ID: 1167650493

View in Genome Browser
Species Human (GRCh38)
Location 19:50725955-50725977
Sequence TGCCCTCTCTCTCGGCCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167650488_1167650493 -8 Left 1167650488 19:50725940-50725962 CCTTCACCTCCATCGTGCCCTCT No data
Right 1167650493 19:50725955-50725977 TGCCCTCTCTCTCGGCCTTTGGG No data
1167650487_1167650493 23 Left 1167650487 19:50725909-50725931 CCGGAGTACACGCGTACAAACGC 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1167650493 19:50725955-50725977 TGCCCTCTCTCTCGGCCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167650493 Original CRISPR TGCCCTCTCTCTCGGCCTTT GGG Intergenic
No off target data available for this crispr