ID: 1167647979

View in Genome Browser
Species Human (GRCh38)
Location 19:50716084-50716106
Sequence CTGGTCAGAAGCAGAACAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 320}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167647977_1167647979 -9 Left 1167647977 19:50716070-50716092 CCAAGGCCACTTAGCTGGTCAGA 0: 1
1: 0
2: 4
3: 63
4: 448
Right 1167647979 19:50716084-50716106 CTGGTCAGAAGCAGAACAGATGG 0: 1
1: 0
2: 3
3: 30
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167647979 Original CRISPR CTGGTCAGAAGCAGAACAGA TGG Intronic
900857628 1:5198743-5198765 CTAGTGATAAGCAGAAAAGAGGG + Intergenic
903098171 1:21000758-21000780 ATGGTCACTAGCAGAGCAGATGG + Intronic
903227954 1:21904472-21904494 CGGGTCAGCAGCACAACTGAGGG - Intronic
903338162 1:22638424-22638446 CTAGTCCAAAGCAGACCAGAAGG + Intronic
904874485 1:33643766-33643788 ATAGGCAGAAGCAGACCAGAGGG + Intronic
904876367 1:33657635-33657657 CAGGTCAGAAGGAGGACAGTGGG - Intronic
906002628 1:42440026-42440048 CTGCCCAAAAGCAGAAAAGAAGG + Intronic
908647186 1:66290821-66290843 CTGCTCAGAAGCAGAAACCATGG + Intronic
909700985 1:78522661-78522683 CTAGTGATAAGCAGAAAAGAGGG + Intronic
910055118 1:83024482-83024504 CTGGTAACAAGTACAACAGAGGG + Intergenic
910256468 1:85253112-85253134 CTAGTGATAAGCAGAAAAGAAGG + Intronic
911191629 1:94954564-94954586 CTAGTCAACAGCAGAAGAGACGG - Intergenic
911705894 1:101012332-101012354 CTAGTGATAAGCAGAAAAGAGGG + Intronic
914829716 1:151161744-151161766 CTGCTCAGAAGCTGAAAAAAGGG - Exonic
914967269 1:152271175-152271197 CTCTTCAGAAGCTGAACAGATGG - Intergenic
914969099 1:152290938-152290960 CTCTTCAGAAGCTGAACAGATGG + Intergenic
917014500 1:170514180-170514202 CTTTTCAGAACCAAAACAGAGGG - Intergenic
919647946 1:200114806-200114828 CTAGTAAGTGGCAGAACAGATGG + Intronic
919985669 1:202672687-202672709 CTTGGCAGAAGCAGAATAAAGGG + Intronic
920681051 1:208073002-208073024 CTGGTTAGTGGCAGAGCAGAAGG - Intronic
921099066 1:211912561-211912583 CTGGTCTGCAGGAGAACAGGGGG + Intergenic
921139505 1:212292997-212293019 CTAGTGATAAGCAGAAAAGAAGG - Intronic
921344989 1:214174406-214174428 CTGCTCAGAAACAGAAGAAATGG + Intergenic
921889265 1:220337388-220337410 TTGGTCAGCAGCAGGACAGCAGG - Intergenic
921916369 1:220615358-220615380 CTGATCAGCAACAGAAAAGAGGG - Intronic
924073510 1:240308499-240308521 CTAGTGATAAGCAGAAAAGAGGG + Intronic
924858146 1:247895568-247895590 CTGTTCAGCAGCAGTAGAGATGG + Exonic
1064078189 10:12287060-12287082 CTGGTCAGAAGCACCTCAGGAGG + Intergenic
1066457769 10:35586569-35586591 CAGATCAGAAGCAGAACTGGTGG - Intergenic
1066638958 10:37536457-37536479 CTAGTGATAAGCAGAAAAGACGG + Intergenic
1069713613 10:70506813-70506835 CAGGTCAGAAGGAAGACAGAGGG - Intronic
1070706159 10:78640330-78640352 CTGGTCAGAGGCAGGAAAGGTGG - Intergenic
1071133046 10:82417867-82417889 CTGATCAGAAAGAGGACAGAAGG + Intronic
1072117709 10:92379821-92379843 TTGGGCAGTAGCAGAACAGTGGG - Intergenic
1072188846 10:93064741-93064763 CTTGTCAGTAGGAGAACTGAAGG + Intronic
1072572757 10:96673064-96673086 CTGGTTAGCAGAAGAACAGAAGG + Intronic
1072679576 10:97497627-97497649 CTGGTCAAAAGCAGGAAAGTGGG + Intronic
1072766279 10:98097415-98097437 CTGGTGGGACGCAGGACAGAAGG - Intergenic
