ID: 1167653781

View in Genome Browser
Species Human (GRCh38)
Location 19:50749662-50749684
Sequence TCTGTCCAGCTCTCTCTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167653781_1167653783 1 Left 1167653781 19:50749662-50749684 CCTAGCAGAGAGAGCTGGACAGA No data
Right 1167653783 19:50749686-50749708 TCCATTTTGGTTTCTTCACTTGG No data
1167653781_1167653786 3 Left 1167653781 19:50749662-50749684 CCTAGCAGAGAGAGCTGGACAGA No data
Right 1167653786 19:50749688-50749710 CATTTTGGTTTCTTCACTTGGGG No data
1167653781_1167653787 24 Left 1167653781 19:50749662-50749684 CCTAGCAGAGAGAGCTGGACAGA No data
Right 1167653787 19:50749709-50749731 GGCCCCCCGTATCCCCCTTAAGG No data
1167653781_1167653788 25 Left 1167653781 19:50749662-50749684 CCTAGCAGAGAGAGCTGGACAGA No data
Right 1167653788 19:50749710-50749732 GCCCCCCGTATCCCCCTTAAGGG No data
1167653781_1167653785 2 Left 1167653781 19:50749662-50749684 CCTAGCAGAGAGAGCTGGACAGA No data
Right 1167653785 19:50749687-50749709 CCATTTTGGTTTCTTCACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167653781 Original CRISPR TCTGTCCAGCTCTCTCTGCT AGG (reversed) Intergenic
No off target data available for this crispr