ID: 1167653788

View in Genome Browser
Species Human (GRCh38)
Location 19:50749710-50749732
Sequence GCCCCCCGTATCCCCCTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167653781_1167653788 25 Left 1167653781 19:50749662-50749684 CCTAGCAGAGAGAGCTGGACAGA No data
Right 1167653788 19:50749710-50749732 GCCCCCCGTATCCCCCTTAAGGG No data
1167653784_1167653788 0 Left 1167653784 19:50749687-50749709 CCATTTTGGTTTCTTCACTTGGG No data
Right 1167653788 19:50749710-50749732 GCCCCCCGTATCCCCCTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167653788 Original CRISPR GCCCCCCGTATCCCCCTTAA GGG Intergenic
No off target data available for this crispr