1074550186 10:114435566-114435588 CTGTTCAAAAGCAAAAGAGAAGG - Intronic
1074881880 10:117666037-117666059 CTCCCCAGAAGCAGAGCAGATGG - Intergenic
1075336556 10:121613108-121613130 CTGGCTAGAGGCAGAAGAGATGG - Intergenic
1076494212 10:130886234-130886256 CTGGTCAGTTGCAGAAATGAAGG - Intergenic
1076610516 10:131723173-131723195 CTGGTGCGGAGCAGGACAGAAGG + Intergenic
1076689253 10:132212916-132212938 CTGGCCTGGAGCAGAACTGATGG + Intronic
1077385108 11:2265733-2265755 CTAGTGATAAGCAGAAAAGAGGG - Intergenic
1077537188 11:3130018-3130040 CTGGTGGGGAGCAGGACAGAGGG - Intronic
1078593442 11:12665821-12665843 CTGGTTAGAAGCAGAGAGGAGGG + Intergenic
1079294435 11:19219677-19219699 CTAGTGATAAGCAGAAAAGAGGG + Intergenic
1080311258 11:30895379-30895401 CTAGTCTGAGGCACAACAGAAGG + Intronic
1080574254 11:33583891-33583913 TTGGTAAGTAGCAGAACTGATGG + Intronic
1083776630 11:64897345-64897367 CCAGTCAGGACCAGAACAGAAGG + Intronic
1085758442 11:79221077-79221099 CTGGACAGAATCAGACCAGGTGG + Intronic
1086160908 11:83720807-83720829 CTGGTGAGCAGCAGAAGAGAGGG - Intronic
1086897673 11:92332548-92332570 CTAGTGATAAGCAGAAGAGAGGG + Intergenic
1089411746 11:118249199-118249221 CTGGAAAGAAGCACAAAAGAAGG + Intronic
1089492591 11:118893200-118893222 CTGCTCAGAACTGGAACAGATGG + Intronic
1090237327 11:125158882-125158904 GTCGGCAGAAGCAGAAGAGATGG + Intergenic
1090324590 11:125874023-125874045 AGGATCAGAATCAGAACAGAAGG + Intergenic
1090446347 11:126768011-126768033 CATTTCAGAAGCAGAACACAGGG - Intronic
1090924027 11:131234058-131234080 GTGGTCAGAAGCAGAATGGCAGG - Intergenic
1091072859 11:132585237-132585259 CTGGGAAGTAGCAGAACAGAGGG + Intronic
1091710748 12:2738302-2738324 TGGGTCAGAAGCAAGACAGAGGG + Intergenic
1092870842 12:12804508-12804530 GTGGTTAGGAGCAGCACAGAGGG - Intronic
1093569971 12:20655530-20655552 CTAGTGATAAGCAGAACAGTGGG - Intronic
1094491821 12:30965483-30965505 CTCCACAGAAGCAGGACAGATGG - Intronic
1095154888 12:38840746-38840768 CTGGTCAAAACCAGAACATATGG - Intronic
1095508902 12:42928010-42928032 CTGGGCAGAAGAAGAACTGGGGG + Intergenic
1096417124 12:51424316-51424338 CAAGTCAGAAGCAAAACACACGG - Intronic
1096850392 12:54432005-54432027 CTGGTCAGCAGCAGGAGAGAAGG + Intergenic
1098239170 12:68448864-68448886 CTAGTAATAAGCAGAAAAGAGGG + Intergenic
1098353918 12:69591807-69591829 CTAGTGATAAGCAGAAAAGAGGG - Intronic
1099206797 12:79737782-79737804 CTGGTGGGAAGCAGAGCAAAAGG + Intergenic
1099607173 12:84818705-84818727 CTGTTAAGAAACAGAAAAGAAGG - Intergenic
1100616243 12:96233935-96233957 ATGGTTGGAAGCATAACAGATGG + Intronic
1100883632 12:99045403-99045425 CTGATCAGAAGCAGTAGATAGGG - Intronic
1100912827 12:99384742-99384764 CTGGTCAGAAGAATCAGAGATGG - Intronic
1102270376 12:111529567-111529589 CTGCCCAGAATCAGAAGAGAAGG - Intronic
1104735635 12:131134320-131134342 CTGGTCAAAAGCAGAAGAAGAGG - Intronic
1105074135 12:133260502-133260524 CTGTACAATAGCAGAACAGAGGG - Intergenic
1105741367 13:23327069-23327091 CTGGTCACAGGCAGAACTAAAGG + Intergenic
1105959408 13:25316308-25316330 TTCATCAGAAGCAGAAGAGATGG - Intronic
1106698723 13:32206243-32206265 CTGGTCCGAGGAAGAGCAGAAGG + Intronic
