ID: 1167644589

View in Genome Browser
Species Human (GRCh38)
Location 19:50698934-50698956
Sequence GTAGGCACAAGGGTTGAACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 55}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167644589 Original CRISPR GTAGGCACAAGGGTTGAACG AGG (reversed) Intronic
906775205 1:48523024-48523046 GTAGGCAAGTGGGTTGAAGGGGG + Intergenic
914323969 1:146592937-146592959 GGAGGCACAAGGGCTTAAGGGGG - Intergenic
920301044 1:204989228-204989250 GAAGGCACATGGGTTCAAGGAGG + Intronic
1070063402 10:73008902-73008924 GTAGATACAAGGGTTGAAGAAGG - Intronic
1077992535 11:7424785-7424807 GTATGCACAAAGGTTGAGCTTGG - Intronic
1083470232 11:62879548-62879570 CTAGGAACAAGGGGTGCACGGGG - Intronic
1088537431 11:110876326-110876348 GGAGGCACCAGGGTTGCACTAGG + Intergenic
1091413825 12:262921-262943 GGAGGCACAAGGGTGGAATGTGG - Intergenic
1093144209 12:15544943-15544965 TTAGGCAGAAGAGTTGAAGGAGG - Intronic
1098991638 12:77070127-77070149 GTAGGCACAGAGGTTTAAAGGGG + Intergenic
1101068766 12:101050819-101050841 GAAGCCACAAGGGTTGAAAGGGG + Intronic
1121235946 14:92391344-92391366 GTTGGCACAAGGGTTGGGCTGGG - Intronic
1122293812 14:100693919-100693941 GTACGCAGAAGGGGTGGACGGGG - Intergenic
1133376841 16:5294133-5294155 GTAGGAAAATGGGTTGAACCTGG + Intergenic
1140009592 16:71117906-71117928 GGAGGCACAAGGGCTTAAGGGGG + Intronic
1144162908 17:12579034-12579056 CTAGGCACAAGAGTTGAGCCTGG + Intergenic
1151458054 17:74238357-74238379 GGAGGCACAAGGGAGGAATGAGG + Intronic
1152990195 18:356399-356421 GTAGGATCAAGGCTTGAACTTGG + Intronic
1158040681 18:53089414-53089436 GTAGACACAAGGCATGAAAGAGG - Intronic
1160137034 18:76281263-76281285 ACAGGCTCAAGGGATGAACGAGG - Intergenic
1164179309 19:22806051-22806073 GTAGGCACAGGGGTGGGATGGGG + Intergenic
1167644589 19:50698934-50698956 GTAGGCACAAGGGTTGAACGAGG - Intronic
926316593 2:11714754-11714776 GTAGCCACAAGGCTTGGACCAGG - Intronic
934484272 2:94688182-94688204 GTTGGCAAAGGTGTTGAACGTGG - Intergenic
938977128 2:136490493-136490515 GTTTGTACAAGGGTTGAATGTGG + Intergenic
939289401 2:140174080-140174102 GTAGGGACCAGGGTTGGAGGTGG + Intergenic
941681264 2:168401794-168401816 GCAGACACCAGGGTTGAAGGTGG - Intergenic
1169864652 20:10186930-10186952 AATGGCACAAGGGTTGAACAAGG - Intergenic
1170823369 20:19772820-19772842 GTAGTCACAAAGCTTGAAAGTGG + Intergenic
1178701052 21:34834459-34834481 GGAGGCACGAGGGTTGGGCGTGG + Exonic
1184422917 22:44392199-44392221 GTTGGCAGATGGGTTGAAGGAGG + Intergenic
951511386 3:23506611-23506633 GAAGGGACAAGGGTGGAACCAGG - Intronic
957065452 3:75518383-75518405 GTAGGAAAATGGGTTGAACCCGG - Intergenic
959663873 3:108900187-108900209 GGAGGGACAAGGGTTGAAGTGGG + Intergenic
967531645 3:190554416-190554438 GTCTGCACACTGGTTGAACGGGG - Intronic
969010037 4:4054475-4054497 GTAGGAAAATGGGTTGAACCCGG - Intergenic
969744196 4:9056772-9056794 GTAGGAAAATGGGTTGAACCCGG + Intergenic
993549370 5:89254993-89255015 GTTGGCACAAGTGATGAACAAGG + Intergenic
997402884 5:133616162-133616184 ATAGGCAAAAGGGATGAAAGAGG + Intergenic
1009161562 6:60289192-60289214 GCAGGCACAAGGGGTGAATTTGG + Intergenic
1017681094 6:156864613-156864635 GCAGCTACAAGGGTTGAAAGTGG - Intronic
1021020799 7:15596141-15596163 GTTGGCACAAAGGTTGAAATTGG - Intergenic
1029069134 7:97881032-97881054 GTAGGAAAATGGGTTGAACCCGG - Intergenic
1033967471 7:146993630-146993652 GTAGTAACAAGGCTTGAGCGGGG - Intronic
1036884842 8:12544425-12544447 GTAGGAAAATGGGTTGAACCCGG - Intergenic
1037677641 8:21065570-21065592 GAAGGCACCAGGTTTGAATGGGG + Intergenic
1039781102 8:40786658-40786680 GGAGGCACAAGGACTGAATGAGG - Intronic
1043921287 8:85986543-85986565 GTAGGCAAAAGTGTTAAATGTGG - Intergenic
1044354694 8:91207516-91207538 GTAGGCACCAGGGTTAAACCAGG - Intronic
1046673711 8:117085794-117085816 GTAGACCCAAGAGTTGAACTAGG + Intronic
1048306068 8:133285618-133285640 GTTGGCACAAGGGATGGACCCGG - Intronic
1050702272 9:8353748-8353770 GTAGGCAAAAGGGTTAGAAGAGG - Intronic
1053673515 9:40396212-40396234 GTAGGCAAAGGTGTTGAACGTGG + Intergenic
1053923321 9:43022571-43022593 GTTGGCAAAGGTGTTGAACGTGG + Intergenic
1054384616 9:64536277-64536299 GTAGGCAAAGGTGTTGAACGTGG + Intergenic
1054511114 9:65980077-65980099 GTAGGCAAAGGTGTTGAACGTGG - Intergenic
1054804628 9:69385845-69385867 GGACGCACCAGGGTTGAACTGGG - Exonic
1055716282 9:79121617-79121639 GTGAGCACAGGGGTTGAAAGTGG - Intergenic
1060000703 9:119956019-119956041 GAAGGCACAAGGCTTGCAGGAGG + Intergenic
1188152016 X:26688311-26688333 ATAGGCAAAAGGATTGAACAGGG + Intergenic
1189829116 X:44952561-44952583 GTCAGCAGAGGGGTTGAACGCGG - Intronic
1192285331 X:69728929-69728951 GTAGGGATAAGGGTTTAATGGGG + Intronic