ID: 1167646536

View in Genome Browser
Species Human (GRCh38)
Location 19:50708802-50708824
Sequence CACTCAACAAAGATGGAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 150}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167646531_1167646536 30 Left 1167646531 19:50708749-50708771 CCAAGAGGGCTGACCCCATCATT 0: 1
1: 0
2: 0
3: 15
4: 117
Right 1167646536 19:50708802-50708824 CACTCAACAAAGATGGAACTAGG 0: 1
1: 0
2: 3
3: 13
4: 150
1167646533_1167646536 16 Left 1167646533 19:50708763-50708785 CCCATCATTCATTCACTCATTTT No data
Right 1167646536 19:50708802-50708824 CACTCAACAAAGATGGAACTAGG 0: 1
1: 0
2: 3
3: 13
4: 150
1167646532_1167646536 17 Left 1167646532 19:50708762-50708784 CCCCATCATTCATTCACTCATTT 0: 1
1: 5
2: 31
3: 201
4: 1125
Right 1167646536 19:50708802-50708824 CACTCAACAAAGATGGAACTAGG 0: 1
1: 0
2: 3
3: 13
4: 150
1167646534_1167646536 15 Left 1167646534 19:50708764-50708786 CCATCATTCATTCACTCATTTTC 0: 1
1: 1
2: 32
3: 188
4: 1335
Right 1167646536 19:50708802-50708824 CACTCAACAAAGATGGAACTAGG 0: 1
1: 0
2: 3
3: 13
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167646536 Original CRISPR CACTCAACAAAGATGGAACT AGG Intronic
901361220 1:8702925-8702947 GACCCTAGAAAGATGGAACTCGG - Intronic
904189618 1:28733517-28733539 CCCTGAACAAGGAAGGAACTTGG - Intergenic
910289873 1:85589324-85589346 GACTCAACACAGATGGTACTAGG + Intergenic
914248517 1:145903236-145903258 CATTCAACAAATATTGCACTTGG + Intronic
914784462 1:150816114-150816136 CTCTCAACAAAGATGGAAATTGG + Intronic
917040975 1:170806015-170806037 AAATCAAAAAAGATGGAACAAGG + Intergenic
918206672 1:182315632-182315654 AACTCAAAACAGATGGAACAGGG + Intergenic
919207786 1:194439293-194439315 CACTCTACAAAGACTGAACTAGG + Intergenic
919278990 1:195462152-195462174 CATTCAACAAAGATTTAACTTGG + Intergenic
920665105 1:207957900-207957922 CACACAACAATGAAGGTACTCGG + Intergenic
920934847 1:210422548-210422570 GAGGCAACAAAGATGGAACTGGG - Intronic
923062708 1:230490543-230490565 CACACACCAAATATGGAGCTGGG + Intergenic
923972009 1:239214372-239214394 CACTCGACAAAGATTGATGTAGG + Intergenic
924770722 1:247077466-247077488 CACTCAAAAAAGATAAAATTAGG + Intronic
1065203342 10:23334886-23334908 CTTTCAAAAAAGATGGAAATAGG + Intronic
1069594143 10:69659732-69659754 CACTCAACAAGCATGAAACTCGG + Intergenic
1074324194 10:112431867-112431889 CACTGAAAACAGATGGAGCTAGG - Intronic
1074953402 10:118363521-118363543 AACTCACCCAAGTTGGAACTAGG - Intergenic
1075763278 10:124872655-124872677 CTGTCAACAAAGCTGGGACTTGG + Intergenic
1075934203 10:126325626-126325648 CACTCAAGGAAGCTGGAAATTGG + Intronic
1079901439 11:26191538-26191560 TAGTGAACAAAGATGGAAATGGG - Intergenic
1081239934 11:40692720-40692742 CAATCAACAAAGAAGGAAAAAGG - Intronic
1085374124 11:76042580-76042602 CACTCAACAGTGATGGATTTAGG + Intronic
1087557768 11:99744403-99744425 CACTAAACAATGTTGGGACTGGG + Intronic
1094285612 12:28789734-28789756 CACTGAACTAAGATGGAACTGGG + Intergenic
1108367636 13:49731763-49731785 CACTAAACAAAAATGGAAATAGG + Intronic
1109822355 13:67674486-67674508 AACTCAACAAATATTGAGCTAGG + Intergenic
1111241555 13:85481754-85481776 CACTCAACCAATGAGGAACTAGG - Intergenic
1111433485 13:88176209-88176231 CTCTCAGCAAAGAAAGAACTGGG + Intergenic