1106991775 13:35428484-35428506 GTGCTCAACAGCAGAACAGAAGG - Intronic
1107109178 13:36677070-36677092 CAAATCAGAATCAGAACAGAAGG - Intronic
1107127276 13:36859215-36859237 GTGTTCAGAGGCAGAACAAAAGG + Intronic
1108023998 13:46159687-46159709 CTGGAGAGAAGAAGAACATAAGG + Intronic
1110212994 13:72994743-72994765 CAGGTTAGAAGCAAAGCAGAGGG + Intronic
1110901697 13:80833212-80833234 CTCCTCAGAAGCCAAACAGATGG - Intergenic
1111832193 13:93343343-93343365 CTGGCCAAGAGCTGAACAGATGG - Intronic
1112155941 13:96816929-96816951 CTGGGCAGAATAAGGACAGACGG - Intronic
1112246985 13:97744303-97744325 CTGATCAGAAGCAGCAGCGAAGG - Intergenic
1112334440 13:98502264-98502286 CTGGCCCGAAGCAGAGCAGCTGG + Intronic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114376103 14:22148329-22148351 CTGTTTAGAAACAGAGCAGAAGG - Intergenic
1114965933 14:27959265-27959287 CAGATCAGATACAGAACAGAAGG + Intergenic
1116858637 14:49976024-49976046 CTGGCCAGAATCAGATCACATGG - Intergenic
1116921109 14:50576419-50576441 CAGGTCAGAAGTAAACCAGATGG - Intronic
1118694674 14:68372607-68372629 CTGGAGAGAAACAGAAAAGAGGG + Intronic
1118859815 14:69654044-69654066 CGGGACAGGTGCAGAACAGACGG - Intronic
1118872008 14:69750899-69750921 CTAGTGATAAGCAGAAAAGAGGG - Intronic
1120220201 14:81723015-81723037 CTTATCAGAAGCAAAGCAGATGG + Intergenic
1121422571 14:93825498-93825520 CTGGCCCCAAGCAGAACAGGTGG - Intergenic
1122244597 14:100393569-100393591 CAGGGCAGAAGTAGGACAGATGG + Intronic
1122330268 14:100907277-100907299 GCGCTCAGAAGCAGAACAGAAGG - Intergenic
1123020517 14:105395834-105395856 CTGGGGAGAAGCAGGACTGAGGG - Exonic
1124968763 15:34463384-34463406 CTGGTCAGAAGAAGTCCAAATGG + Intergenic
1125088351 15:35759050-35759072 CTGGGCTGCAACAGAACAGAAGG - Intergenic
1126917796 15:53484746-53484768 CTAGTGATAAGCAGAAAAGAGGG - Intergenic
1128993486 15:72279753-72279775 CTGGTCAAAAGCAGAAAAGGCGG - Intronic
1131293744 15:91129537-91129559 GTGGACAGAACCAAAACAGAAGG + Intronic
1131398515 15:92105971-92105993 CTGGTGAGGAACAGAACAGGGGG - Intronic
1131617430 15:94031444-94031466 CAGGCCAGAAGGAGAAGAGATGG + Intergenic
1132843412 16:1989577-1989599 CTGGTCCCAAGAAGACCAGATGG - Intergenic
1134814007 16:17191097-17191119 CTAGTGATAAGCAGAAAAGAGGG + Intronic
1135201348 16:20440194-20440216 ATGGCCAGAAGCAAAACAGCTGG - Intronic
1135217761 16:20587670-20587692 ATGGCCAGAAGCAAAACAGCTGG + Intergenic
1136255437 16:29035849-29035871 CTGGTCAGCAGCAACACAGCTGG + Intergenic
1138909917 16:61384183-61384205 GTGGCCAGAAGGAGCACAGAAGG + Intergenic
1139061220 16:63254117-63254139 CTCCACAGAAGCAGAAGAGAAGG - Intergenic
1140365114 16:74375153-74375175 CTGGTCAGCAGCAACACAGCTGG + Intergenic
1141323774 16:83036711-83036733 CTGGGAAGAAGCAGAACACAGGG - Intronic
1141995885 16:87636114-87636136 CTGGTCACCTGCAGAACAGGCGG - Intronic
1142412923 16:89925196-89925218 GTGTTCAGAAGCAGAGCACAAGG - Intronic
1143024091 17:3930684-3930706 CGGCTCAGAAGGAGAACAGCTGG + Intronic
1143545507 17:7592895-7592917 CTGGTCAGAGGAAGAAGAGGAGG + Intronic
1146788195 17:35735949-35735971 AGGGACAGCAGCAGAACAGACGG + Intronic
1147132657 17:38418394-38418416 CCTGTCAGATGCAGAACAGAGGG + Intergenic
