ID: 1167659213

View in Genome Browser
Species Human (GRCh38)
Location 19:50786091-50786113
Sequence TCCTGAAAGTTCATGGCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 200}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167659199_1167659213 13 Left 1167659199 19:50786055-50786077 CCCAGGCCTCCCTTCCCTGCCAG No data
Right 1167659213 19:50786091-50786113 TCCTGAAAGTTCATGGCCTTGGG 0: 1
1: 0
2: 2
3: 20
4: 200
1167659194_1167659213 26 Left 1167659194 19:50786042-50786064 CCCTCTGCCCAGCCCCAGGCCTC No data
Right 1167659213 19:50786091-50786113 TCCTGAAAGTTCATGGCCTTGGG 0: 1
1: 0
2: 2
3: 20
4: 200
1167659203_1167659213 3 Left 1167659203 19:50786065-50786087 CCTTCCCTGCCAGACCCCTCCTC No data
Right 1167659213 19:50786091-50786113 TCCTGAAAGTTCATGGCCTTGGG 0: 1
1: 0
2: 2
3: 20
4: 200
1167659205_1167659213 -2 Left 1167659205 19:50786070-50786092 CCTGCCAGACCCCTCCTCACTTC 0: 1
1: 0
2: 3
3: 49
4: 565
Right 1167659213 19:50786091-50786113 TCCTGAAAGTTCATGGCCTTGGG 0: 1
1: 0
2: 2
3: 20
4: 200
1167659200_1167659213 12 Left 1167659200 19:50786056-50786078 CCAGGCCTCCCTTCCCTGCCAGA No data
Right 1167659213 19:50786091-50786113 TCCTGAAAGTTCATGGCCTTGGG 0: 1
1: 0
2: 2
3: 20
4: 200
1167659198_1167659213 14 Left 1167659198 19:50786054-50786076 CCCCAGGCCTCCCTTCCCTGCCA No data
Right 1167659213 19:50786091-50786113 TCCTGAAAGTTCATGGCCTTGGG 0: 1
1: 0
2: 2
3: 20
4: 200
1167659201_1167659213 7 Left 1167659201 19:50786061-50786083 CCTCCCTTCCCTGCCAGACCCCT No data
Right 1167659213 19:50786091-50786113 TCCTGAAAGTTCATGGCCTTGGG 0: 1
1: 0
2: 2
3: 20
4: 200
1167659204_1167659213 -1 Left 1167659204 19:50786069-50786091 CCCTGCCAGACCCCTCCTCACTT No data
Right 1167659213 19:50786091-50786113 TCCTGAAAGTTCATGGCCTTGGG 0: 1
1: 0
2: 2
3: 20
4: 200
1167659206_1167659213 -6 Left 1167659206 19:50786074-50786096 CCAGACCCCTCCTCACTTCCTGA 0: 1
1: 0
2: 3
3: 59
4: 521
Right 1167659213 19:50786091-50786113 TCCTGAAAGTTCATGGCCTTGGG 0: 1
1: 0
2: 2
3: 20
4: 200
1167659195_1167659213 25 Left 1167659195 19:50786043-50786065 CCTCTGCCCAGCCCCAGGCCTCC No data
Right 1167659213 19:50786091-50786113 TCCTGAAAGTTCATGGCCTTGGG 0: 1
1: 0
2: 2
3: 20
4: 200
1167659202_1167659213 4 Left 1167659202 19:50786064-50786086 CCCTTCCCTGCCAGACCCCTCCT No data
Right 1167659213 19:50786091-50786113 TCCTGAAAGTTCATGGCCTTGGG 0: 1
1: 0
2: 2
3: 20
4: 200
1167659192_1167659213 30 Left 1167659192 19:50786038-50786060 CCTGCCCTCTGCCCAGCCCCAGG No data
Right 1167659213 19:50786091-50786113 TCCTGAAAGTTCATGGCCTTGGG 0: 1
1: 0
2: 2
3: 20
4: 200
1167659197_1167659213 18 Left 1167659197 19:50786050-50786072 CCAGCCCCAGGCCTCCCTTCCCT No data