1116374378 14:44179806-44179828 CACTCAAGAAAAGTGGAAGTTGG + Intergenic
1116684550 14:48020756-48020778 CACCCAACAAAGAAAGAACTTGG + Intergenic
1117823092 14:59671810-59671832 CACTCTACAGAGCTGGACCTGGG + Intronic
1119615957 14:76099366-76099388 CACTCAACACAGGTAGAACAAGG + Intergenic
1119940504 14:78636060-78636082 CGCTCAACAAATATTGAAATAGG - Intronic
1120799489 14:88672816-88672838 CACTCTCCAAAGACGGAACCAGG + Intronic
1121373467 14:93382703-93382725 CACTCACTAAATATGGACCTTGG - Intronic
1123813433 15:23952748-23952770 CACTCACCAAAAAAGGAACTAGG - Intergenic
1123834497 15:24174886-24174908 CATTCACCAAAAAAGGAACTAGG - Intergenic
1124823074 15:33067050-33067072 CACTGAAAAAAGCTGGAAGTTGG + Intronic
1125545568 15:40501731-40501753 CAATCAGCAAAGAGAGAACTTGG + Intergenic
1127294328 15:57596509-57596531 CACTCACCAAAGAGGGAAAGAGG - Intronic
1128135511 15:65260340-65260362 CACACTGCAGAGATGGAACTAGG + Intronic
1131815000 15:96212905-96212927 CACTCAACAAAGCTGGTAGAAGG + Intergenic
1134356943 16:13491208-13491230 CCCTCTACAAAGATGCTACTGGG + Intergenic
1140548633 16:75838010-75838032 CACTCAGCACTGATGAAACTTGG - Intergenic
1141829819 16:86503996-86504018 CACTTAGCACAGATGGGACTGGG - Intergenic
1142680289 17:1543662-1543684 CACTCTACAAACATGGCAGTGGG - Intronic
1143085356 17:4412129-4412151 CACACATCAAAGGTGGAAATGGG - Intergenic
1146946000 17:36874037-36874059 CCCTCCACAGAGATGAAACTGGG + Intergenic
1149173800 17:53845116-53845138 CTCTCAACAGAGAGGGAAATGGG + Intergenic
1149595293 17:57861690-57861712 CACTCAACAGACATGGGGCTGGG + Exonic
1151076141 17:71274784-71274806 CACTCAACCATGGTGGAAATGGG - Intergenic
1155958486 18:31974178-31974200 CACTGAACAAAGAAGGGAATGGG + Intergenic
1156001417 18:32388859-32388881 CAATCAACAAAACTGGAACATGG + Intronic
1156993714 18:43440538-43440560 CTCTCAGCAAAGAGGGGACTTGG - Intergenic
1158279707 18:55810595-55810617 CACTGCCCAAAAATGGAACTAGG - Intergenic
1160900346 19:1424771-1424793 CACAGAACAAAGATGGACATGGG - Intronic
1161665794 19:5575612-5575634 CCCTCCAGAAAGATGGGACTTGG - Intergenic
1163712127 19:18853151-18853173 CACTTTACAAGGGTGGAACTAGG - Intronic
1167188777 19:47967831-47967853 CAAGCAACACAGATGGAAGTAGG - Intergenic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
1167646536 19:50708802-50708824 CACTCAACAAAGATGGAACTAGG + Intronic
927200636 2:20575972-20575994 AACAAAACAAAGATGGAAATGGG - Intronic
934607476 2:95708109-95708131 CACTCAACCCAAATGGTACTGGG + Intergenic
935387881 2:102520269-102520291 CACAGAACAAAGATGGCACCAGG + Intronic
935794238 2:106625554-106625576 CACTCAACAGTGCTTGAACTTGG + Intergenic
936026256 2:109033315-109033337 CACTCAAAAAGGAGGGGACTGGG - Intergenic
937182593 2:120009988-120010010 CTCCTATCAAAGATGGAACTGGG - Intergenic
937718761 2:125065550-125065572 TACTCAACAAAGATGAAAGAAGG - Intergenic
938254051 2:129840354-129840376 CACTCAACAAAGATTGAAAGTGG + Intergenic
938297678 2:130188582-130188604 GACTCAACAAAGATGGAGTCAGG - Intronic
939922743 2:148137060-148137082 GACTCAATTAAGAAGGAACTGGG - Intronic
940102604 2:150059003-150059025 TACTTAACAAAGATGGCACTTGG - Intergenic
945369437 2:208998907-208998929 AACTCAACAATTATGGATCTTGG + Intergenic