1150585064 17:66510072-66510094 CTAGTGATAAGCAGAAAAGAGGG + Intronic
1150919545 17:69468750-69468772 CTAGTGATAAGCAGAAAAGAGGG - Intronic
1152061571 17:78079798-78079820 CTGGTCAGAAGCAATATTGAGGG + Intronic
1152749566 17:82056435-82056457 CTGGTCAGGACCAGGACAGGAGG - Intronic
1152812347 17:82387996-82388018 CTGGACAGAAACAAGACAGAGGG + Intergenic
1152929624 17:83103219-83103241 CTGGTCTGCAGCAGGACAGGTGG - Intergenic
1153713867 18:7825808-7825830 ATGGTAGTAAGCAGAACAGATGG + Intronic
1153874632 18:9358183-9358205 ATGGTCACAAGGAGAAGAGAAGG - Intronic
1154272529 18:12932460-12932482 CGGGTAAGTAACAGAACAGATGG - Intergenic
1156065834 18:33141423-33141445 CAGATCAGAAGCAGAAGAGCTGG + Intronic
1157927454 18:51781806-51781828 CTAGTGATAAGCAGAAAAGAGGG + Intergenic
1159069220 18:63604907-63604929 CTGGTCAGAAGCAGAAGAGCTGG - Intergenic
1160358213 18:78246656-78246678 CAAGTCAGAAGCAAAACTGAGGG - Intergenic
1160854825 19:1212045-1212067 CTGGGCAGCCGCAGAACAGCGGG + Intronic
1162171755 19:8795261-8795283 CTAGTGATAAGCAGAAAAGAGGG - Intergenic
1163888897 19:19993563-19993585 CTATTCAGAAGGAGACCAGAGGG - Intergenic
1165705133 19:37970576-37970598 CTGCACAGAAGCTGAACGGATGG - Intronic
1166587701 19:43965366-43965388 ATGGACAGAAGTAAAACAGATGG - Intronic
1166590315 19:43991975-43991997 ATGGACAGAAGCACAACAGGTGG - Intronic
1166592169 19:44009215-44009237 ATGGTCAGAAGTAAAACAAATGG - Intronic
1166599575 19:44082146-44082168 ATGGACAGAAGTAAAACAGATGG - Intronic
1167372340 19:49090690-49090712 CTTTTCAGCAGCAGAACATAGGG + Intronic
1167647979 19:50716084-50716106 CTGGTCAGAAGCAGAACAGATGG + Intronic
1167894676 19:52571293-52571315 CTGGTGGCAAGGAGAACAGAGGG + Intronic
1167903152 19:52637342-52637364 CTGGTGGCAAGGAGAACAGAGGG - Intronic
1167909326 19:52689446-52689468 CTGGTGGCAAGGAGAACAGAGGG - Intronic
1167925848 19:52820593-52820615 CTGGTGGCAAGGAGAACAGAGGG - Intronic
1167930034 19:52856582-52856604 CTGGTGGCAAGGAGAACAGAGGG - Intronic
1167934169 19:52892814-52892836 CTGGTGGCAAGGAGAACAGAGGG - Intronic
1167937845 19:52922371-52922393 CTGGTGGCAAGGAGAACAGAGGG - Intergenic
1167958857 19:53090136-53090158 CTGGTGACAAGGAGAGCAGAGGG - Intronic
1167971758 19:53192313-53192335 CTGGTGACAAGGAGAGCAGAGGG - Intronic
1167983306 19:53294277-53294299 CTAGTGATAAGCAGAAAAGAGGG + Intergenic
1167995221 19:53396172-53396194 CTGGTGGCAAGGAGAACAGAGGG + Intronic
1167999479 19:53432968-53432990 CTGGTGGCAAGGAGAACAGAGGG + Intronic
1168427854 19:56253296-56253318 ATGGTCAGAAGAGCAACAGAAGG + Intronic
925727475 2:6887738-6887760 CTCGTCAGAAGCAAATCAGGAGG + Intronic
925773214 2:7304819-7304841 CTGTCTAGAAGCAGCACAGAGGG + Intergenic
926691933 2:15742639-15742661 CTGGTGAGACCCTGAACAGAGGG - Intronic
926896500 2:17695831-17695853 CTTGTCCTAACCAGAACAGATGG - Intronic
927185904 2:20482318-20482340 CTGGTCAAAAGAAGAGAAGAAGG - Intergenic
927625150 2:24708355-24708377 GTGGTCAGAATCAGATGAGAAGG - Intronic
927845143 2:26467502-26467524 CTGGCCAGAAGCAGAAAAGGAGG + Intronic
927949834 2:27159791-27159813 CTGCTGAGCAGCAAAACAGAGGG + Intergenic
930474723 2:51867270-51867292 CTGGTCAGAAGCAGTAGAAATGG - Intergenic
933184598 2:79264966-79264988 CTGTACAGAAGCAGAGCAGATGG - Intronic
