ID: 1167648604

View in Genome Browser
Species Human (GRCh38)
Location 19:50718476-50718498
Sequence CGGAGCCGGCCCGGGGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 588
Summary {0: 1, 1: 0, 2: 5, 3: 60, 4: 522}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167648604_1167648630 26 Left 1167648604 19:50718476-50718498 CCAGCCCCCCCGGGCCGGCTCCG 0: 1
1: 0
2: 5
3: 60
4: 522
Right 1167648630 19:50718525-50718547 GGGAGCGGGCACGCTCCGCCGGG 0: 1
1: 0
2: 0
3: 14
4: 164
1167648604_1167648617 1 Left 1167648604 19:50718476-50718498 CCAGCCCCCCCGGGCCGGCTCCG 0: 1
1: 0
2: 5
3: 60
4: 522
Right 1167648617 19:50718500-50718522 CCCCTCCCCCTCAGGGCTCGCGG 0: 1
1: 0
2: 2
3: 31
4: 327
1167648604_1167648614 -6 Left 1167648604 19:50718476-50718498 CCAGCCCCCCCGGGCCGGCTCCG 0: 1
1: 0
2: 5
3: 60
4: 522
Right 1167648614 19:50718493-50718515 GCTCCGGCCCCTCCCCCTCAGGG 0: 1
1: 0
2: 3
3: 35
4: 329
1167648604_1167648623 6 Left 1167648604 19:50718476-50718498 CCAGCCCCCCCGGGCCGGCTCCG 0: 1
1: 0
2: 5
3: 60
4: 522
Right 1167648623 19:50718505-50718527 CCCCCTCAGGGCTCGCGGGAGGG 0: 1
1: 0
2: 1
3: 12
4: 130
1167648604_1167648627 11 Left 1167648604 19:50718476-50718498 CCAGCCCCCCCGGGCCGGCTCCG 0: 1
1: 0
2: 5
3: 60
4: 522
Right 1167648627 19:50718510-50718532 TCAGGGCTCGCGGGAGGGAGCGG 0: 1
1: 0
2: 3
3: 30
4: 317
1167648604_1167648631 27 Left 1167648604 19:50718476-50718498 CCAGCCCCCCCGGGCCGGCTCCG 0: 1
1: 0
2: 5
3: 60
4: 522
Right 1167648631 19:50718526-50718548 GGAGCGGGCACGCTCCGCCGGGG 0: 1
1: 0
2: 0
3: 7
4: 86
1167648604_1167648629 25 Left 1167648604 19:50718476-50718498 CCAGCCCCCCCGGGCCGGCTCCG 0: 1
1: 0
2: 5
3: 60
4: 522
Right 1167648629 19:50718524-50718546 AGGGAGCGGGCACGCTCCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 83
1167648604_1167648621 5 Left 1167648604 19:50718476-50718498 CCAGCCCCCCCGGGCCGGCTCCG 0: 1
1: 0
2: 5
3: 60
4: 522
Right 1167648621 19:50718504-50718526 TCCCCCTCAGGGCTCGCGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 117
1167648604_1167648632 30 Left 1167648604 19:50718476-50718498 CCAGCCCCCCCGGGCCGGCTCCG 0: 1
1: 0
2: 5
3: 60
4: 522
Right 1167648632 19:50718529-50718551 GCGGGCACGCTCCGCCGGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 116
1167648604_1167648619 2 Left 1167648604 19:50718476-50718498 CCAGCCCCCCCGGGCCGGCTCCG 0: 1
1: 0
2: 5
3: 60
4: 522
Right 1167648619 19:50718501-50718523 CCCTCCCCCTCAGGGCTCGCGGG 0: 1
1: 0
2: 1
3: 23
4: 254
1167648604_1167648613 -7 Left 1167648604 19:50718476-50718498 CCAGCCCCCCCGGGCCGGCTCCG 0: 1
1: 0
2: 5
3: 60
4: 522
Right 1167648613 19:50718492-50718514 GGCTCCGGCCCCTCCCCCTCAGG 0: 1
1: 0
2: 3
3: 52
4: 433
1167648604_1167648628 12 Left 1167648604 19:50718476-50718498 CCAGCCCCCCCGGGCCGGCTCCG 0: 1
1: 0
2: 5
3: 60
4: 522
Right 1167648628 19:50718511-50718533 CAGGGCTCGCGGGAGGGAGCGGG 0: 1
1: 0
2: 1
3: 31
4: 442

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167648604 Original CRISPR CGGAGCCGGCCCGGGGGGGC TGG (reversed) Intronic
900109284 1:998815-998837 TCGGGCGGGCCCGGGGGGGCGGG - Intergenic
900244411 1:1630803-1630825 CGGACCCGGGCCTGGGGGGCGGG - Intergenic
900340499 1:2186494-2186516 CTGAGCTGGCCGGGGGGGGGCGG - Intronic
900516052 1:3082675-3082697 TGGAGCTGGACCTGGGGGGCTGG + Intronic
900630649 1:3633425-3633447 CGGCCCCGGCCCGGGGCGGCGGG + Exonic
900645252 1:3706111-3706133 CGGAGGCGGGCCGGGGGCGGGGG - Intronic
900970803 1:5991761-5991783 CGGAGCTGGAGCCGGGGGGCGGG + Intronic
901138050 1:7010262-7010284 AGGAGCCGGCCCTGGGGTCCTGG - Intronic
901303642 1:8217244-8217266 CCGAGCCGTCCCGGGGCGACAGG + Intergenic
902586210 1:17439842-17439864 CGGCGCAGGCTCGGGTGGGCAGG - Intergenic
903069082 1:20717790-20717812 CAGCGCCGGCCACGGGGGGCGGG + Exonic
903324783 1:22563611-22563633 CCGGGCCGGGCCGGGCGGGCGGG - Exonic
903855744 1:26336795-26336817 CGGGGCGGGCCCGGGCGAGCCGG - Intronic
904062991 1:27725934-27725956 CGGGGCGGACCCGGGCGGGCTGG - Intergenic
904384942 1:30135008-30135030 TGGAGGCGGCCAGGGGAGGCGGG + Intergenic
904847504 1:33431037-33431059 CGGCGCCGAGCCGAGGGGGCGGG - Intronic
905174278 1:36126143-36126165 AGGAGCGGGCCCAGGGAGGCGGG + Intergenic
905789837 1:40784068-40784090 CGGCGCCGGGCTGGGGGCGCCGG - Exonic
905960010 1:42035676-42035698 CGGGGGCGGTCCCGGGGGGCGGG - Intronic
906104829 1:43285520-43285542 AAGAGAAGGCCCGGGGGGGCCGG - Exonic
906204378 1:43979303-43979325 CCGAGCCGCCCCGGGGGGCAGGG - Intronic
906345530 1:45012191-45012213 CGGAGCCTGGACTGGGGGGCAGG + Exonic
907357642 1:53889637-53889659 CCGCGGCGGCCCGGGCGGGCAGG + Intronic
908534829 1:65067391-65067413 CGGAGCCGGCCTGGGGACGCGGG - Intergenic
910200145 1:84690553-84690575 CGGCGCCGGCGCGCGGGGGCGGG - Intronic
910757236 1:90706647-90706669 CGGAGCCGGCGCGCCGCGGCTGG + Intergenic
911208705 1:95117801-95117823 CGGAGCCCGCCCGGGAGCCCCGG - Intronic
912166144 1:107044866-107044888 CGGGGCCGGCAGGGCGGGGCCGG - Intergenic
912401446 1:109397409-109397431 CGGAGTCGGGCCCGGGCGGCCGG - Intronic
912435110 1:109656268-109656290 CGCAGCGGGGCCGAGGGGGCGGG + Exonic
912514738 1:110210644-110210666 CGGCGCCGAGCCTGGGGGGCGGG - Intergenic
912818720 1:112850164-112850186 GGGAGCCGGCGCTGGGGAGCCGG + Intergenic
912927935 1:113929792-113929814 CGGGGACGGCTCCGGGGGGCGGG + Exonic
914197343 1:145454439-145454461 GAGAGCGGGCCCGGGGCGGCGGG - Intergenic
915213304 1:154325500-154325522 CGGAGCCGGCGGCGGGGGCCGGG - Intergenic
915310160 1:155002531-155002553 GGGAGGGGGCCTGGGGGGGCGGG + Intergenic