Right 1167659213 19:50786091-50786113 TCCTGAAAGTTCATGGCCTTGGG 0: 1
1: 0
2: 2
3: 20
4: 200
1167659196_1167659213 19 Left 1167659196 19:50786049-50786071 CCCAGCCCCAGGCCTCCCTTCCC No data
Right 1167659213 19:50786091-50786113 TCCTGAAAGTTCATGGCCTTGGG 0: 1
1: 0
2: 2
3: 20
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167659213 Original CRISPR TCCTGAAAGTTCATGGCCTT GGG Intergenic
902831321 1:19014855-19014877 TTTTTAAAGTTCATGCCCTTTGG + Intergenic
903737825 1:25541575-25541597 TCCTGAAAGTTCAGGACTGTGGG + Intergenic
904031086 1:27533770-27533792 TCCTGTGTATTCATGGCCTTTGG - Intergenic
904529915 1:31161635-31161657 CCCTGAAAGGTCATGGGCTTTGG - Intergenic
905911968 1:41661652-41661674 GACTGAAACTGCATGGCCTTGGG + Intronic
910286140 1:85556267-85556289 TCATGAAAGGTCATGGCAATGGG - Intronic
912085534 1:105998114-105998136 TACTTAAAGTTCATGGCATGAGG - Intergenic
912115863 1:106407087-106407109 TCCTGATACTTCCTGGCCTTAGG - Intergenic
912570314 1:110616452-110616474 TCCTGAAAGCTCCTGGACTTTGG - Intronic
914372771 1:147044377-147044399 TCCTGAAATTTCTTGACCCTGGG + Intergenic
914576723 1:148978378-148978400 TCCTGAAATTTCTTGACCCTGGG - Exonic
915656391 1:157364577-157364599 GCCTGAATTTTCATGGCCATGGG - Intergenic
915662251 1:157414214-157414236 TCCTGAAAATTCTGTGCCTTGGG + Intergenic
915672240 1:157499402-157499424 GCCTGAATTTTCATGGCCATGGG + Intergenic
918704285 1:187641375-187641397 GCCTGAATTTTCATGGCCATGGG + Intergenic
919994756 1:202739032-202739054 TCATGAAAATTCTGGGCCTTGGG + Intronic
924411868 1:243814573-243814595 TCCTAACAATTCATGACCTTTGG + Intronic
924734696 1:246745532-246745554 TCCAGAAAGTTCATGATCTCTGG - Intronic
1063922873 10:10949261-10949283 TCCGGAAAGTGCAGGGGCTTTGG - Intergenic
1064882016 10:20065905-20065927 TCCTAACAGGTCATGGCCTGTGG + Intronic
1065253505 10:23841002-23841024 TCCTGAATTTTCATTTCCTTGGG + Intronic
1068341667 10:55712197-55712219 TTCAGAAAGTTCAGTGCCTTGGG - Intergenic
1071027757 10:81136667-81136689 TCCTGAAAGTTCAATTCTTTCGG + Intergenic
1071783587 10:88875008-88875030 TACTCCAAGCTCATGGCCTTTGG + Intergenic
1073308685 10:102523848-102523870 ACCTTAAAGGTGATGGCCTTTGG - Intronic
1074404792 10:113171645-113171667 ACCTGCAACTTAATGGCCTTAGG + Intergenic
1076135693 10:128044517-128044539 TCCTGAAAGTTGAAAACCTTAGG - Intronic
1080810845 11:35702593-35702615 ACCAGAAAGTTCCAGGCCTTAGG - Intronic
1081651685 11:44828038-44828060 TCCTGGGAGTTCATGGGCTTTGG + Intronic
1083511542 11:63213424-63213446 TACTGGACCTTCATGGCCTTAGG + Intronic
1084348535 11:68575741-68575763 TCCTGAAAGTCCATGGGATTTGG + Intronic
1085785381 11:79443670-79443692 TCCTGAAAGTTCAGGTACTGGGG + Intergenic