933773195 2:85756368-85756390 CAGGACAGAAGGATAACAGAAGG + Intronic
934574444 2:95391334-95391356 CTGGTCAAGAGCTGAACAGAGGG - Intergenic
935154382 2:100470376-100470398 CTGATCAGATGCAGGACAGAGGG + Intergenic
935349268 2:102139787-102139809 CTCCTCAGAAGCCCAACAGATGG + Intronic
936863195 2:117046922-117046944 AAGGTCAGAAGAAGAGCAGATGG + Intergenic
937009122 2:118545853-118545875 CAGGGCAGAAGAAGAAAAGATGG + Intergenic
937106735 2:119322881-119322903 CTGGTCAGACAGAGACCAGAAGG + Intronic
937822143 2:126322686-126322708 CTGGTCTGAAGCAGAAGCTATGG - Intergenic
938319162 2:130351550-130351572 CTGGTCAGCAGCAGCAGTGAGGG + Intergenic
938576574 2:132609734-132609756 CATGTCAGAAGCAGAGCAAAAGG - Intronic
938754856 2:134370462-134370484 CTGGTTGGAACCAGAACAAATGG - Intronic
940727897 2:157356014-157356036 CTAGTCAGAAGCAGAACAGTTGG - Intergenic
942141137 2:172978438-172978460 CCTGGGAGAAGCAGAACAGAGGG - Intronic
942985768 2:182139779-182139801 CTGGGCAGAAGCACAGCAGAAGG - Intergenic
944130004 2:196337432-196337454 CTGTTCATAAGCAGGAGAGATGG + Intronic
944155397 2:196602117-196602139 CTGGTCAGAAGCAGAGCCTCTGG + Intergenic
944587609 2:201186348-201186370 CTAGTGAGAAGCAAAACAAAGGG - Intronic
946151774 2:217778659-217778681 GGGCTCAGCAGCAGAACAGAGGG + Intergenic
946635245 2:221717953-221717975 ATGGTAAGAAGCAGTACACAGGG + Intergenic
946685203 2:222261541-222261563 CTCTTCTGAGGCAGAACAGAGGG + Intronic
947212902 2:227724339-227724361 CAGGACAGAAGCAGAAAGGAAGG + Intergenic
947313605 2:228830706-228830728 CTCATCAAAAGCAGAGCAGATGG - Intergenic
948175495 2:235939537-235939559 GTGGTGAGAAGGAGAATAGAAGG - Intronic
948477280 2:238228113-238228135 CTGGTGAGATGGGGAACAGAAGG + Intronic
1168749377 20:271268-271290 CTGGTGGGAGGCAGCACAGAAGG + Intronic
1169909291 20:10634325-10634347 CTCTTCAGGTGCAGAACAGAGGG + Intronic
1170439921 20:16368614-16368636 CTGGTAAATATCAGAACAGAAGG - Intronic
1170920928 20:20678797-20678819 CAGGTCGGAAGCCAAACAGATGG - Intronic
1171385442 20:24766667-24766689 CTGGCTAGAAGCAGATGAGATGG - Intergenic
1171428611 20:25064441-25064463 CAGGTTGGAGGCAGAACAGAGGG - Intergenic
1172714393 20:36951904-36951926 GTGGCTAGAAGCAGAACTGAGGG + Intergenic
1173181354 20:40808798-40808820 GGGGTCAGAGGCAGAACACATGG + Intergenic
1173701596 20:45076641-45076663 CGGGCCTGAAGCAGATCAGAGGG + Exonic
1174729323 20:52899397-52899419 CAGGTCAGAAGGAAGACAGATGG + Intergenic
1175580373 20:60094337-60094359 GTTGTCAGAGGGAGAACAGAGGG - Intergenic
1178188486 21:30253296-30253318 CTGGTGAGAATGAGAAGAGAAGG + Intergenic
1179545977 21:42112437-42112459 CTGGGCAGATACAGAACAGCTGG - Intronic
1181690937 22:24559985-24560007 CTGGACAGAAACACTACAGAGGG - Intronic
1182027111 22:27128797-27128819 CTGAGCAGCAGCAGAACAGCAGG - Intergenic
1182867260 22:33614578-33614600 CTGGTCACAGGCAGAACTGAGGG - Intronic
1184294777 22:43516480-43516502 CTGGTCAGAAACGGTTCAGATGG + Intergenic
1184329069 22:43814523-43814545 CTGGTGAGAAGCATAACAGCAGG - Intergenic
1184644264 22:45887888-45887910 CTGGCCATAAGCAGAGCTGACGG + Intergenic
1185418674 22:50723151-50723173 CTGGGCAGGGGCAGGACAGACGG - Intergenic
951036227 3:17935351-17935373 CTGGCCAGAGGCAAAACAGCCGG + Intronic