915458094 1:156053756-156053778 CCGAGCCGGGCCGGCCGGGCGGG - Exonic
916694476 1:167221543-167221565 GGGAGCGGGCCCGGGCGGGGGGG + Intronic
917291599 1:173477224-173477246 GGGGGCCGGGCCGCGGGGGCTGG - Intergenic
917438623 1:175045713-175045735 CGCCGCGGGCCCGGCGGGGCAGG + Intergenic
917715184 1:177728181-177728203 CAGAGCCTGCTCGGGGGGGTCGG + Intergenic
919403259 1:197146471-197146493 CGGAGCCGCCTCGTGGGAGCGGG - Exonic
919739318 1:200972732-200972754 AGGAGGCGGCCCTGGAGGGCCGG + Intronic
919748650 1:201023560-201023582 CGGGCCCAGCCCCGGGGGGCCGG - Exonic
920409639 1:205749574-205749596 TGGAGCCAGCGCGGGGAGGCGGG - Intronic
922116357 1:222618010-222618032 CGGGGCGGGGACGGGGGGGCTGG - Intergenic
922119040 1:222644244-222644266 AGGAGCCGGCCGGCGAGGGCGGG - Intronic
922250487 1:223845528-223845550 CGCAGCCCGCGCGGAGGGGCCGG - Intronic
923007903 1:230067035-230067057 CGGAGGCGGCGAGGGGGGTCAGG - Intronic
923372457 1:233327636-233327658 AGGGGCGGGCCCGGGGGGGTGGG + Intergenic
924482791 1:244451938-244451960 GGGTGGCGGCCCGGCGGGGCGGG - Exonic
1063995033 10:11611342-11611364 CGGAGTTGGCCCCGGGGAGCCGG - Intronic
1064462963 10:15552687-15552709 CGGGGCCTGCCCGGGGGTGAGGG - Intronic
1065099569 10:22320743-22320765 CGGGGCCGGCCGGGGGGCGGCGG + Intronic
1065636958 10:27743332-27743354 CGGAGCGGGAGCGGGGTGGCCGG - Exonic
1067473260 10:46550707-46550729 GGGACCCGGCTCGGGGCGGCTGG + Exonic
1067686101 10:48466746-48466768 CGGCGCTGGCCGGGGCGGGCGGG - Intronic
1068845161 10:61663230-61663252 CGGGGCCGGCTGGGGGGCGCCGG - Intronic
1069962483 10:72087215-72087237 AGGCGGCGGCCCGGCGGGGCTGG - Intronic
1070570682 10:77637850-77637872 CGCCGCCCGCCCGGGGGGGAGGG + Intronic
1070751890 10:78968707-78968729 GGGAGCTGGCCAGGGGAGGCAGG + Intergenic
1072421083 10:95291015-95291037 CGGCGCGGGCCCGGGGAGCCTGG + Exonic
1073325762 10:102643473-102643495 CGGAGCCAGCCTGCGGCGGCGGG - Intergenic
1073392834 10:103193300-103193322 CGGTGCCGGGCGGCGGGGGCGGG - Exonic
1074592096 10:114822373-114822395 AGGAGCCGGGGCGGGGGTGCCGG + Intronic
1075616134 10:123891866-123891888 CGGGGCGGGCGCAGGGGGGCCGG + Intronic
1075871308 10:125774101-125774123 TGGAGCGGGCTCTGGGGGGCGGG + Exonic
1076189225 10:128470896-128470918 CGGAGCTGGCACGGGCGGGAGGG + Intergenic
1076319127 10:129565104-129565126 TGTAGCCTGCCCGGCGGGGCCGG + Intronic
1076650300 10:131982444-131982466 CCGAGACGGCCCGTGGGGTCGGG + Intergenic
1076864498 10:133160289-133160311 CGGGGCGGGCCCGGGGGGCGCGG - Intergenic
1076909284 10:133379230-133379252 CGGAGGCGGAGCGAGGGGGCGGG - Exonic
1077194186 11:1271051-1271073 GGGAGCCGGCCTGGGGCAGCAGG + Intergenic
1077214626 11:1390250-1390272 CGGCGCCGGCCAGGGGCGCCCGG - Intronic
1077296970 11:1830940-1830962 CGGGGCCGGCCCCACGGGGCTGG - Intronic
1077299786 11:1841619-1841641 CAGAGCCTGCCAGGGAGGGCTGG + Exonic
1077324842 11:1959245-1959267 CGGAGCAGGCCGGGGTGGGCAGG + Intronic
1077635764 11:3840729-3840751 CGCGGCCGGCCGGGCGGGGCGGG - Intronic
1077637837 11:3855623-3855645 CGGGGCGGGCCCGGGGCGGGCGG - Intronic
1078402957 11:11044339-11044361 TGGAGCCAGCCCAGGGAGGCAGG - Intergenic
1078594587 11:12674991-12675013 CGGAGGGGGCGCGGGGAGGCGGG - Intronic
1079035187 11:17014414-17014436 CGGAGCCGCCGCGGGGTGGGGGG + Intronic
1079135757 11:17775286-17775308 GGGGGCTGGCCTGGGGGGGCGGG - Intronic
1080551377 11:33376319-33376341 AGGAGCCGGCCCGGGGGAGGGGG + Intergenic
1080749549 11:35139446-35139468 CTGAGTCGGCCCTGGGGGACTGG + Intronic
1081700061 11:45147040-45147062 CGGCGCCGGCGCGGGGTGGGGGG + Intronic
1082814591 11:57499689-57499711 CGGGGCCGGCCAGAGGGAGCGGG + Intronic
1082986118 11:59172456-59172478 CTGAGGCTGCCCGGGGCGGCGGG + Intronic
1084118749 11:67056821-67056843 CGGGGCAGGCCCGGCGGGGCAGG - Exonic
1084171242 11:67401908-67401930 CGGGGCGGGCCCGGGAGGCCTGG - Intronic
1084183143 11:67456456-67456478 CGCAGGCTGCCCGGGCGGGCGGG - Intronic
1084304407 11:68272113-68272135 CCGAGCCGGCCCCGGGGAGGCGG - Intergenic
1084316861 11:68350583-68350605 AGGAGCCGGGCGGGAGGGGCTGG + Intronic
1084858423 11:72003324-72003346 CGGAGCTGGCCCAGGGGGCCTGG - Exonic
1087175201 11:95089772-95089794 CGGAGCCGGGCGGGGCGGCCCGG - Intergenic
1087795662 11:102452811-102452833 CGCAGCCGGGGCGGCGGGGCCGG + Exonic
1089065559 11:115659606-115659628 CGGGCACTGCCCGGGGGGGCGGG - Intergenic
1089243137 11:117098447-117098469 GGGAGCCGGCTCGGGGGAGGGGG + Intergenic
1090817791 11:130314453-130314475 CGGCGGCGGCCCGGGGGGAGGGG + Exonic
1091286636 11:134411978-134412000 CGGGGCCGGGCGGGGCGGGCGGG - Intergenic
1091286648 11:134411997-134412019 ACGAGCCGGGCCGGGGCGGCGGG - Intergenic
1202807822 11_KI270721v1_random:14422-14444 CGGAGCAGGCCGGGGTGGGCAGG + Intergenic
1091450764 12:570711-570733 CAGAGCTGGTCCGGGTGGGCTGG + Intronic
1091823113 12:3491077-3491099 GGGGGCGGGCCCGGGGGCGCTGG + Intronic
1094682685 12:32679689-32679711 CGGAGCCGGCGCGGCGGGCCTGG + Intronic
1096241330 12:49961800-49961822 CGGGGCCGGCGCGGGGGGGCAGG - Intergenic
1096773964 12:53953075-53953097 CGGGGCCGGCTCCTGGGGGCGGG + Intergenic
1097190391 12:57216784-57216806 CGGAGCCGGCGCTGGGGGCGGGG - Exonic
1098450095 12:70609990-70610012 CGCAGCCCGCCCGGGGCGGCAGG - Intronic
1100186530 12:92145548-92145570 CGGGGGCGGCCCGGGGCGGCTGG + Exonic
1101057034 12:100928173-100928195 GTGAGCGGGGCCGGGGGGGCTGG + Intronic
1102056520 12:109900476-109900498 CGCAGGCGGCCCGCGCGGGCGGG + Intronic
1102254007 12:111405878-111405900 CGGAGCCCGGCGGGGGAGGCCGG - Intergenic
1102256433 12:111418201-111418223 CGGCGGCGGCCCCGCGGGGCTGG + Exonic
1102457166 12:113077955-113077977 CGGCGCGGGCTCGGCGGGGCCGG - Exonic
