ID: 1167652567

View in Genome Browser
Species Human (GRCh38)
Location 19:50740943-50740965
Sequence GCGGCTCCTACTGTTGTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167652567_1167652571 10 Left 1167652567 19:50740943-50740965 CCTGGGACAACAGTAGGAGCCGC No data
Right 1167652571 19:50740976-50740998 GGCTTCTCCTCAGCAAATATGGG No data
1167652567_1167652570 9 Left 1167652567 19:50740943-50740965 CCTGGGACAACAGTAGGAGCCGC No data
Right 1167652570 19:50740975-50740997 TGGCTTCTCCTCAGCAAATATGG No data
1167652567_1167652573 28 Left 1167652567 19:50740943-50740965 CCTGGGACAACAGTAGGAGCCGC No data
Right 1167652573 19:50740994-50741016 ATGGGAAACAGAGAAAGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167652567 Original CRISPR GCGGCTCCTACTGTTGTCCC AGG (reversed) Intergenic
No off target data available for this crispr