ID: 1167650496

View in Genome Browser
Species Human (GRCh38)
Location 19:50725962-50725984
Sequence TCTCTCGGCCTTTGGGACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167650491_1167650496 -10 Left 1167650491 19:50725949-50725971 CCATCGTGCCCTCTCTCTCGGCC No data
Right 1167650496 19:50725962-50725984 TCTCTCGGCCTTTGGGACCCAGG No data
1167650487_1167650496 30 Left 1167650487 19:50725909-50725931 CCGGAGTACACGCGTACAAACGC 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1167650496 19:50725962-50725984 TCTCTCGGCCTTTGGGACCCAGG No data
1167650488_1167650496 -1 Left 1167650488 19:50725940-50725962 CCTTCACCTCCATCGTGCCCTCT No data
Right 1167650496 19:50725962-50725984 TCTCTCGGCCTTTGGGACCCAGG No data
1167650489_1167650496 -7 Left 1167650489 19:50725946-50725968 CCTCCATCGTGCCCTCTCTCTCG No data
Right 1167650496 19:50725962-50725984 TCTCTCGGCCTTTGGGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167650496 Original CRISPR TCTCTCGGCCTTTGGGACCC AGG Intergenic
No off target data available for this crispr