945987987 2:216370509-216370531 CACTGAACAAAGTTGGAGGTTGG - Exonic
948947091 2:241226216-241226238 CACCAAGCAGAGATGGAACTGGG + Intergenic
1168990568 20:2092248-2092270 CACTAAAAAGCGATGGAACTTGG - Intergenic
1169020088 20:2324409-2324431 CACTCAACAAACAAAGAACCAGG - Intronic
1169467038 20:5850485-5850507 AACTAAAAAAAGCTGGAACTGGG - Intronic
1170617025 20:17961892-17961914 CACTTAACAAATATTGGACTAGG - Intronic
1172190854 20:33061069-33061091 TACCCAACAAAGATGGAGCAGGG - Intronic
1173335011 20:42105530-42105552 CACTCAACAAACATTTATCTGGG - Intronic
1176025759 20:62984802-62984824 CACTCAACAAAGCTGGATCTTGG + Intergenic
1179006947 21:37523419-37523441 CCCTGAACAAAGGTGGAAGTAGG + Intergenic
1181972120 22:26698801-26698823 TATTCAACAAAAATGGAACCAGG - Intergenic
1182750345 22:32636626-32636648 CACTCAGTATAGTTGGAACTGGG + Intronic
949194334 3:1287445-1287467 CACCCATAAAAGATGGAAATTGG + Intronic
950451011 3:13065739-13065761 CACCCAACAGAAATGGAACCAGG + Intronic
950667421 3:14505849-14505871 CACTCAGCACAGCTGGAAATGGG - Intronic
954653354 3:52178650-52178672 CCCTCAACAAAGAGGGAGCATGG + Intergenic
956401523 3:68884584-68884606 CACTGGACAAAAATGGAAGTTGG + Intronic
958145027 3:89613049-89613071 CATTCAGCAAACATGAAACTAGG - Intergenic
958655148 3:96991824-96991846 CACACAACACACATGGAACAGGG + Intronic
961369730 3:126422123-126422145 CACTCAGCCAAGAGGGAACATGG + Intronic
965297063 3:166961106-166961128 CAGACAAAAAAGATGGAATTTGG - Intergenic
966046512 3:175557699-175557721 CAAACAACATTGATGGAACTGGG - Intronic
969918870 4:10517896-10517918 CATTCAACAAAGATACAACCAGG - Intronic
971409719 4:26357430-26357452 CACTTAACGAAGATAGAAATAGG + Intronic
971893980 4:32565693-32565715 CAGTCTGCAAAGATGGCACTAGG - Intergenic
972883447 4:43455056-43455078 GAGACAACATAGATGGAACTGGG + Intergenic
974476893 4:62393754-62393776 CACTCACCAAAAAGGCAACTTGG - Intergenic
976641293 4:87341492-87341514 TACACAACAAAGATGTAACATGG - Intronic
976736770 4:88318076-88318098 CACTCAATAAAGATTCAAGTGGG - Intergenic
979995251 4:127424810-127424832 CACTGAAGAAAGTAGGAACTGGG + Intergenic
981145342 4:141317499-141317521 CACTCACCAAAAATGGAAAGAGG - Intergenic
982011190 4:151107773-151107795 TATTCAACAAATATTGAACTAGG - Intronic
985225584 4:187757847-187757869 CACTCAAGAAAGAAGAAAATGGG - Intergenic
987044142 5:14090760-14090782 CACCCAACAAATATGGAATAGGG - Intergenic
987441254 5:17959853-17959875 AACTAAACAAAAATGGAAATGGG + Intergenic
988497271 5:31756126-31756148 CACTCAGAAAGGATGGAACGGGG + Intronic
989206097 5:38810019-38810041 TACTTAAGAAAGATGGAGCTGGG + Intergenic
989781111 5:45265715-45265737 AACTCAAAAAAGATGGGGCTGGG - Intronic
991111597 5:62905850-62905872 CAATCCATAAAGATGGAATTTGG - Intergenic
994546374 5:101171860-101171882 AACTCTACCAAGATGGAACAAGG + Intergenic
996339887 5:122424971-122424993 CATTCAACAAACATAGAACAGGG + Intronic
996621559 5:125510333-125510355 AACCCAACAAACATTGAACTAGG - Intergenic
1003343818 6:5246723-5246745 GCCACAACAAAGCTGGAACTGGG - Intronic
1007066233 6:38992734-38992756 CTCTCAAGAAAGATGAAACAGGG + Intronic
1008530173 6:52449538-52449560 CACTCACCCAAGACTGAACTAGG - Intronic
1009419257 6:63446569-63446591 CACTCAACAAACATTGTATTGGG - Intergenic
1012739091 6:102991301-102991323 TAAACAACATAGATGGAACTGGG + Intergenic