1102575849 12:113855639-113855661 AGGAGCCGGCCCTGAGAGGCTGG + Intronic
1103407773 12:120687581-120687603 CGCAGCCGGCCGGGGGCTGCGGG + Intronic
1103719686 12:122966542-122966564 CGGAGCCTCCCGGGAGGGGCGGG + Intronic
1103852636 12:123943316-123943338 GGGAGCAGGCCCGGGCAGGCGGG - Intronic
1104804770 12:131578640-131578662 AGGAGCCAGCACGGGAGGGCTGG + Intergenic
1104854341 12:131894977-131894999 CGCAGGCGGGCCGGGGGCGCGGG - Exonic
1106517170 13:30465413-30465435 CGGAGCGCGGCCGGGGCGGCGGG - Intronic
1109284830 13:60397531-60397553 CGGAGCCGGCCCGAAGGGCCCGG - Intronic
1110860498 13:80341003-80341025 CGGAGGCGGCGCGGGGGCGCGGG + Intergenic
1111396227 13:87672428-87672450 CGGAGCCGGGCGGGGCGGGGAGG - Intergenic
1113494060 13:110714024-110714046 AGGAGCCGGCGGGGGGGCGCCGG + Intronic
1113651382 13:112036360-112036382 CGGAGCCGTCACGGTGGGCCTGG - Intergenic
1113748901 13:112765148-112765170 CAGAGCCGGGGCGGGGGGGAGGG - Intronic
1114525704 14:23365939-23365961 CGGAGCCGGCGCCGGGTGCCAGG - Intergenic
1116886973 14:50231420-50231442 CGGAGGCGGCGCCGGCGGGCTGG + Exonic
1117722036 14:58637886-58637908 AGGGGCCGGCGCGGGGAGGCGGG + Intronic
1119520192 14:75279253-75279275 CGGTGCCGGCTCGGGGGCTCGGG + Intronic
1120190666 14:81436560-81436582 GGGAGCCGGGGCGGGGGGACTGG + Intergenic
1122220828 14:100238518-100238540 CGGCCCCGGCCCGAGGCGGCGGG + Intronic
1122399564 14:101458767-101458789 CGGAGCCCTCCCGGGCGGGCGGG - Intergenic
1122582316 14:102778098-102778120 CCGGGCCGGCCGGGGGGGCCCGG + Intronic
1122606658 14:102951154-102951176 GGGAGGCGGCCCGGGCTGGCAGG - Intronic
1122645174 14:103189293-103189315 CGGAGCTGGACTCGGGGGGCGGG - Intergenic
1122658639 14:103279520-103279542 CGGGGCCGTCCCGCGGGTGCTGG + Intergenic
1122719865 14:103716018-103716040 CGGGGCCGGGCCGGGGCGGCGGG - Intronic
1122768227 14:104085674-104085696 CGGAGGAGGCCCGGGGCGCCGGG - Exonic
1122833755 14:104421115-104421137 GGGTGCCGGACCAGGGGGGCCGG - Intergenic
1122959290 14:105087269-105087291 GGGAGCCCGCCCTGGGGGCCTGG + Intergenic
1122959384 14:105087549-105087571 CGGAGCCTGCCCCGCCGGGCGGG - Intergenic
1122981326 14:105193551-105193573 CTGGCCCGGCCCCGGGGGGCTGG - Intergenic
1122993297 14:105248974-105248996 CGGCGCTGGCGCGGGGGCGCTGG - Exonic
1123068387 14:105629343-105629365 CGGAGCCAGCACGGGGGAGGTGG - Intergenic
1123072398 14:105648148-105648170 CGGAGCCAGCACGGGGGAGGTGG - Intergenic
1123092407 14:105747667-105747689 CGGAGCCAGCACGGGGGAGGTGG - Intergenic
1125534630 15:40436197-40436219 GGGAGCTGGGCCGGGTGGGCTGG - Intergenic
1125689620 15:41585526-41585548 CGGTGGCGGCCCGTGGGCGCGGG + Intergenic
1126777548 15:52112604-52112626 TGGCGCCGGCTCGGGGGTGCCGG + Exonic
1126837061 15:52678714-52678736 CGGAGCCGGCCGCGGAGGACTGG - Intronic
1127117540 15:55743033-55743055 CGGAGCCGGAGCGGGGAGCCAGG - Intronic
1128344132 15:66842828-66842850 CGGCGCCGGCGCGGGCGGGGAGG + Intergenic
1128374708 15:67066417-67066439 CGGGGCCGACCCAGTGGGGCTGG + Intronic
1129162245 15:73753228-73753250 CGGGGCGGGCCGGGGGCGGCCGG - Intergenic
1129676516 15:77634799-77634821 AGGAGGCGGCGCGGGAGGGCGGG - Intronic
1129853732 15:78810457-78810479 GGAGGCCGGCCCGGCGGGGCGGG + Intronic
1129854040 15:78811544-78811566 CGGGGCCGGCCGGGGCGGGGCGG - Intronic
1130076578 15:80695241-80695263 CGGGGCCGGCCCGGCGGGCGCGG - Intronic
1131367484 15:91853204-91853226 CGGAGGCGCCCCCGCGGGGCTGG - Intergenic
1131484592 15:92809359-92809381 CGTGGCCGGCCCGGAGGGACAGG + Intronic
1131517625 15:93089346-93089368 CGGGGCCGGCAGGGAGGGGCGGG + Intergenic
1131827977 15:96334918-96334940 CCCAGCAGGCCCGGGGGGCCTGG - Intronic
1132092462 15:98957319-98957341 CGGCCCCGGCCCTGGGGTGCTGG + Exonic
1132453668 16:10731-10753 CGGCGCCGGCCTGGGGGCGGGGG + Intergenic
1132482249 16:172592-172614 CGGGGCCGGCCCGTTGGGGTCGG - Intergenic
1132483097 16:176396-176418 CGGGGCCGGCCCGTTGGGGTCGG - Intergenic
1132498740 16:275642-275664 CGGGGCGGGCCGGGGAGGGCCGG + Intronic
1132565461 16:620615-620637 TGGAGCCCGTCGGGGGGGGCTGG - Intronic
1132604571 16:788408-788430 CGGGGGCGGGCCGGGGGGGGGGG - Intergenic
1132629396 16:909715-909737 CGCAGCTGCCCCGGGGGGACAGG + Intronic
1132657828 16:1048683-1048705 CGGGGCTGGGCCGGGGAGGCGGG + Intergenic
1132815909 16:1826522-1826544 CGGAGCGGGCGCGGGGCCGCGGG - Intronic
1132828895 16:1918138-1918160 GGGGGCCGGCGCGGGGGCGCGGG + Exonic
1132850002 16:2020628-2020650 CGGAGGCGCCACGGGCGGGCGGG - Exonic
1132932883 16:2467846-2467868 CAGACCCGGCCCGGGGGGCGAGG - Intergenic
1133136818 16:3717785-3717807 CGCAGCCGGCCAGCGTGGGCCGG - Intergenic
1133219892 16:4315602-4315624 GGGAGGTGGCCTGGGGGGGCGGG - Intronic
1134014590 16:10879361-10879383 CGGAGTCGGCCAAGGGTGGCCGG - Intronic
1136110844 16:28063021-28063043 CCGCGCCGCCCCGGGGGAGCCGG + Intronic
1136242116 16:28951056-28951078 CGGTGCCGGCCGAGGGGGTCGGG + Exonic
1136419531 16:30123180-30123202 CGGCGGCGGCTCAGGGGGGCGGG - Exonic
1138023145 16:53502835-53502857 GGGACCCGGCCGGGGAGGGCGGG + Intronic
1138105235 16:54284423-54284445 CGGAGCTGGCCGGGAGGGGCAGG - Intronic
1138594948 16:58024979-58025001 CGGAGTCGGCGCGGGGCGGGTGG - Intergenic
1139475078 16:67199065-67199087 CGGGGCCGCCTCGGCGGGGCGGG + Intergenic
1139826639 16:69762437-69762459 CGGGGCGGGCCGGGGGCGGCGGG + Intronic
1140442613 16:74999242-74999264 CGGAGGAGGGCCGGGGGCGCCGG - Exonic
1141054817 16:80804715-80804737 CGAAGCCGGCCCGGGGTGGCGGG - Intergenic
1141538644 16:84700460-84700482 GGGAGGCGGCCCGGGGGCTCCGG + Intronic
1141840190 16:86568854-86568876 CGGAGCGGGCCGGGGAGGGGAGG - Exonic