951201343 3:19878012-19878034 CTAGGCAGAAGCAGAAAAAAGGG + Intergenic
951922547 3:27872343-27872365 CTAGTGATAAGCAGAAAAGAGGG + Intergenic
952327637 3:32335420-32335442 CCGGTCGGAAGCAGACCAGCTGG + Intronic
952739312 3:36720280-36720302 CTTATCAGAAGCAGAGCAGATGG + Intronic
956736532 3:72242910-72242932 CTGCTCAGAAGCGGTCCAGAAGG + Intergenic
957246193 3:77719756-77719778 CTCCCCAGAAGCAGAGCAGATGG + Intergenic
957681709 3:83444380-83444402 CTGAGCAGAAGAGGAACAGAAGG + Intergenic
960268445 3:115648243-115648265 GGAGTCAGAAGCAGAAAAGAAGG - Intronic
961201034 3:125045532-125045554 CTGGTGGGAGGCAGAAGAGATGG + Intronic
961344605 3:126255895-126255917 CTGGTAAGTAGCAGAACAGTGGG - Intergenic
962281996 3:134059157-134059179 CTGGGCAGTAGCAAAATAGAGGG - Intergenic
965879008 3:173365576-173365598 CTGATCAGGAACTGAACAGATGG - Intergenic
966843824 3:184110851-184110873 CTGAACAGAAAAAGAACAGATGG - Intergenic
967196357 3:187029716-187029738 CTGGTGTGGAGCAGAACAGAGGG + Intronic
968226957 3:196978815-196978837 GTGGTCAGAAGAAGAAAACAGGG - Intergenic
969576272 4:8037906-8037928 CTGGGCAGAATCAGAGCAGAGGG - Intronic
969926956 4:10594105-10594127 CTGGTGGGAAGCAGAAGAGTGGG - Intronic
970704276 4:18782038-18782060 CTCCTCAGAAACTGAACAGATGG - Intergenic
971203667 4:24539075-24539097 CTGATCAGACTCAGAGCAGATGG - Intronic
971342374 4:25782319-25782341 CTGGTTAAAAGCAGAAGAAATGG - Exonic
973140579 4:46763505-46763527 ATGGTCAGAAGCAGAATGGGAGG - Intronic
974070082 4:57115305-57115327 CTGGGCAGATGCAGCACTGAGGG + Intergenic
974121934 4:57649379-57649401 ATGATCAGAGGCAGAGCAGAAGG + Intergenic
974157688 4:58095298-58095320 CTTTCCAGAAGCTGAACAGATGG - Intergenic
974897423 4:67956334-67956356 CTGTTTACAAACAGAACAGATGG - Intronic
979474249 4:121136014-121136036 CTGGCCAGCAGCAGAGAAGAGGG - Intronic
981439032 4:144761052-144761074 ATGGTTAGAAGCAGACAAGATGG - Intergenic
982122521 4:152156685-152156707 CTGCTCAGCAACAGGACAGAAGG - Intergenic
982448378 4:155521992-155522014 GTGTTCAGCAGCAGAAAAGAAGG - Intergenic
983470943 4:168153353-168153375 CTAGTGATAAGCAGAAAAGAGGG - Intronic
984608768 4:181814810-181814832 CAGAGCAGAAGCAGAAGAGAGGG + Intergenic
985347423 4:189021191-189021213 CTGTTCAGATGCAGCACAGAAGG + Intergenic
985379467 4:189377142-189377164 CTGAGCAGAAACACAACAGATGG + Intergenic
987456352 5:18151770-18151792 CATGTCAGAAGCAACACAGATGG + Intergenic
987999122 5:25327481-25327503 CTGGGCAAAGGCAGAACAGTGGG - Intergenic
990203045 5:53399184-53399206 GTGGTCAGAAGGAGAATTGAGGG + Intergenic
990478897 5:56188096-56188118 CTGGTCAGGGGCAGAACATGTGG + Intronic
993016297 5:82538523-82538545 CTGATCAGAAACTGAACAGACGG - Intergenic
994683729 5:102923220-102923242 CTGGCTAGAAGCAGAAAATACGG + Intronic
996413711 5:123186890-123186912 CCCGTCTGATGCAGAACAGAGGG - Intronic
998056065 5:139078525-139078547 CTGGGGAGACGCAGAACAGCAGG + Intronic
998174648 5:139894340-139894362 CTGGCCAGCAGCAGGACAGTGGG - Intronic
998373623 5:141677423-141677445 CTGGTCAGCACCAGCTCAGATGG + Intronic
1000160151 5:158589558-158589580 CTGGGCATAAGCAGAACAGCGGG + Intergenic
1000932715 5:167271263-167271285 GAGATCAGAAGCTGAACAGATGG - Intergenic
1001278813 5:170371113-170371135 CTATGCAAAAGCAGAACAGAAGG - Intronic