1013357249 6:109356904-109356926 AACAGAACACAGATGGAACTTGG + Intergenic
1013648116 6:112165392-112165414 CACACAGCAAGGATGGAGCTGGG - Intronic
1015313646 6:131793047-131793069 CACACAAAAAAGATGCAACCAGG - Intergenic
1017280605 6:152620269-152620291 CACTCAACACTGAGGGAAGTGGG - Intronic
1018736871 6:166693508-166693530 CAGTCCACAAATATGGAACAGGG - Intronic
1019200285 6:170308181-170308203 CACTCACTAATGATGGAGCTGGG - Intronic
1019855825 7:3606372-3606394 CACTCAACCCTGATGCAACTGGG - Intronic
1022018280 7:26373677-26373699 CATTCAACATGGATGAAACTTGG - Exonic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1026381774 7:69807262-69807284 CACTCAACAAATCTGGATCTTGG - Intronic
1030733145 7:113013952-113013974 CAGTCTACAAAGATTGAAATAGG - Intergenic
1034867447 7:154654348-154654370 CACTCACTAAAGATGGATCGGGG - Intronic
1038471513 8:27827212-27827234 CACTTAATAAACATGAAACTAGG + Intronic
1038777456 8:30543852-30543874 CACTCCACAAAGATGTAAACAGG - Intronic
1039100676 8:33938773-33938795 CATTCAAGAAAGAGGCAACTTGG - Intergenic
1039328051 8:36506342-36506364 GACTCTACAAAGCTGGAGCTGGG + Intergenic
1042426557 8:68655847-68655869 CATTCTAGAAAGATGGAAATAGG - Intronic
1042898743 8:73699597-73699619 CACCCTACAAAGATTGAACCCGG + Intronic
1044779113 8:95724872-95724894 CACTGAACCAAGAGGGAATTTGG - Intergenic
1044997743 8:97853336-97853358 CACCCAAGAAAGATGGAAACTGG + Intergenic
1046745905 8:117875694-117875716 CTCTCCCCAAAGATGGTACTTGG - Intronic
1046969713 8:120208380-120208402 CACTCTACAAAGTTAGAAGTGGG - Intronic
1047024277 8:120810403-120810425 CATTCAACAATGAGGGGACTGGG + Intronic
1049947764 9:614352-614374 CACTCCTCAAAGATGGAAATGGG - Intronic
1050346227 9:4690935-4690957 CACTCTCCACTGATGGAACTTGG - Intronic
1051943792 9:22541216-22541238 GACTCAACAAAGATGGTGGTAGG + Intergenic
1053592429 9:39527740-39527762 CACTCAACCAATGAGGAACTTGG + Intergenic
1053850277 9:42283082-42283104 CACTCAACCAATGAGGAACTTGG + Intergenic
1054573872 9:66837539-66837561 CACTCAACCAATGAGGAACTTGG - Intergenic
1055891316 9:81127012-81127034 GTCTCCACAAAAATGGAACTGGG - Intergenic
1056197636 9:84243931-84243953 CATTTTACAAAGAGGGAACTGGG - Intergenic
1058735390 9:107889415-107889437 TACTCAACCAATAAGGAACTGGG - Intergenic
1058785646 9:108384181-108384203 TACTCAACAAATATTGAATTAGG + Intergenic
1060453162 9:123762859-123762881 CACTCAAGAAACAGGGCACTGGG + Intronic
1061206501 9:129167014-129167036 CCCTCAGCAAAGACGGAACATGG - Intergenic
1185782140 X:2857945-2857967 CCCTGAACACAGATGGAGCTAGG + Intronic
1185866054 X:3624971-3624993 CACTCAACTCAGATGGGATTTGG + Intronic
1187415210 X:19087250-19087272 CATTCAACAAACATTTAACTGGG + Intronic
1188391028 X:29619527-29619549 CACTCAAAAAAGATGCAGATGGG - Intronic
1190065722 X:47240603-47240625 CCCGCAAGAAAGATGGCACTTGG + Exonic
1191221789 X:57997392-57997414 CACTCTTCAAAGATTGAACCAGG - Intergenic
1194252156 X:91589230-91589252 CACCCTCCAAAGATGGAACCAGG + Intergenic
1195416426 X:104624887-104624909 CACTAAATATAGATGGCACTTGG + Intronic
1196485778 X:116204990-116205012 CTCTCAAAAAAGCTGGAACTCGG - Intergenic
1200571087 Y:4830469-4830491 CACCCTCCAAAGATGGAACCAGG + Intergenic
1200797770 Y:7357356-7357378 CACTCAACTCAGATGGGATTTGG - Intergenic