1085820232 11:79784684-79784706 TTCTGAAAGATCATTGGCTTTGG + Intergenic
1087602737 11:100337476-100337498 TCCTGAAAGTTCAGTCCCTCAGG - Intronic
1089719569 11:120402179-120402201 CCCTAAAATTTCAAGGCCTTGGG - Intronic
1089719637 11:120403148-120403170 TTCTGAACGTTTAAGGCCTTTGG + Intronic
1090638258 11:128707196-128707218 TCCTGACTGTTCATGAACTTGGG - Intronic
1090952046 11:131482181-131482203 TTCTGTAAGATCATGGCCTTTGG + Intronic
1091115238 11:133006365-133006387 TCCTGAATTTTCTTGGCCATGGG + Intronic
1093852711 12:24060390-24060412 TCCTGCAGGTGCATGGGCTTTGG + Intergenic
1095833784 12:46615315-46615337 GCCTGAATTTTCATGGCCATGGG + Intergenic
1097423187 12:59407838-59407860 TTCTTAAAGTTCTTTGCCTTTGG - Intergenic
1097987804 12:65802872-65802894 TCCTGAAAGTTGAGTGTCTTAGG + Intergenic
1100245851 12:92756191-92756213 TCTAGAAAGTTCATGACATTTGG - Intronic
1100929872 12:99595036-99595058 TCCTGAAAGAGCATAGACTTTGG + Intronic
1103584877 12:121945130-121945152 TCTTGGAAGTAAATGGCCTTGGG - Intronic
1103681176 12:122695294-122695316 TCCTGAAATTTCATTCCCTAAGG + Intergenic
1103811824 12:123620739-123620761 TCCTGAATGTGCTTGGCCCTGGG + Exonic
1104508580 12:129355838-129355860 GCCTGAGAGTTCCTGGCCCTTGG + Intronic
1106242398 13:27921902-27921924 TCCGGAGACTTCAAGGCCTTTGG - Intronic
1106342356 13:28842570-28842592 TCCTGAAACTTCATGATTTTTGG + Intronic
1107236232 13:38173967-38173989 TCCTGGAATATCATTGCCTTGGG - Intergenic
1107432085 13:40349356-40349378 TTCTGCAACTTGATGGCCTTGGG - Intergenic
1108595958 13:51949643-51949665 TCCTGTAAGTTGAATGCCTTGGG - Exonic
1108873955 13:55022211-55022233 GCCTGAATTTTCATGGCCATGGG - Intergenic
1109865876 13:68261668-68261690 GCCTGAATTTTCATGGCCGTAGG + Intergenic
1110263693 13:73514632-73514654 TCCTGTAAGTCCAATGCCTTGGG + Intergenic
1110823677 13:79946527-79946549 TCCTGATAGTCCATGGACTTTGG + Intergenic
1112549143 13:100403651-100403673 GCCTGAATTTTCATGGCCATGGG - Intronic
1114447331 14:22799098-22799120 CCCTGAAATTTCATTGCCTTAGG + Intronic
1117255475 14:53972831-53972853 TCCTGATAGTCAATGGCCTGAGG - Intergenic
1118242188 14:64070836-64070858 TCCTGAAAGCTCAGGGGCTGTGG + Exonic
1121109415 14:91302554-91302576 TCTTGACAGTTCATGGTCTTGGG - Intronic
1121423675 14:93833230-93833252 TCCTGAAAGTTACTGACCGTGGG - Intergenic
1121496088 14:94392075-94392097 TCCCCAAAGGTCATGGCCTTTGG - Intergenic
1121686620 14:95840192-95840214 TCCTCCAAGGTCATGGCCTCAGG - Intergenic
1124018433 15:25898241-25898263 TCCTCAAAATTCATGGCCCACGG - Intergenic
1124135658 15:27033924-27033946 CCCTCAGTGTTCATGGCCTTTGG + Intronic
1124549717 15:30668412-30668434 TTCTGAAAGTTCTGTGCCTTTGG + Intronic
1128534710 15:68481721-68481743 GCCTGAATTTTCATGGCCATGGG + Intergenic
