ID: 1167653784

View in Genome Browser
Species Human (GRCh38)
Location 19:50749687-50749709
Sequence CCCAAGTGAAGAAACCAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167653784_1167653787 -1 Left 1167653784 19:50749687-50749709 CCATTTTGGTTTCTTCACTTGGG No data
Right 1167653787 19:50749709-50749731 GGCCCCCCGTATCCCCCTTAAGG No data
1167653784_1167653788 0 Left 1167653784 19:50749687-50749709 CCATTTTGGTTTCTTCACTTGGG No data
Right 1167653788 19:50749710-50749732 GCCCCCCGTATCCCCCTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167653784 Original CRISPR CCCAAGTGAAGAAACCAAAA TGG (reversed) Intergenic
No off target data available for this crispr