1141972264 16:87492282-87492304 CGGGGGCGGCCGGGGGGCGCCGG + Intergenic
1142032778 16:87846758-87846780 CGGAGCAGGCCTGGGTGGGTGGG - Intronic
1142037217 16:87869607-87869629 CCGAGCTGGGCCGAGGGGGCGGG - Intergenic
1142279769 16:89141725-89141747 GGGAGCCGGCCCTGTGGTGCTGG + Intronic
1142426933 16:90006463-90006485 GGTAGCCGGCCCGGGGCAGCGGG + Exonic
1142618120 17:1148473-1148495 CGGTCCATGCCCGGGGGGGCTGG - Intronic
1142631716 17:1229850-1229872 CGGAGCCGCCGGGGGAGGGCGGG + Intergenic
1142876206 17:2853419-2853441 CGGGGCCGGGCCGGGGAGGGCGG + Intronic
1143331684 17:6141423-6141445 GGGAGCTGGCCTGGGGTGGCTGG + Intergenic
1143598519 17:7929580-7929602 AGGATCGGGCCCGCGGGGGCGGG + Intronic
1143742871 17:8966629-8966651 TGGTGCCGGCCAGGGAGGGCGGG - Intergenic
1144500839 17:15786216-15786238 CGGCGGCGGCTCGGGGGTGCTGG - Intergenic
1144500852 17:15786243-15786265 GGGGGGCGGCCCGGGGCGGCGGG - Intergenic
1144759365 17:17698638-17698660 CTGAGCTGGCCTGGGGGTGCAGG - Intronic
1145163000 17:20588878-20588900 CGGCGGCGGCTCGGGGGTGCTGG - Intergenic
1145163013 17:20588905-20588927 GGGGGGCGGCCCGGGGCGGCGGG - Intergenic
1145214775 17:21043129-21043151 CGGTGCCGGCCGGGAGGGGGGGG - Intronic
1145935366 17:28711815-28711837 TGGAGCCGGGCTGGGGAGGCCGG - Exonic
1146393643 17:32444638-32444660 CCGAGCTGGGCCGGCGGGGCCGG - Intronic
1146393674 17:32444732-32444754 GGGGGCCGGGCCGGGGGCGCAGG + Intronic
1147250713 17:39151328-39151350 GGGAGCCGGCCCGGGTGGGCCGG - Intronic
1147313250 17:39607044-39607066 GGGAGCTGGGCCGGGGGGCCCGG - Intronic
1147420475 17:40319813-40319835 TGGAGGGGGCCGGGGGGGGCGGG + Intronic
1147705636 17:42423115-42423137 CGGGACCGGCCGGGTGGGGCTGG + Exonic
1147740795 17:42670102-42670124 CGGGCCCGGCGCGGCGGGGCCGG - Exonic
1147740797 17:42670107-42670129 CGGAGCGGGCCCGGCGCGGCGGG - Exonic
1147754877 17:42761448-42761470 CGGAACGGGCCCTGGGGTGCGGG + Intronic
1147970769 17:44218479-44218501 CGGAGCCGGGCTGCAGGGGCTGG - Intronic
1148048719 17:44759087-44759109 CGGAGCCGGGGCGGGGGCGCGGG - Exonic
1148262118 17:46193122-46193144 CGCAGCCCGGCCGGGAGGGCGGG + Intronic
1148356512 17:46979089-46979111 AGGAGCCGGTCCGAGGGGTCCGG - Exonic
1148542660 17:48492733-48492755 CGGAGCCGGGCCGGCAGCGCTGG + Intergenic
1148551917 17:48555666-48555688 CGGGGCGGGGGCGGGGGGGCGGG - Intronic
1150373667 17:64662376-64662398 CGGGGCCGGCGGGGCGGGGCGGG + Intergenic
1150983448 17:70169319-70169341 CGGAGCCCGGCCGGGGAGTCGGG - Intronic
1151414583 17:73952923-73952945 GGGAGCCGGCCGGAGGGAGCCGG - Intergenic
1151535938 17:74738744-74738766 TGGGGCAGGCCCGGGGAGGCTGG - Intronic
1151572978 17:74936361-74936383 CGGAGCCGGCCCTGCGCTGCTGG + Intronic
1151748664 17:76024666-76024688 CGGAGCCGGGGAGGTGGGGCAGG + Intronic
1151783840 17:76265644-76265666 CGGGGCCGGGCCGCGGGGGTCGG + Intronic
1152239518 17:79154136-79154158 TGGAGCCAGCCAGGTGGGGCGGG - Intronic
1152313922 17:79568836-79568858 CGGAGCAGGTCCTGGGGGTCTGG - Intergenic
1152362354 17:79838721-79838743 CGGGGCCGAGCCGGGGAGGCCGG - Intronic
1152535909 17:80950261-80950283 AGGAGCCGGCAGAGGGGGGCTGG - Intronic
1152586399 17:81191370-81191392 CGGAGCCGGCCCGCGGGGCCAGG + Intronic
1152663120 17:81552141-81552163 GAGCGCCGGCCCGCGGGGGCGGG - Intronic
1152697497 17:81804314-81804336 CGGGGCGGGCGCGGCGGGGCCGG + Intronic
1152718521 17:81911296-81911318 AGCAGCCGGGCCCGGGGGGCAGG - Exonic
1152910412 17:83002227-83002249 CTGAGCTGCCCCGTGGGGGCAGG - Intronic
1153515166 18:5895444-5895466 CGGCGGCGGCTCGGGGCGGCCGG + Exonic
1155169963 18:23259989-23260011 CGGAGCCAGCCTAGGGGGCCCGG + Exonic
1155519855 18:26656931-26656953 CGGAGCGGCCGCGGGGAGGCTGG + Intronic
1156350366 18:36297478-36297500 CGGAGGCGGGGCGGGGAGGCCGG - Intergenic
1157492824 18:48136251-48136273 CGGAGACGGCCCGGTGTGGGTGG - Intronic
1157496777 18:48162007-48162029 CGGCGCCTGCCCGGGCGGGCGGG + Intronic
1157529606 18:48409731-48409753 CGGAGGCGGAGTGGGGGGGCCGG + Intronic
1157849154 18:51030778-51030800 ACGAGCCGGGCCGGGCGGGCCGG + Intronic
1158976522 18:62715808-62715830 CGGCGGCGGCCGGGGGCGGCCGG + Exonic
1159511246 18:69400822-69400844 GGGGGCGGGCCGGGGGGGGCGGG - Intergenic
1160147915 18:76379345-76379367 CGGTGCCTGCCCCGGGTGGCGGG - Exonic
1160500491 18:79399410-79399432 GGGAGCCGGCCCGGGCGGAGGGG - Intronic
1160592533 18:79952145-79952167 CGGGGCCGTCGCCGGGGGGCCGG + Intergenic
1160718733 19:588553-588575 CGGGGCCGGCGTGGGGGCGCAGG + Intergenic
1160791518 19:925794-925816 CGCAACCAGCCCGGGGGCGCTGG - Intronic
1160791834 19:926819-926841 CGGCGCCGGCCCCGGGCGGCGGG + Intronic
1160809948 19:1008994-1009016 CGAAGCCGGCCGCGGGGTGCAGG + Intronic
1160833044 19:1112225-1112247 CGGAGCTGGCCGGGGAGCGCCGG - Exonic
1160899172 19:1418547-1418569 TGGAGCCGGCGGGGCGGGGCGGG + Intronic
1160909773 19:1469147-1469169 CGGAGCCGGGCCCCAGGGGCCGG + Exonic
1160952763 19:1675535-1675557 GTGAGCCGGCCCGGGAGGACTGG + Intergenic
1161001773 19:1914364-1914386 GGGAACAGGCCCGAGGGGGCGGG - Intronic
1161072617 19:2270231-2270253 CGGGGTCGGCCTTGGGGGGCTGG + Intronic
1161072807 19:2270887-2270909 TGGAGCGGGGGCGGGGGGGCGGG + Intronic
1161115613 19:2495034-2495056 TGGAGCTGGCCCGGGCGGGACGG + Intergenic
1161267166 19:3369715-3369737 CAGAGCAGGCGCGGGGAGGCCGG - Intronic
1161397984 19:4054698-4054720 CGGCGGCGGCCGCGGGGGGCAGG + Exonic
1161484721 19:4529182-4529204 TGGACCTGGCCCGGAGGGGCCGG - Exonic
1161516685 19:4700330-4700352 GAGAGCCGGCACGGGGGGCCTGG + Intronic
1161664667 19:5568058-5568080 CAGGCCCGGCCCGGCGGGGCGGG + Intergenic