1133391490 16:5413908-5413930 TCCTGAAAGCTCATGACTCTAGG + Intergenic
1134232576 16:12440000-12440022 TCCTGGAATTGCGTGGCCTTGGG + Intronic
1137002299 16:35239863-35239885 TCCTGACAGATCAAGGGCTTGGG + Intergenic
1137514660 16:49132767-49132789 TACTGTAAGTTCTAGGCCTTAGG - Intergenic
1137759112 16:50926376-50926398 TCCAATAAGTTCATGGCTTTGGG - Intergenic
1139460137 16:67115500-67115522 TCCAGAATATTCAGGGCCTTTGG + Intronic
1139596144 16:67959486-67959508 TCCTGAAGGGTCCTGGCCTGGGG + Intronic
1140766097 16:78158894-78158916 ACCTGAAACTTCATACCCTTTGG + Intronic
1142281588 16:89151007-89151029 ACCTGAAAACTCATGACCTTTGG - Intronic
1142587938 17:986294-986316 TCCTGAAAGGTCTGGGCCCTTGG + Intergenic
1143667164 17:8369840-8369862 TCCTTAAAAGTCATGGGCTTTGG + Exonic
1144515480 17:15914889-15914911 TCCTCAAAGTTCAGGTCTTTTGG + Intergenic
1146300829 17:31687780-31687802 TCCTAACAGGTCATGGCCTGGGG + Intergenic
1146552703 17:33795510-33795532 ACATGAAATCTCATGGCCTTTGG + Intronic
1147791856 17:43018693-43018715 TCCTCAAAGGTCATGGCCTCAGG + Exonic
1150969054 17:70006040-70006062 TCCTGAAAGCTGGTGGCCCTTGG - Intergenic
1151075017 17:71261467-71261489 CCCTGAAACTTCTTGTCCTTGGG + Intergenic
1151998446 17:77628645-77628667 TCCTGACACTTCTTTGCCTTCGG + Intergenic
1156698960 18:39800151-39800173 GCCTGAATTTTCATGGCCGTGGG - Intergenic
1157139374 18:45090328-45090350 TCCTGCAGGTACATGTCCTTTGG + Intergenic
1157778176 18:50413341-50413363 AACTGAAAGTTGGTGGCCTTGGG + Intergenic
1158011248 18:52730375-52730397 TCCTCAAAGTTCATGCACCTAGG - Intronic
1158018494 18:52812647-52812669 TTCTGAAAATGCATGCCCTTAGG - Intronic
1158199427 18:54923501-54923523 TCTTGAAAACACATGGCCTTGGG + Intronic
1158549878 18:58426735-58426757 TCCTACAAGTTCTGGGCCTTAGG - Intergenic
1163797601 19:19346376-19346398 TCCTTAGGGTACATGGCCTTGGG - Intronic
1164661410 19:29974054-29974076 TCCTTAAAGAGCATGGCATTTGG + Intronic
1165986109 19:39770342-39770364 CCCTTATAGTTCATGTCCTTGGG + Intergenic
1167659213 19:50786091-50786113 TCCTGAAAGTTCATGGCCTTGGG + Intergenic
1167730271 19:51249129-51249151 CCCTGAAAGCTCTTGCCCTTGGG - Intronic
1168624017 19:57902464-57902486 TCCTGAATGTTCCTGTCCTATGG - Intronic
927425789 2:22979758-22979780 TTCTATAATTTCATGGCCTTAGG + Intergenic
930382473 2:50648952-50648974 TCCTTAAAATTCATGGCCTTTGG + Intronic
933981528 2:87554702-87554724 CTCTGAAATTTCATGGCCTGAGG - Intergenic
936312308 2:111396114-111396136 CTCTGAAATTTCATGGCCTGAGG + Intergenic
937084841 2:119164526-119164548 TCATGACAGTTCCTGCCCTTTGG - Intergenic
937336277 2:121064286-121064308 TCCTGGGAGTTCAAGGACTTTGG - Intergenic
938589880 2:132726312-132726334 TGCTGACAGTTCATGGGCTGAGG + Intronic