1001305964 5:170573030-170573052 CTGCTAAGCAGCAGAGCAGAGGG + Intronic
1002808573 6:603142-603164 GAGGTCAGAGGCAGGACAGAAGG + Intronic
1003028356 6:2578829-2578851 CTGGGCAAGAGCAGAACAGTGGG + Intergenic
1003335626 6:5169319-5169341 CTGGCCAGAATAAGAACAAAAGG + Intronic
1006304366 6:33210141-33210163 CAGGAGAGAAGCAGAACTGATGG + Intronic
1006601677 6:35230736-35230758 CTGGCCAGAAGGGGAAGAGAAGG + Intronic
1007087074 6:39156055-39156077 CAAGTCAGAAGCAGAGCAGTAGG + Intergenic
1007736813 6:43987128-43987150 CTGGGCAGAAGCAAAAGAGAGGG - Intergenic
1008045788 6:46849908-46849930 GTGGACAGAAGAAGAAAAGAGGG - Intergenic
1008793249 6:55265959-55265981 CTAGTAATAAGCAGAAAAGAGGG - Intronic
1010354714 6:74918663-74918685 GTGCTCAGATGCAGAGCAGAGGG + Intergenic
1010737766 6:79461775-79461797 CTGGACAGCAGCAGAGGAGAGGG - Intergenic
1012117272 6:95318147-95318169 ATGGCAAGAATCAGAACAGATGG - Intergenic
1012822038 6:104097391-104097413 TTGGTAGGAAACAGAACAGATGG - Intergenic
1013442910 6:110189798-110189820 GTGGTAAAAAACAGAACAGATGG - Intronic
1014424960 6:121292856-121292878 CTGGGCAGGAGCAAAGCAGAAGG + Intronic
1014494596 6:122105680-122105702 CTGGTGAGAGGCATCACAGAAGG - Intergenic
1016300769 6:142628842-142628864 CTGGACTGAAGAAGAACCGAAGG - Intergenic
1019191063 6:170251238-170251260 CAGGTCACAAGCTGAACACAGGG - Intergenic
1021098011 7:16554999-16555021 GTGGTGAGAGGAAGAACAGAAGG + Intronic
1022383271 7:29880650-29880672 CTGGTGACAAGCAGACCAGTAGG - Intronic
1022435837 7:30384131-30384153 CTAGTGATAAGCAGAAAAGAGGG - Intronic
1022816880 7:33922559-33922581 CTAGTGATAAGCAGAAAAGAGGG + Intronic
1023218420 7:37891709-37891731 CTAGTGATAAGCAGAAAAGAAGG - Intronic
1024013660 7:45292177-45292199 GTGGTCAGAACCAGAGCAAATGG - Intergenic
1024013667 7:45292219-45292241 CTGGTCACAAGCATGGCAGATGG + Intergenic
1024054336 7:45649991-45650013 CTGGGCAGAAGCAGGAAGGAAGG + Intronic
1028242463 7:88437939-88437961 CTGGTCTGAACCTGAACAGCTGG - Intergenic
1030090344 7:105852518-105852540 CTGGTCAGATGCAGCACAGGGGG + Intronic
1030185541 7:106758292-106758314 CAGGTCAGCAGCAGTAGAGATGG - Intergenic
1031805247 7:126299983-126300005 CTGATCAAAAGAAGAAAAGAGGG + Intergenic
1032493205 7:132340557-132340579 ATGGAGAGAAGCAGAAAAGAGGG + Intronic
1032512229 7:132481251-132481273 CAGGGCAGAGACAGAACAGAGGG + Intronic
1032750498 7:134835237-134835259 CTGGGCAGCAGCAGGACACAGGG - Intronic
1033184104 7:139209853-139209875 CAGGTCAGAAGCAGGTCAGAAGG + Intergenic
1034858224 7:154573881-154573903 CTGGTCAGATTCACAACAGGAGG - Intronic
1035662528 8:1358939-1358961 CTGGTCAGCAGCAGAACCTCTGG + Intergenic
1036205780 8:6804913-6804935 CTATTAAGAAGCAGAAAAGAAGG - Intergenic
1036733817 8:11289308-11289330 CTAGTAAGAGGCAGAACTGAAGG - Intronic
1038470964 8:27820164-27820186 CTGGAATGAAGCAGAAAAGAGGG - Intronic
1038626427 8:29197686-29197708 CTAGTGATAAGCAGAAAAGAAGG - Intronic
1040514445 8:48123357-48123379 CTGGGCAGAAGCAGAGAAGGTGG + Intergenic
1043379559 8:79688006-79688028 CTAGTGATAAGCAGAAAAGAGGG - Intergenic
1043827165 8:84943181-84943203 CTGGGAAACAGCAGAACAGAGGG - Intergenic
1043869239 8:85412789-85412811 CTAGTCATACACAGAACAGATGG + Intronic