1161808748 19:6459628-6459650 TGGCGCCCGCCCGGGGGGGAGGG + Exonic
1162018304 19:7857275-7857297 CAGAGGCTTCCCGGGGGGGCGGG + Intronic
1162064430 19:8116648-8116670 AGGAGCCGGGACGGTGGGGCGGG - Intronic
1162079354 19:8209296-8209318 CGGGGCGGGGCCGTGGGGGCGGG - Intronic
1162470745 19:10871071-10871093 CCGGGCGGGCCCGGGGGGGTGGG + Intergenic
1162908868 19:13839153-13839175 CGGAGGCGGCCCAGGGAGGCTGG - Intergenic
1162959617 19:14118086-14118108 CGGGCCCGGGCCGGCGGGGCGGG + Intergenic
1162962502 19:14136302-14136324 CGGGGTCGGCCCGGGGGTGGGGG + Intronic
1163035183 19:14565693-14565715 GGCTGCCGGCCCGGAGGGGCAGG - Intronic
1163158155 19:15449971-15449993 CGGCGGCGCGCCGGGGGGGCGGG - Intergenic
1163243119 19:16076418-16076440 GGCAGCCGGCCCGGGGGGCGGGG + Intronic
1163370377 19:16897853-16897875 CCGGGCCGGGCCGGGGGTGCGGG + Intronic
1163556899 19:17998313-17998335 CGGGGCCGGGCCTGGGAGGCAGG - Exonic
1163635079 19:18433849-18433871 CGGCGTCGGGCCGGAGGGGCTGG + Intronic
1163654129 19:18535810-18535832 AGGAGCCGGCCCAGGAGGGAAGG + Intronic
1163665849 19:18603878-18603900 CGGGGGCGGCCGAGGGGGGCGGG + Intronic
1164648140 19:29873752-29873774 CGGCGCGGGCGCGGGGGCGCGGG - Intergenic
1165058544 19:33194205-33194227 CGGAGGCGGCTGGGGCGGGCCGG - Intronic
1165058725 19:33194733-33194755 CGGAGCCGGAGCCGCGGGGCAGG + Exonic
1165427866 19:35755710-35755732 CGCCGCCGGGCCGGAGGGGCGGG - Intronic
1166094145 19:40529306-40529328 CGGAGTCGGCGTGGGCGGGCAGG - Intronic
1166106371 19:40600096-40600118 CGGCGGCGGCCCCGGGGGCCAGG + Exonic
1166245377 19:41522076-41522098 CGGAGGGGGCCCGGGCGGGCCGG - Intergenic
1166809355 19:45506639-45506661 CGGAGCCGGCGTGTGGGGGCGGG + Intronic
1167142471 19:47661464-47661486 GGGAGCCGGGCCGGGGAGGAGGG + Intronic
1167311250 19:48739139-48739161 CTGGGCCGGCCCGCGGCGGCGGG - Exonic
1167412990 19:49355965-49355987 CAGAGCCTGCCCGTGGGGGTGGG + Exonic
1167648604 19:50718476-50718498 CGGAGCCGGCCCGGGGGGGCTGG - Intronic
1167738757 19:51311857-51311879 CGGAGCCGGGCCCCGGGCGCAGG - Exonic
1168239446 19:55081875-55081897 AGGAGCCGGCGCCGGGCGGCTGG + Exonic
1168280827 19:55304679-55304701 TGGAGCGGGCACTGGGGGGCGGG - Exonic
925012633 2:497008-497030 CGGAGCCAGCACGAGGGGTCAGG - Intergenic
925068865 2:950876-950898 CGGAGCCGGCAGAGGGGCGCGGG + Exonic
926250943 2:11155290-11155312 CGGGGCGGGCCCGGGCGGGAGGG + Intronic
926250960 2:11155319-11155341 CGGGGCGGGCCCGGGCGGGAGGG + Intronic
927125962 2:20012600-20012622 GGGAGGCGGCGCGCGGGGGCCGG + Exonic
927713787 2:25340848-25340870 CGGGCCCGGGCCGCGGGGGCCGG - Intronic
927713987 2:25341304-25341326 CCGCGGCGGCCCGGGGGAGCGGG - Intronic
928127238 2:28625298-28625320 CGCAGCCGGCCCTGGGGTGAGGG - Intronic
928928067 2:36598181-36598203 CGGGGCCGGGCTGGGCGGGCTGG - Exonic
929452600 2:42047600-42047622 CGGAGCCGGCCGGGCGGAGTGGG - Intergenic
929511373 2:42568488-42568510 CGGGGGAGGCCCGGGGAGGCTGG - Intronic
929857868 2:45651323-45651345 CCGATCCGGCTCGGGGGCGCAGG - Intronic
930028858 2:47046231-47046253 TGGAGCCGCCCTGGTGGGGCAGG + Intronic
931762888 2:65432384-65432406 CGGGGTCGCCCCCGGGGGGCCGG + Intronic
932158202 2:69437396-69437418 CGGCGACGGCCAGGCGGGGCTGG - Exonic
932405903 2:71512560-71512582 AGGACCCAGCCCGGGGTGGCTGG + Intronic
932699952 2:73985319-73985341 CTGAGCCGGGCGGGGGTGGCGGG + Intergenic
934664856 2:96163233-96163255 CTGAGCAGGCCAAGGGGGGCAGG + Intergenic
934978333 2:98821911-98821933 CGACGCCGGCCCGGGAGAGCGGG - Exonic
935196681 2:100820380-100820402 CGGAGCGGCCCCGCGGGGCCGGG - Exonic
935265108 2:101387184-101387206 CGGCGCCCGCCCGGGGCCGCAGG + Exonic
935349722 2:102142808-102142830 CGGCGCCGGCCGGGAGGAGCCGG + Exonic
935918725 2:107986623-107986645 CGGAGCGGGGCCGGGCGGTCAGG - Exonic
936174248 2:110205065-110205087 CGGGACCGGCCCGGGCGGGGCGG - Intronic
936412974 2:112276281-112276303 CGGAGCCCGCCCGGGGGGCGGGG - Intronic
936954765 2:118013413-118013435 TGGACCCGGGCCGGGGCGGCGGG - Intronic
938895139 2:135742146-135742168 CGCAGCCGTCCCTGGGGCGCGGG - Intronic
940316703 2:152335099-152335121 CGGAGCCGGGCCGGGGGCGGGGG + Intergenic
942453558 2:176123071-176123093 CAGAGGCGGCCAGGGGCGGCGGG - Exonic
942681391 2:178480763-178480785 CGGAGGGGGCCCGGGCGGGCCGG + Exonic
945683061 2:212936801-212936823 GGGAGCAGGCACGGGGGGACTGG + Intergenic
947992374 2:234497380-234497402 CGGCTGCGGCCCGGAGGGGCAGG - Intergenic
948206918 2:236167410-236167432 CGCAGCCGGGACGAGGGGGCGGG - Intronic
948368941 2:237475337-237475359 CGGGGCCGGGCCGCGGGGGGCGG + Intergenic
948655006 2:239471091-239471113 AGGAGCTGGCCCAGGAGGGCAGG - Intergenic
948983870 2:241508460-241508482 CAGAGCGGGCCGGGGGAGGCCGG - Exonic
949014756 2:241702671-241702693 CCGAGTCGGCCCTGGTGGGCGGG + Intronic
949069227 2:242013422-242013444 CGGAGTCTGCCCGGGCTGGCAGG - Intergenic
1168769788 20:408005-408027 GGGGGCGGGGCCGGGGGGGCCGG - Intronic
1168814604 20:728200-728222 CGGACCCGGCCCGGCCGGGAAGG - Intergenic
1168855067 20:1002353-1002375 AGGAGCCGGCGCGGCGGGGGCGG + Intergenic
1169074424 20:2752305-2752327 CGGTGCCGGCCGGGGAGGGGCGG - Intronic
1169117149 20:3072940-3072962 CGGAGCGGGCCTGGGGGGAGGGG + Intergenic
1169145667 20:3250651-3250673 CGGAGCCCGCCCGTGAGAGCGGG - Exonic
1170524756 20:17226836-17226858 CGGAGGCGGCCGGGCCGGGCCGG + Intronic
1170596098 20:17806950-17806972 CCCAGCCGCCCCGGGGGGGCAGG + Intergenic
1171010330 20:21505973-21505995 GGGAGGCGGCCCGGGAGCGCGGG - Intergenic
1171361616 20:24590268-24590290 TGGGGCCGGCGCGGCGGGGCTGG + Intronic
1172125936 20:32625359-32625381 CTGAGCCAGCCAGGGAGGGCTGG + Intergenic