940007162 2:149018495-149018517 TTCTCAAAGTTCTTGGCCTTAGG + Intronic
940173270 2:150851280-150851302 TCCTGAAAGTCCAAGGCTTTAGG - Intergenic
940984983 2:160043787-160043809 TCCTGAAAATGCCTGGCCCTTGG + Intronic
942057519 2:172198491-172198513 TCTGGAAGGTTCTTGGCCTTAGG - Intergenic
942122511 2:172792308-172792330 TCCTCAAAGTTAAGGGGCTTTGG - Intronic
942404601 2:175640868-175640890 AGCTGAAAGCTCATGGACTTTGG - Intergenic
942765905 2:179456196-179456218 TCTTCAAAGTTCATGTCCTGAGG - Intronic
944066361 2:195623255-195623277 TCATGAAAATACATGCCCTTGGG - Intronic
944365759 2:198917316-198917338 GTCTTCAAGTTCATGGCCTTAGG - Intergenic
945185782 2:207138061-207138083 GCCTGAAAGTGCATGTCATTCGG - Intronic
947850919 2:233287226-233287248 AGCTGAAAATTCATGGGCTTTGG - Intronic
947858164 2:233338516-233338538 TCCTAGAAGTTCATGTACTTGGG - Intronic
948036860 2:234864697-234864719 TCATAAATATTCATGGCCTTTGG + Intergenic
948273744 2:236692909-236692931 ACTTGTAAGTTCATGGCTTTAGG - Intergenic
1169677010 20:8165748-8165770 TACTGAAAGGTCATTGGCTTTGG - Intronic
1171325747 20:24290882-24290904 TCCTGAATGTTCATGTCTTTTGG - Intergenic
1174140907 20:48412993-48413015 TGCTGACAGTTGATGGCCCTGGG + Intergenic
1175048178 20:56126921-56126943 TCCTGCATGTTTATGGCTTTGGG - Intergenic
1177688134 21:24466818-24466840 TCCTGAAAGAGACTGGCCTTTGG + Intergenic
1178741207 21:35203406-35203428 TCCTGAAAGTTGATGACTTCAGG + Intronic
1181975021 22:26722749-26722771 TTCTCAAAGTCCATGGACTTGGG - Intergenic
1182006286 22:26962313-26962335 GCTTGAGAGTTAATGGCCTTGGG + Intergenic
1182906357 22:33940533-33940555 TCTTCAAAGATAATGGCCTTAGG - Intergenic
1183511215 22:38236147-38236169 ACTGGAAAGTTGATGGCCTTGGG + Intronic
1184904716 22:47473314-47473336 TCCTGCAAGTTCATGGTTTTCGG - Intronic
952105906 3:30069240-30069262 TCCTTAAAGTTTCTGGCCTGTGG - Intergenic
952445087 3:33373390-33373412 TCCAGAATGTTCATAGCTTTGGG - Intronic
957014629 3:75048532-75048554 TCCTTAATTTTCATGGCCATGGG - Intergenic
958971166 3:100611493-100611515 ACCTGAAAGTTCAAGGCTTGGGG + Intronic
963128829 3:141839440-141839462 TCCTGAAAGTTTATGTCCTTAGG - Intergenic
964329943 3:155591283-155591305 TCATTAAAGTACATGGCTTTTGG - Intronic
967696982 3:192543686-192543708 TGCTGAAAGTTCAAGGCCCAAGG + Intronic
970348941 4:15181544-15181566 TCCAGAAAGAACATGACCTTGGG + Intergenic
971711448 4:30118570-30118592 GCCTGAATTTTCATGGCCGTGGG + Intergenic
972786272 4:42329310-42329332 AGCTGAAAGTTCAGGGACTTAGG + Intergenic
975558259 4:75685532-75685554 TCCTGAAATTTGATGGTATTTGG + Intronic
978834353 4:113130595-113130617 ACCTCAAAGTACATGGGCTTAGG - Intronic
981760229 4:148186556-148186578 ACCTGAGAATTCATGGACTTTGG - Intronic