1047417096 8:124673605-124673627 TTGTTCTGAAGCAGCACAGATGG + Intronic
1047839414 8:128734250-128734272 GTGGTCAGAAGTATGACAGAGGG + Intergenic
1047985782 8:130232097-130232119 ATGATCAGAAAAAGAACAGAAGG + Intronic
1048250724 8:132864725-132864747 CTGGTGAGGAGCAGTACAGCAGG + Intergenic
1049833565 8:144718148-144718170 CAGAGCAGAAGCAGAACACAAGG + Intergenic
1050890935 9:10823750-10823772 CTTCTCAGAAGGAGAACTGATGG - Intergenic
1051070762 9:13163564-13163586 CATGTCAGAAGCAGGACAGCAGG - Intronic
1051146064 9:14028696-14028718 CTGGCCAGAACTTGAACAGATGG - Intergenic
1051155002 9:14132975-14132997 CTGGTCAGTATCATACCAGAGGG - Intronic
1051356175 9:16241485-16241507 CTAGTTAGAAGCAAAACAAATGG + Intronic
1051370964 9:16358694-16358716 CTAGTGATAAGCAGAAAAGAGGG - Intergenic
1052605567 9:30694730-30694752 CTTGGCAGGAGCAGAACAGGTGG - Intergenic
1053365999 9:37522980-37523002 ATGGAGAGAAGCAGAAAAGAAGG + Intronic
1053651737 9:40176502-40176524 GTGGACAGAAGAAGAAAAGAGGG + Intergenic
1053902127 9:42805824-42805846 GTGGACAGAAGAAGAAAAGAGGG + Intergenic
1054532848 9:66199700-66199722 GTGGACAGAAGAAGAAAAGAGGG - Intergenic
1054967048 9:71041171-71041193 CTGTTCTTAAGCAGTACAGAAGG + Intronic
1054969225 9:71065455-71065477 CTGGTCAGTAGCAGCACAGATGG - Intronic
1055766601 9:79670322-79670344 CTGGGCAAAAGCACAACAAAAGG + Intronic
1056389584 9:86128602-86128624 CTGGACAGCAGCAGAACAGTGGG - Intergenic
1057840009 9:98478661-98478683 CTGTTCAGAAGCAGAAACCATGG + Intronic
1057961237 9:99459341-99459363 TTGGCCAGAATCAGAACACATGG - Intergenic
1057976086 9:99607888-99607910 CTGCACAGAAGCATAACAGTGGG - Intergenic
1058162381 9:101583533-101583555 TTGGTCAGAGGAAGAAAAGAAGG + Intronic
1058686075 9:107480856-107480878 CTGGTCACAGTCAAAACAGAGGG - Intergenic
1059340338 9:113594405-113594427 GGGGACAGAAGCAGAAAAGAGGG - Intronic
1059998575 9:119937677-119937699 CTGGACTAAAGCAGAAAAGACGG + Intergenic
1060133363 9:121127330-121127352 ATGCTCAGAAGCAGAACTGTGGG + Intronic
1060180709 9:121531772-121531794 ATGGTCAGCAGCAGGACTGAGGG + Intergenic
1060278587 9:122200517-122200539 CTAGTGATAAGCAGAAAAGAGGG - Intergenic
1061083323 9:128385202-128385224 CTGGACAGAAGGATAACACATGG - Intronic
1061545356 9:131301325-131301347 CTGGTCACCAGTAGGACAGATGG + Intronic
1185647979 X:1628606-1628628 CAGGACAGAAGGAGAAGAGAGGG - Intronic
1187036178 X:15542427-15542449 GTGGCAAGAAGGAGAACAGATGG + Intronic
1187153062 X:16698849-16698871 CTGCTCAAAAGTAGAACTGAAGG - Intronic
1188547386 X:31323648-31323670 CTGGACAGACGCTGAAAAGAAGG + Exonic
1190716845 X:53111755-53111777 CTAGTGATAAGCAGAAAAGAGGG - Intergenic
1192169904 X:68847696-68847718 CAGTTCAGAGGCAGAACTGAAGG - Intergenic
1192215103 X:69152678-69152700 CTGGTCAGAAGCAGGGCTCAAGG + Intergenic
1194417939 X:93636683-93636705 TTCCTCAGAAGCTGAACAGATGG + Intergenic
1195255334 X:103084293-103084315 ATGTTCAGAAGGAGAACAGGGGG - Intronic
1198405285 X:136306010-136306032 CTGGTTTGATGCAGAAAAGAAGG + Intronic
1199180549 X:144848833-144848855 CTGGTCATAAGCCCAACAGCTGG + Intergenic
1199205640 X:145145681-145145703 GTAGTCAGAAGCAAAAAAGAAGG - Intergenic
1199856320 X:151761855-151761877 CTTGCCAGAAGGAGAATAGAAGG - Intergenic