ID: 1167659288

View in Genome Browser
Species Human (GRCh38)
Location 19:50786400-50786422
Sequence GGTGCTGGGGAGCCATGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167659277_1167659288 9 Left 1167659277 19:50786368-50786390 CCATACTGAGGTGTTTGGGTTTT No data
Right 1167659288 19:50786400-50786422 GGTGCTGGGGAGCCATGAGAGGG No data
1167659274_1167659288 17 Left 1167659274 19:50786360-50786382 CCTGAACACCATACTGAGGTGTT No data
Right 1167659288 19:50786400-50786422 GGTGCTGGGGAGCCATGAGAGGG No data
1167659273_1167659288 18 Left 1167659273 19:50786359-50786381 CCCTGAACACCATACTGAGGTGT No data
Right 1167659288 19:50786400-50786422 GGTGCTGGGGAGCCATGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167659288 Original CRISPR GGTGCTGGGGAGCCATGAGA GGG Intergenic
No off target data available for this crispr