1172587091 20:36092600-36092622 GGGAGCCGGCCGGGGCGGGGCGG + Intronic
1172662130 20:36574702-36574724 CGGAGTCGGCCCGGGGTGTGGGG + Intronic
1172781345 20:37438532-37438554 AGGAGCGGGGCCGGTGGGGCGGG + Intergenic
1174060172 20:47826885-47826907 GGGAGCAGGCCCCGGGGGGATGG + Intergenic
1174071721 20:47904484-47904506 GGGAGCAGGCCCCGGGGGGACGG - Intergenic
1174172350 20:48625520-48625542 CGGAGCCATCCCGAGGGAGCCGG + Exonic
1174204343 20:48828025-48828047 CGGAGGCAGCGCGCGGGGGCCGG + Intergenic
1175210482 20:57350923-57350945 GGGGGGCGGCGCGGGGGGGCGGG + Intergenic
1175230692 20:57471527-57471549 CTGAGTGGGCCCGGGGGGCCTGG + Intergenic
1175443837 20:59007356-59007378 CGGAGCCGGGCGGGGAGGGCAGG - Intergenic
1175911382 20:62406963-62406985 CTGAGCAGGCCCTGGGGCGCGGG + Exonic
1175994197 20:62805066-62805088 CGCAGCCGGGCGGGGGGCGCCGG - Intronic
1176016870 20:62938299-62938321 CGGGGCCGGGCCGGGCGGGCAGG + Intronic
1176048050 20:63102805-63102827 CGCAGCGGGGCCGGGTGGGCTGG - Intergenic
1176130849 20:63496215-63496237 GGAGGCCGGCCCTGGGGGGCAGG - Intronic
1176131821 20:63499475-63499497 CGGAGCCGGCAGGCGGGGGAGGG + Intergenic
1176160177 20:63643694-63643716 CGGAGGCGGCCCACGGGGACAGG - Intronic
1176198021 20:63846531-63846553 TGGAGCCGGGCCGGCGGGCCGGG + Intergenic
1176243007 20:64083746-64083768 CGGAGCCGGCCGGGGCGGGGCGG - Intronic
1176296457 21:5075962-5075984 CAGAGCAGGCCCCGGGGGGCAGG + Intergenic
1176385947 21:6138599-6138621 CGGAGCCGGCGAGAGGGGGCCGG + Intergenic
1176548464 21:8211884-8211906 GGGAGCCGGCGCGGCGGGGCCGG - Intergenic
1176556358 21:8256092-8256114 GGGAGCCGGCGCGGCGGGGCCGG - Intergenic
1176567395 21:8394919-8394941 GGGAGCCGGCGCGGCGGGGCCGG - Intergenic
1176575297 21:8439134-8439156 GGGAGCCGGCGCGGCGGGGCCGG - Intergenic
1176952497 21:15064430-15064452 CGGGGCCGGACTCGGGGGGCCGG - Intronic
1178948394 21:36966681-36966703 CGGGGCCGGGCCTGGGGCGCTGG - Intronic
1179737526 21:43399653-43399675 CGGAGCCGGCGAGAGGGGGCCGG - Intergenic
1179860592 21:44186159-44186181 CAGAGCAGGCCCCGGGGGGCAGG - Intergenic
1180105469 21:45615611-45615633 CAGAGCAGCCCCGGGGGGGCAGG + Intergenic
1180177724 21:46098436-46098458 CGGAGCCGGCCTGGGCGGGGTGG + Intronic
1180230591 21:46424686-46424708 GGGAGCAGGGCCGGGGGAGCAGG - Intronic
1180949381 22:19714393-19714415 CCAGGGCGGCCCGGGGGGGCGGG - Intergenic
1181361096 22:22336740-22336762 CAGGGCCTGTCCGGGGGGGCTGG + Intergenic
1181514335 22:23402600-23402622 CTGGGCCGGCCAGGGCGGGCCGG + Intergenic
1182294904 22:29306978-29307000 CGGATCCTGCCCGGAGGGGGCGG - Intronic
1183856078 22:40636247-40636269 CCGGGCCGGGCCGGGCGGGCGGG - Intronic
1184035290 22:41915109-41915131 CGGCGCGGGCTCGGGCGGGCGGG + Intergenic
1184523255 22:45007896-45007918 CGGAGGGGGCCCGGAGGGGGGGG + Intronic
1184523632 22:45009365-45009387 TGGAGCCTGCCCGGGGGCGGGGG - Intronic
1184680575 22:46070663-46070685 GGGAGCCGGCCGGCGGAGGCAGG - Intronic
1184685645 22:46095460-46095482 CCCAGCCAGCCCGGGGCGGCAGG + Intronic
1185289066 22:50014959-50014981 CGGAGCGGGTGCGGGGGTGCTGG + Intergenic
1185409467 22:50674499-50674521 GGGAGGGGGCCGGGGGGGGCCGG - Intergenic
1203253348 22_KI270733v1_random:128189-128211 GGGAGCCGGCGCGGCGGGGCCGG - Intergenic
1203261402 22_KI270733v1_random:173267-173289 GGGAGCCGGCGCGGCGGGGCCGG - Intergenic
950400972 3:12768924-12768946 CGGGGCGGGGCGGGGGGGGCGGG + Intronic
950759214 3:15206102-15206124 AGGAGCCGGGCCGCGGGGGCGGG - Intergenic
951039046 3:17967888-17967910 CGGGGCCAGGCCGGGAGGGCGGG + Intronic
951543696 3:23806253-23806275 CGGGGCCCGCCCGCGGGGGATGG + Intronic
951898348 3:27632771-27632793 GGCAGCCGGCCCGGGGGGCGGGG + Intergenic
954333668 3:49903918-49903940 CGGAGTCGGGCCGTGGGGGCGGG + Intronic
954615603 3:51967511-51967533 AGGGGCCGGGCCGGGCGGGCCGG - Intronic
954639749 3:52090848-52090870 AGGAGCCTGGCCTGGGGGGCAGG + Intronic
954717536 3:52533923-52533945 CGGACCCGGCGGGGCGGGGCGGG + Intronic
956420230 3:69080015-69080037 CGCAGCGGGCCCGGGGGGCTGGG - Intronic
959462504 3:106644107-106644129 GGGAGCGGGCGCGGGGGAGCAGG - Intergenic
960582623 3:119294087-119294109 AAGAGCCGGCTCGGCGGGGCAGG + Intergenic
960884927 3:122384151-122384173 CGCAGGCGGCGCCGGGGGGCGGG - Intergenic
961645843 3:128392414-128392436 CGGGGCCTGCCCAGGGAGGCAGG + Intronic
961821348 3:129577247-129577269 AGGAGCAGGCCCTGGGGAGCAGG + Intronic
961831830 3:129626986-129627008 CCCAGCCGGCCTAGGGGGGCGGG + Intergenic
962714480 3:138115091-138115113 CGGAGCAGGCCGAGGGGGCCGGG + Intronic
966440819 3:179942422-179942444 CGGAGGCGGCTGGGCGGGGCTGG + Intronic
966886425 3:184380118-184380140 CGGCGCCGGGCCGGGCGGGGCGG - Exonic
967028646 3:185586025-185586047 CGGAGCCGGCCCGTGGGACAAGG - Intronic
967390314 3:188948359-188948381 AGGGGCTGGCCCGGAGGGGCTGG - Intronic
967732339 3:192917898-192917920 GGGAGGAGGCCCAGGGGGGCGGG - Exonic
968078457 3:195830031-195830053 GGGAGCCGGCCCAGAGGAGCTGG - Intergenic
968092981 3:195909611-195909633 CGGGGGCGGCCCGGGGCGGGAGG - Intronic
968133653 3:196207548-196207570 CGGAGTCGGGCCTGGGGGGCGGG - Intronic
968133678 3:196207598-196207620 CGGAGTCGGGCCTGAGGGGCGGG - Intronic
968133725 3:196207695-196207717 CGGAGTCGGGCCTGAGGGGCGGG - Intronic
968133748 3:196207743-196207765 CGGAGTCGGGCCTGAGGGGCGGG - Intronic
968178171 3:196568989-196569011 CGGCGCCGGCCCCGGGGGCTGGG + Exonic
968729273 4:2262026-2262048 CGGAGCCGGCCGGAGCGGGCCGG - Exonic
969360295 4:6658915-6658937 CGGAGGCGGCGCGGATGGGCAGG + Intergenic
969362677 4:6674502-6674524 CGGAGGCGGCGCGGATGGGCAGG + Intergenic
