ID: 1167650487

View in Genome Browser
Species Human (GRCh38)
Location 19:50725909-50725931
Sequence GCGTTTGTACGCGTGTACTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 25}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167650487_1167650496 30 Left 1167650487 19:50725909-50725931 CCGGAGTACACGCGTACAAACGC 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1167650496 19:50725962-50725984 TCTCTCGGCCTTTGGGACCCAGG No data
1167650487_1167650492 22 Left 1167650487 19:50725909-50725931 CCGGAGTACACGCGTACAAACGC 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1167650492 19:50725954-50725976 GTGCCCTCTCTCTCGGCCTTTGG No data
1167650487_1167650493 23 Left 1167650487 19:50725909-50725931 CCGGAGTACACGCGTACAAACGC 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1167650493 19:50725955-50725977 TGCCCTCTCTCTCGGCCTTTGGG No data
1167650487_1167650490 15 Left 1167650487 19:50725909-50725931 CCGGAGTACACGCGTACAAACGC 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1167650490 19:50725947-50725969 CTCCATCGTGCCCTCTCTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167650487 Original CRISPR GCGTTTGTACGCGTGTACTC CGG (reversed) Intergenic
1063055559 10:2500641-2500663 GCGTCTGAACGTGTGTACACTGG - Intergenic
1073061307 10:100735442-100735464 GCGTGTGCACGCGTGTGCGCGGG + Intergenic
1081995608 11:47361685-47361707 GCGTGTGTACGTGTGTACAAAGG + Intronic
1087048157 11:93861771-93861793 GTGTTTGTTGGCGTGTTCTCTGG - Intergenic
1103930879 12:124450155-124450177 GGGTTTGTCCGGGTGTGCTCTGG - Intronic
1104039552 12:125121000-125121022 GCACATGTACGCGTGTACACAGG - Intronic
1132403446 15:101527950-101527972 GTGTCTGCACACGTGTACTCAGG - Intergenic
1139719731 16:68842909-68842931 GCGTGTGTACGTCTGTACTTAGG + Intergenic
1167650487 19:50725909-50725931 GCGTTTGTACGCGTGTACTCCGG - Intergenic
931868419 2:66434930-66434952 GCGTTTGTGTGCGTGTGCCCTGG + Intronic
1175720449 20:61282885-61282907 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720450 20:61282924-61282946 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720451 20:61282961-61282983 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720452 20:61282998-61283020 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720453 20:61283037-61283059 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720454 20:61283076-61283098 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720455 20:61283115-61283137 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720456 20:61283154-61283176 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720457 20:61283193-61283215 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720458 20:61283232-61283254 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720459 20:61283271-61283293 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720460 20:61283310-61283332 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720461 20:61283340-61283362 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720462 20:61283379-61283401 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720463 20:61283418-61283440 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720464 20:61283457-61283479 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720466 20:61283494-61283516 GCATTTGCACGCGTGTGCTGTGG + Intronic
987871339 5:23621886-23621908 GGGTTTGTACCAGTGTCCTCAGG + Intergenic
1190789735 X:53687083-53687105 GGGTTTGCTCGCGTGAACTCTGG - Intergenic