982306950 4:153942546-153942568 TCATGAAGGATCATGGACTTTGG - Intergenic
982789468 4:159574143-159574165 TTCTGAAACTTTATGGCTTTTGG + Intergenic
983832943 4:172352923-172352945 TCTTGAAAGTTGTTGGCATTGGG - Intronic
986288804 5:6381174-6381196 TCCTAACAGGTCATGGCATTTGG + Intergenic
988999980 5:36749749-36749771 TCCTGCAACTTCATGTCCTTTGG + Intergenic
989747791 5:44851823-44851845 TCATGAGAGTTCAAGTCCTTGGG + Intergenic
990313112 5:54558726-54558748 TCCTTAAATTTCATGTACTTGGG + Intergenic
990476839 5:56169685-56169707 GCCTGGAAGATTATGGCCTTGGG + Intronic
990569417 5:57063037-57063059 TCCTGGAGGTTCTTGGCCTCTGG + Intergenic
991015584 5:61928783-61928805 CCCTGAAGGTACATGGTCTTTGG - Intergenic
991703864 5:69339429-69339451 TACTGAAAGTTCTTGGGGTTGGG + Intergenic
992259399 5:74954533-74954555 TCCTGAAAGTTGACTTCCTTTGG + Intergenic
992662968 5:78979704-78979726 GCCTGAATTTTCATGGCCATGGG + Intronic
994642962 5:102433406-102433428 TCCTTGAAGTTCCTGTCCTTTGG + Intronic
998324308 5:141265820-141265842 TCCAGAAATTTAATGCCCTTAGG - Intergenic
999313721 5:150570406-150570428 TCCTGGCAGCTCATGGCCTAAGG + Intergenic
1005753999 6:28909423-28909445 TCCTGGAAGGTCATGGAATTGGG - Intronic
1006829669 6:36961302-36961324 TCCTGAACCTGCATGGCCTTGGG + Intronic
1006987199 6:38183831-38183853 TCCTGAGAGCTCATTCCCTTTGG + Intronic
1009907444 6:69887696-69887718 GCCTGAATTTTCATGGCCATGGG - Intronic
1009908338 6:69895442-69895464 GCCTGAATTTTCATGGCCATGGG - Intronic
1010444022 6:75931115-75931137 CCCTGCAAGTTCCTGGCCTGCGG - Exonic
1010471433 6:76233084-76233106 TCTTGAACTTTCATGGCCTCAGG + Intergenic
1014470508 6:121808740-121808762 GCCTGAATTTTCATGGCCATGGG - Intergenic
1015345268 6:132149669-132149691 TCTTAAAAGAACATGGCCTTTGG + Intergenic
1016331168 6:142953195-142953217 TTCTAAAAGTTCAAGGACTTAGG - Intergenic
1016577189 6:145583299-145583321 TCTTCAAAGTTGATGTCCTTTGG + Intronic
1022315463 7:29241226-29241248 GCCTGAATTTTCATGGCCATGGG - Intronic
1022771038 7:33473180-33473202 TCCTAAAAGTTCATCGCACTTGG - Intronic
1026826016 7:73582081-73582103 TCCTGACAGTCCAGGCCCTTCGG + Intergenic
1027362412 7:77422830-77422852 CCCTGAAAATTCAGGGACTTGGG - Intergenic
1027623001 7:80515493-80515515 TCCAGAGAGTTCATGCCTTTTGG + Intronic
1027660374 7:80981404-80981426 GCCTGAATTTTCATGGCCGTAGG - Intergenic
1027932842 7:84561508-84561530 TCCTGAAACTTCATGCCAATGGG - Intergenic
1030139717 7:106292119-106292141 GCCTGAAATTTCATGGCCATGGG + Intergenic
1032199420 7:129808871-129808893 TTCTGAAGGTTCATTGCCTCTGG + Intergenic
1034011015 7:147529868-147529890 TCCTGTGATTTCCTGGCCTTTGG - Intronic
1036084540 8:5599422-5599444 GCCTGAATATTCATGGCCGTGGG - Intergenic
1037110951 8:15164125-15164147 GCCTGAATTTTCATGGCCATGGG + Intronic