973279143 4:48341454-48341476 CTGGGCCGGCCCGCGGGGGGCGG + Exonic
974506527 4:62781275-62781297 CAGAGCCAGCCCGTGGGGGCAGG - Intergenic
976751665 4:88456361-88456383 CGGAGCGGGCACGAGGGGGGTGG + Intergenic
978463149 4:108979964-108979986 CGAAGCAGGCCCGGGGGGAAGGG + Intronic
979311824 4:119212544-119212566 CGGAGCCCGCTCCGAGGGGCGGG + Intronic
981474995 4:145179755-145179777 CGGGGACGGCCCGGCGGGTCTGG - Intronic
981550452 4:145937210-145937232 CGGAGAGGGACCGGGGGCGCGGG + Intronic
982202825 4:152975768-152975790 AGGAGCCTCCCCAGGGGGGCTGG - Exonic
983904648 4:173169857-173169879 GGCAGCCGGCGCGGGGCGGCCGG - Intronic
984811228 4:183797797-183797819 CGGGGCTGGGCCGGGGGCGCGGG - Intergenic
985068389 4:186144822-186144844 CGGCGCCGGCGCGGGCGGGGCGG + Exonic
985451401 4:190065644-190065666 CGGAGGCGTCCGGGGGGCGCGGG - Intergenic
985659668 5:1150791-1150813 CAGAGCCTGCCCCGTGGGGCTGG + Intergenic
985963788 5:3324583-3324605 CTGACCCGGCGCGGTGGGGCTGG + Intergenic
993386346 5:87267761-87267783 CGGAGCGGGGGCGGGGGGCCGGG - Intergenic
995047903 5:107671093-107671115 CTGAGCCGGGCCCGGCGGGCCGG - Intergenic
996091435 5:119355809-119355831 CGGAGGCGACCTGGCGGGGCTGG - Intronic
997521283 5:134525894-134525916 TGGGGCCGGCGCGGGAGGGCGGG - Intronic
998130874 5:139650476-139650498 CGGAGCCGCCCCAGGGCCGCCGG + Intronic
998374589 5:141682281-141682303 GGGAACCGGCCGGGCGGGGCGGG - Intergenic
1001382058 5:171311654-171311676 CGCAGCCCGCCTGGGGGGTCCGG - Exonic
1001401865 5:171450847-171450869 GGGAGGCGGCCCAGGCGGGCAGG - Intronic
1001720851 5:173855880-173855902 CGGAGCCAGCCAGGGGGAGAGGG - Intergenic
1002071316 5:176680347-176680369 GGGAGCCGGCCCAGGCGGGTGGG - Intergenic
1002186668 5:177457900-177457922 CAGAGCCGGCCCAGGGAGGGAGG + Intronic
1002189991 5:177473170-177473192 CGGACGCGGCCCGGAGGCGCGGG - Exonic
1002190159 5:177473663-177473685 GGGAGCCGGCCGGCGGGGGGCGG + Intronic
1002541286 5:179907913-179907935 CGGAGCGGGCCGGGGCGGGGCGG + Intergenic
1002565560 5:180111331-180111353 CGGAGCCAGCCCAGGTGGGCAGG + Intronic
1002792628 6:447162-447184 CTGAGGCGGCCGGGAGGGGCTGG + Intergenic
1002898812 6:1393923-1393945 GGGAGCCGCCCCGGGAGAGCAGG + Intronic
1002925612 6:1604456-1604478 CGGAGCCGGCCCTTGGAGCCCGG + Intergenic
1003524474 6:6886356-6886378 CGGAGCAGGCCTGGTGGTGCAGG - Intergenic
1003942677 6:11044381-11044403 CGGCGCGAGCCCGAGGGGGCGGG - Intergenic
1005913004 6:30327032-30327054 CGGAGCCGGCCGGCGAGCGCAGG - Intronic
1005957021 6:30671371-30671393 TGGGGCCGGGCCGCGGGGGCAGG - Intronic
1006083594 6:31581255-31581277 CCGAGCCGGGCCGGGGGAGGAGG + Intronic
1006177508 6:32131302-32131324 CCGAGGCGGCGGGGGGGGGCGGG + Intergenic
1006414070 6:33893062-33893084 CGGGGCCGGGGCGAGGGGGCGGG + Intergenic
1006642730 6:35497137-35497159 CGGTGCTGGCCGGGAGGGGCGGG + Intergenic
1006806599 6:36793244-36793266 GGAAGCCGGCCCTGGAGGGCTGG + Intronic
1007390346 6:41546836-41546858 CGGAGCCCGCACGGAGCGGCCGG + Exonic
1007585101 6:42984628-42984650 CGGAGCCGGAGCGGGGCCGCAGG + Exonic
1007774979 6:44219788-44219810 CGGGGCGGGGCCGGGGGGCCTGG + Intronic
1007775717 6:44223461-44223483 CGGAGTCGCCGCGGGGTGGCAGG + Intronic
1012410232 6:98947991-98948013 CGGAGCCGGGGAGGAGGGGCGGG + Intronic
1013514917 6:110875996-110876018 CGGAGCCGGCGGAGCGGGGCGGG + Intronic
1015965466 6:138692706-138692728 CTGCGCCGGCCCGAGGCGGCGGG - Intergenic
1016597085 6:145814813-145814835 AGAAGCCGGGCCGGGTGGGCGGG - Intergenic
1017071013 6:150575727-150575749 AGGAGCTGGCCAGGGGGGACTGG + Intergenic
1017103139 6:150865877-150865899 CGGAGGCGGCGCGGAGGGCCCGG - Exonic
1017282210 6:152637105-152637127 CGGAGCCGGGCGCGGGGCGCGGG - Intronic
1017737946 6:157381020-157381042 GGGCGCCCGCCCGAGGGGGCTGG + Intergenic
1018686439 6:166307848-166307870 CGGAGCCTGCCGGCCGGGGCGGG + Exonic
1018876576 6:167827022-167827044 CGGAGGCGGCCGGCGGGGGGTGG + Exonic
1019530078 7:1498949-1498971 CGGGGGCGCCCCGGGGGGGTGGG - Intronic
1019735218 7:2647060-2647082 AGGGGGCGGCCCGAGGGGGCGGG + Intronic
1019803955 7:3108869-3108891 TGGAGCCAGCCCAGGGAGGCAGG + Intergenic
1020080262 7:5282894-5282916 CGGGGCCGGGCGCGGGGGGCGGG + Intronic
1022396127 7:29989477-29989499 CGGTGCTGGCCCGGGCGGGCTGG - Intronic
1023938821 7:44757381-44757403 TGCAGGCGGCCCGGGGGGCCTGG + Exonic
1024993590 7:55254785-55254807 CGGAGCCAGCCCAGGGCTGCCGG - Intronic
1025004789 7:55345162-55345184 CGGAGACGGCCCAGGGCTGCGGG - Intergenic
1025089669 7:56051786-56051808 CAGAGCCGGCGCGGCGTGGCCGG - Exonic
1025239089 7:57256685-57256707 TGGAGCTGTCCCGGGAGGGCTGG + Intergenic
1026522937 7:71132241-71132263 AGGCGCCTGCCCGGGGGAGCGGG + Exonic
1026909470 7:74083900-74083922 CGCCGCCGGCCCGGGGAGGCGGG - Intronic
1027421184 7:78019588-78019610 CGGACGCGGCGCGGGCGGGCGGG - Exonic
1029123211 7:98281758-98281780 CCGAGCCGGGCCGGAGCGGCGGG + Exonic
1029270786 7:99375361-99375383 CGGACCTGGCCCGGGGGAGGCGG - Intronic
1029483809 7:100827476-100827498 CGGAGCCGGGCGGGCCGGGCCGG + Exonic
1029495979 7:100895684-100895706 CGGGGCAGGCCCGGGGAAGCGGG + Intronic
1029896524 7:103989773-103989795 CCGAGCCAGCCCGAGAGGGCGGG - Intergenic
1030033473 7:105388992-105389014 CGGGGCCGGCGGGTGGGGGCGGG - Intronic
1031980702 7:128122507-128122529 GGGAGCCGGCCGGGGGGTGGGGG - Intergenic
1032002090 7:128272028-128272050 CTGACCCGGTCCGGGAGGGCTGG + Intergenic
1032125464 7:129189493-129189515 CGGAGCCGGGTCTGGGGGGCGGG + Intronic
1032195520 7:129786218-129786240 CGGAGCCTGCCCAGGGGACCAGG - Intergenic
1032525734 7:132577190-132577212 AGCAGCCCGCCCGGGGGGCCGGG - Exonic
