38397807 TACCCCCACCCCATGAGCAAAGG + Intronic
991234686 5:64379900-64379922 TAGCCCACCCACATTATGGAAGG + Intergenic
997230640 5:132239844-132239866 CACCCCACCACCATTGGGACTGG + Intronic
999726254 5:154440721-154440743 TTCCCCTCCCCCGTTAGGTATGG + Intergenic
1004308259 6:14520852-14520874 AGGCCCACCTCCATTAGGAAAGG + Intergenic
1005321836 6:24663217-24663239 TACAACAACCCCATGAGGAAGGG + Intronic
1006248274 6:32758963-32758985 TCCACCTCCCTCATTAGGAATGG - Exonic
1007385808 6:41519576-41519598 CACCCCACCCCCAACAGGCAGGG + Intergenic
1009581182 6:65535750-65535772 ATGCCCACCCACATTAGGAAAGG + Intronic
1013222214 6:108088468-108088490 AAGCCCACCCACACTAGGAAAGG - Intronic
1019087537 6:169494220-169494242 AGGCCCACCCCCATTAGGGACGG - Intronic
1019113579 6:169738322-169738344 TACCCAATTCCCATGAGGAAGGG - Intergenic
1023849078 7:44140422-44140444 TGCCCCACCCCCACCAGGGAAGG - Exonic
1024000543 7:45186502-45186524 TCCTCCACCCCCATGAGGCAGGG - Intergenic
1024606174 7:51024386-51024408 CTCCCCACACCCACTAGGAATGG + Intronic
1024715159 7:52071252-52071274 AGCCCCACCCACATTGGGAAGGG - Intergenic
1025260190 7:57413392-57413414 CAGCCCACCCCCCTTGGGAAGGG + Intergenic
1027414075 7:77955942-77955964 CACCCCACCCCCATTATATAAGG + Exonic
1030171752 7:106609701-106609723 GAGCCCACCCACATTAGGGAGGG + Intergenic
1030700426 7:112632379-112632401 TTCCCCACTGCCATTAAGAATGG - Intergenic
1031043691 7:116863596-116863618 TACCCCACCACCCTCGGGAATGG - Intronic
1031865641 7:127036279-127036301 TACCCCACTTCCATTAAGAAGGG - Intronic
1033625210 7:143104441-143104463 GACCCCACCCCCATTGGCCAAGG + Intergenic
1034336049 7:150324213-150324235 TACTCCACCCCCACCAGGCAGGG - Intronic
1034937690 7:155210390-155210412 CCACCCACCCCCATGAGGAAGGG - Intergenic
1037724696 8:21473463-21473485 GACCTCACCCCCATCAGGAGAGG - Intergenic
1038111635 8:24506170-24506192 TAGCCCACCACCAAGAGGAAGGG - Intronic
1038662070 8:29506064-29506086 TGGCCCTCACCCATTAGGAATGG - Intergenic
1040599654 8:48870850-48870872 CCCCCCACCCACATTTGGAAAGG + Intergenic
1040646855 8:49407888-49407910 TAACCCACCCACATTATGGAAGG + Intergenic
1041082460 8:54226575-54226597 CGCCCCACCCCAATGAGGAAAGG + Intergenic
1041233876 8:55779395-55779417 TACCTCTCACCCATGAGGAAAGG + Intronic
1042098712 8:65248793-65248815 TTCCCTGCCTCCATTAGGAAGGG + Intergenic
1051451884 9:17206173-17206195 TACCCCACCCCCATTGGTATCGG - Intronic
1055867324 9:80830742-80830764 AAGCCCACCCACATTAGGGAAGG + Intergenic
1056219171 9:84434446-84434468 AACCCAAGCCCCATTAGGAATGG - Intergenic
1057057558 9:91975452-91975474 AGGCCCACCCCCATTATGAAGGG + Intergenic
1057819658 9:98321399-98321421 TACCCCACCCTCAGCAGGATGGG + Intronic
1061720149 9:132546380-132546402 CACCCCGGCCCCATTATGAAGGG + Intronic
1061944385 9:133900566-133900588 TGCCCCACACCCAGAAGGAAGGG + Intronic
1203360934 Un_KI270442v1:218710-218732 TCCCCCATCCCCATCACGAATGG + Intergenic
1187815825 X:23230721-23230743 TACCCCTCACACATTAGAAAAGG - Intergenic
1188770327 X:34146889-34146911 AAGCCCACCCACATTAGGGAGGG - Intergenic
1193098157 X:77577302-77577324 CACCACACACCCATTAGGATGGG - Intronic
1197675267 X:129323198-129323220 TCCCCCAGCCCCATTACAAAGGG + Intergenic
1198579256 X:138045763-138045785 TCCCCCACCCCCAGTAAGAGTGG + Intergenic
1201515854 Y:14818269-14818291 TCCCACACCCTTATTAGGAAGGG - Intronic