1038125446 8:24668297-24668319 TCATGAAAGGTCATGGCACTTGG + Intergenic
1038524830 8:28263811-28263833 GCCTGAATTTTCATGGCCATGGG - Intergenic
1044397811 8:91734429-91734451 TCTTGAAAGTCAAAGGCCTTGGG - Intergenic
1045782489 8:105884091-105884113 GGCTCAAAGTTCCTGGCCTTGGG + Intergenic
1046949315 8:120004714-120004736 TCCTGACAGCTCTTGTCCTTGGG - Intronic
1047462105 8:125076599-125076621 TCCTGAAAGGTGATGGGCTTTGG - Intronic
1048333247 8:133485402-133485424 TCCTGAAGCTTCGTGGCCTGTGG + Intronic
1053590227 9:39506323-39506345 TCATGTAAATTCATGGCATTGGG + Intergenic
1053847985 9:42260492-42260514 TCATGTAAATTCATGGCATTGGG + Intergenic
1054576074 9:66858966-66858988 TCATGTAAATTCATGGCATTGGG - Intronic
1057457971 9:95231596-95231618 GCCTGAATTTTCATGGCCATGGG + Intronic
1058554797 9:106155661-106155683 TACTGAAAGTTTATGCCCTCTGG + Intergenic
1058740542 9:107938145-107938167 CTCTGAAAGTTCATGGTCTTTGG + Intergenic
1060298220 9:122357335-122357357 GCCTGAGGCTTCATGGCCTTGGG + Intergenic
1061295887 9:129676538-129676560 TCCTGAAAGCACATGGGCTCTGG - Intronic
1186425156 X:9458515-9458537 TCCTGAAAGTACTTTGCATTTGG - Intergenic
1186595491 X:10976817-10976839 TCCTCAAAGTTGATGTTCTTAGG + Intergenic
1187680600 X:21763808-21763830 TCCTAAAAGCTACTGGCCTTGGG - Intergenic
1187983556 X:24785822-24785844 AACTGAAAGTTCATCCCCTTTGG + Intronic
1189163542 X:38835958-38835980 ACCTGAAAATACAAGGCCTTTGG - Intergenic
1191677633 X:63808318-63808340 GCATAAAAGTTCTTGGCCTTGGG + Intergenic
1192293418 X:69822021-69822043 TCCTGTAATTTCAGTGCCTTAGG + Intronic
1193449382 X:81646993-81647015 TCTTCAAAGTTGATGTCCTTTGG + Intergenic
1196365710 X:114921408-114921430 TCCTGGAAGCTCAAGGCCTAAGG - Intergenic
1197721697 X:129749574-129749596 CCCTTAATGTTTATGGCCTTCGG + Intronic
1198671763 X:139088809-139088831 GCCTCGAAGTTCATGGCTTTTGG + Intronic
1198934293 X:141889724-141889746 TCCTGAAGGTTCTGGGCCATTGG - Intronic
1200684772 Y:6248270-6248292 TCCAGGACGTTCATGGCATTGGG + Intronic
1200990302 Y:9339535-9339557 TCCAGGACGTTCATGGCATTGGG + Intronic
1200992963 Y:9359850-9359872 TCCAGGACGTTCATGGCATTGGG + Intronic
1200995617 Y:9380128-9380150 TCCAGGACGTTCATGGCATTGGG + Intronic
1200998282 Y:9400474-9400496 TCCAGGACGTTCATGGCATTGGG + Intronic
1201000790 Y:9469006-9469028 TCCAGGACGTTCATGGCATTGGG + Intronic
1201003458 Y:9489338-9489360 TCCAGGACGTTCATGGCATTGGG + Intronic
1201006114 Y:9509620-9509642 TCCAGGACGTTCATGGCATTGGG + Intergenic
1201008772 Y:9529933-9529955 TCCAGGACGTTCATGGCATTGGG + Intronic
1201673856 Y:16557330-16557352 TCCTTAAAGTTTTTGGCCATTGG + Intergenic
1202590444 Y:26477330-26477352 TACTGAATGTGCATTGCCTTTGG - Intergenic