1032787330 7:135211330-135211352 CAGAGGCGGCCCGAGGGAGCCGG - Intronic
1032819332 7:135510126-135510148 CTGATCCGGCCAGGAGGGGCGGG + Exonic
1033173946 7:139108551-139108573 CGGAGACGGACCGGGGGCCCAGG + Intronic
1033656912 7:143381080-143381102 CTGAGCCGGGCTGGGGCGGCGGG + Exonic
1034872565 7:154696850-154696872 AGGAGCCGGCCTCGGGGGGCCGG + Intronic
1035208967 7:157313796-157313818 CCGAGCCGGTCCGGAGAGGCAGG + Intergenic
1036664700 8:10730762-10730784 GGGAGGCGGCCCGGGGCAGCCGG - Intronic
1036930521 8:12951692-12951714 TGAAGGCGGCCCGGGGAGGCGGG + Intronic
1037529223 8:19757338-19757360 CGGCGGCGGCTCGGGCGGGCGGG + Intronic
1037620877 8:20562455-20562477 CGGGGCCGGGCGGGGGGGGCGGG - Intergenic
1037886715 8:22599554-22599576 GGGAGCGGGGCTGGGGGGGCGGG - Intronic
1037902168 8:22694675-22694697 CGCAGCCGGCCCGCGGGCGAGGG + Intergenic
1038304113 8:26383520-26383542 CGGAGCCGGGCGGGGCGGGGCGG + Intronic
1038304126 8:26383540-26383562 CGGGGGCGGGCCTGGGGGGCGGG + Intronic
1038444361 8:27593073-27593095 CTGCGCGGGGCCGGGGGGGCGGG + Intergenic
1038577482 8:28717430-28717452 CGGTGCCGTCCCGGTGGTGCTGG + Exonic
1038798161 8:30727604-30727626 CGGGGGCGGCTCGGGCGGGCTGG - Exonic
1039843449 8:41309342-41309364 CGGAGGCGGCGCGGGCGGGGAGG + Exonic
1042695129 8:71547537-71547559 CGGAGGCTGCCCGGGCGGGCTGG + Exonic
1043873878 8:85463931-85463953 CGGGGGCGGCCCGGGGGAGGGGG - Exonic
1047998600 8:130358696-130358718 CGGGGAGGGACCGGGGGGGCGGG - Intronic
1048073173 8:131041617-131041639 CGGAACCGGGCCGGGGGTGGCGG + Exonic
1049211016 8:141386410-141386432 CAGAGCCGGCCTGGAGCGGCTGG - Intergenic
1049411360 8:142475367-142475389 CGAGGCCGGCCCGGGTGGGGAGG - Intronic
1049415222 8:142491960-142491982 GGGAGCCGGCCAGGAGGAGCAGG + Intronic
1049419579 8:142510843-142510865 CGGAGCCGCCGCTCGGGGGCCGG + Intronic
1049433622 8:142576374-142576396 CAGAGCCTGCCCGTGGGTGCAGG + Intergenic
1049442141 8:142614411-142614433 CGGAGCACGCCCGGGGAGGCAGG + Exonic
1049472181 8:142781369-142781391 CGCAGCTGGCCAGAGGGGGCCGG + Intergenic
1049537328 8:143188485-143188507 CTGAGTCTGCCCGGGGGGCCCGG - Intergenic
1049643922 8:143727748-143727770 CGGAGCCGGAGCGCAGGGGCGGG - Exonic
1049689573 8:143952791-143952813 CGGAGCCGGCTTGGGGGAGGCGG - Intronic
1049694088 8:143975236-143975258 CGGAGCCGGCGCAGCGGGGGTGG - Intronic
1049761453 8:144333730-144333752 GGGATCCGGGCCGGGGGGCCGGG - Exonic
1051774592 9:20621012-20621034 CCAAGCCGGGCCGGGCGGGCGGG - Intronic
1053066243 9:35071759-35071781 TGGAGCCGGGTCGGCGGGGCCGG - Intronic
1053142706 9:35691045-35691067 CGGAGCCGGGTCGTGGGGTCTGG + Intergenic
1053151942 9:35749128-35749150 CGGAGCCGGCCGGCGGGACCTGG - Exonic
1053617323 9:39781576-39781598 CGGAGCCAGCGGGGGGTGGCAGG - Intergenic
1054266843 9:62925861-62925883 CGGAGCCAGCAGGGGGTGGCGGG + Intergenic
1054550336 9:66595315-66595337 CGGAGCCAGCAGGGGGTGGCGGG + Intergenic
1054905937 9:70413664-70413686 GGGAGCCGGCTCAGAGGGGCCGG - Exonic
1056746760 9:89310437-89310459 CGGAGCCGGCGCGGTGGCGGCGG - Intergenic
1056773735 9:89497491-89497513 CGGGGCCGGACTGGGCGGGCCGG + Intronic
1057198161 9:93126621-93126643 TGCAGCCGGCCCGCTGGGGCTGG - Exonic
1057596576 9:96419347-96419369 CGGCGCCAGCCAGGCGGGGCTGG - Intergenic
1057631168 9:96720033-96720055 TGGTGCCGTCCCGGGGGTGCGGG + Intergenic
1058508849 9:105694546-105694568 TGGAGCCGGCGCGGAGGAGCGGG + Exonic
1058866600 9:109167018-109167040 CGGTGCGGGCCCGGGGGGCCGGG - Exonic
1059455672 9:114398563-114398585 AGGGGGCGGCCCGGGGGGGGCGG + Intergenic
1060811237 9:126612614-126612636 CGGAGCCGGGCGGGGGCGGAGGG - Intergenic
1060916905 9:127397328-127397350 CGGAGCGGACGCGGAGGGGCGGG - Intronic
1061293597 9:129665841-129665863 GCGAGCGGCCCCGGGGGGGCCGG - Exonic
1061348237 9:130043312-130043334 CGGACCCGGCCGGGGGAGCCCGG - Intergenic
1061365982 9:130172624-130172646 CGGGTCCGGCCCGGGGGGGCGGG + Exonic
1061879379 9:133561137-133561159 CGGAGCCTGCCGGTGGGGCCTGG + Intronic
1062472531 9:136712745-136712767 CAGAGGCGGCCGGGGGCGGCGGG - Intronic
1062493591 9:136821405-136821427 CGGTGCCGGGGCGGGGAGGCAGG + Intronic
1062532845 9:137009319-137009341 TGGGGCGGGCCCGGGGGGGGCGG - Intronic
1062534369 9:137015060-137015082 CGGGGCCCGACCTGGGGGGCTGG + Exonic
1062548934 9:137077274-137077296 CGGACCGGACGCGGGGGGGCTGG + Intergenic
1062567148 9:137168393-137168415 AGGAGGCGGCCCGAGGCGGCGGG - Exonic
1062595044 9:137295657-137295679 CGGACCGGGCCGGGGCGGGCGGG + Intergenic
1062696339 9:137877986-137878008 GAGAGCGGGCCCGGGGCGGCGGG + Exonic
1203469748 Un_GL000220v1:111336-111358 GGGAGCCGGCGCGGCGGGGCCGG - Intergenic
1203477569 Un_GL000220v1:155308-155330 GGGAGCCGGCGCGGCGGGGCCGG - Intergenic
1186485587 X:9932288-9932310 CAGAGCTGCCCCGGGAGGGCCGG + Exonic
1187419550 X:19122547-19122569 CGGAGCGGGCCGGGAGCGGCGGG - Exonic
1187900797 X:24025434-24025456 CGGGGCCCGCCCAGGGAGGCGGG + Intronic
1188003572 X:25002833-25002855 GGAAGCCCGCCCGCGGGGGCTGG - Intergenic
1188542656 X:31266957-31266979 AGGAGCCGGCGCGGGCGGGCCGG + Intronic
1189325263 X:40107731-40107753 CGGCGCGGGCCCTGGGGTGCGGG + Intronic
1189335582 X:40168923-40168945 CTGCGCCGGCCAGGGCGGGCGGG - Intronic
1190511067 X:51174975-51174997 CGGAGCCTGCCAGGGGTGGGGGG + Intergenic
1194133719 X:90112591-90112613 CGGAGCCGGGCGGGGGAGGACGG - Intergenic
1199976598 X:152898128-152898150 CCGGGCCGGGCCGGGGAGGCAGG - Intergenic
1200084791 X:153598889-153598911 CGGAGCGGGCCCGGCTGGCCAGG - Intronic
1200086887 X:153611420-153611442 CTGCCCCGGCCCGGGGGGGTGGG - Intergenic
1200786367 Y:7263922-7263944 CGGAGCCTGTCGGTGGGGGCGGG - Intergenic