ID: 1167659909

View in Genome Browser
Species Human (GRCh38)
Location 19:50790498-50790520
Sequence AGAAGGACCCCTGGTGTTCG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 99}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167659902_1167659909 -9 Left 1167659902 19:50790484-50790506 CCCCGGGCCCTGCCAGAAGGACC 0: 1
1: 0
2: 1
3: 19
4: 195
Right 1167659909 19:50790498-50790520 AGAAGGACCCCTGGTGTTCGTGG 0: 1
1: 0
2: 0
3: 9
4: 99
1167659900_1167659909 -6 Left 1167659900 19:50790481-50790503 CCACCCCGGGCCCTGCCAGAAGG 0: 1
1: 0
2: 4
3: 22
4: 297
Right 1167659909 19:50790498-50790520 AGAAGGACCCCTGGTGTTCGTGG 0: 1
1: 0
2: 0
3: 9
4: 99
1167659897_1167659909 19 Left 1167659897 19:50790456-50790478 CCTGCTGCTGCTGCTGCTGGTGC 0: 2
1: 93
2: 197
3: 549
4: 1918
Right 1167659909 19:50790498-50790520 AGAAGGACCCCTGGTGTTCGTGG 0: 1
1: 0
2: 0
3: 9
4: 99
1167659903_1167659909 -10 Left 1167659903 19:50790485-50790507 CCCGGGCCCTGCCAGAAGGACCC 0: 1
1: 0
2: 4
3: 25
4: 320
Right 1167659909 19:50790498-50790520 AGAAGGACCCCTGGTGTTCGTGG 0: 1
1: 0
2: 0
3: 9
4: 99
1167659895_1167659909 24 Left 1167659895 19:50790451-50790473 CCTCTCCTGCTGCTGCTGCTGCT 0: 9
1: 71
2: 222
3: 605
4: 2017
Right 1167659909 19:50790498-50790520 AGAAGGACCCCTGGTGTTCGTGG 0: 1
1: 0
2: 0
3: 9
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167659909 Original CRISPR AGAAGGACCCCTGGTGTTCG TGG Exonic
900857975 1:5201190-5201212 AGAAGGAGCCCTGGTGGCCTGGG + Intergenic
901929216 1:12586094-12586116 AGAAAGACCTCTGGTCTCCGGGG + Intronic
903236970 1:21956529-21956551 GGAAGGGCCCCTAGTGTTCTTGG - Intergenic
908840777 1:68278098-68278120 GGAAGCTCCCCTGGTGTTCTAGG - Intergenic
913974462 1:143443759-143443781 AGAAGGAACCCTGGTCTCCTTGG + Intergenic
914068852 1:144269373-144269395 AGAAGGAACCCTGGTCTCCTTGG + Intergenic
914110303 1:144696981-144697003 AGAAGGAACCCTGGTCTCCTTGG - Intergenic
921045048 1:211470236-211470258 TGAAGGCCCCCTGGTGGTCACGG - Intergenic
1063042614 10:2358699-2358721 AGAAGAACCTCTGGGGTACGTGG + Intergenic
1064156480 10:12907140-12907162 AGATGGAGCCCTTGTGTTCAAGG - Intronic
1067087763 10:43251937-43251959 AGACGGACCCCTGGTGATGCAGG + Intronic
1069104888 10:64371725-64371747 AGAAGAACCCATGGTATTAGAGG + Intergenic
1069639456 10:69945415-69945437 AGAATGACCCGTGGTGTCCTGGG - Intronic
1070793663 10:79204455-79204477 AGAAGGGCCCCTGGGGTTCAGGG - Intronic
1072411038 10:95202208-95202230 AGACGGACCCCAGGGGTTGGAGG + Intronic
1073687114 10:105766855-105766877 AGAAGGATCGCTTGAGTTCGAGG - Intergenic
1073836805 10:107453664-107453686 ATAAGGACCCTTGGTGTTCCAGG - Intergenic
1074228654 10:111512433-111512455 AGCAAGACCCCTGGTCTTGGGGG + Intergenic
1074696129 10:116051526-116051548 AGAAGGACTCCTGGACTGCGGGG + Intergenic
1077053379 11:577802-577824 AAAAGGGCCTCTGGTGTCCGGGG - Intronic
1080891272 11:36410910-36410932 TGGAGGACCCCTGCTGTTCCTGG + Intronic
1081741593 11:45444800-45444822 AGAAGGACCCCTGAGGATCTGGG - Intergenic
1083032752 11:59608909-59608931 AGAAGGACCTGGGGTGTTTGTGG - Intronic
1083923692 11:65793606-65793628 AGAAGGGTCCCTGGTGGTCTGGG - Intronic
1088224635 11:107606286-107606308 AGACTGACCCCTTGTGTTTGTGG + Intronic
1089268906 11:117287863-117287885 AGGAGGGCCTCTGGTGTTCCTGG - Exonic
1094841365 12:34343952-34343974 ATCAGGAACCCTGGTGTTCCCGG - Intergenic
1100573430 12:95864815-95864837 AGGAGGAGCCCAGGTGTTCAAGG + Intronic
1104595303 12:130116504-130116526 TGAAGAAACCCTGGTGTTCCAGG - Intergenic
1104622965 12:130332109-130332131 GGAAGGAGCTCTGGTGTTGGTGG - Intergenic
1110046614 13:70841025-70841047 TGCAGAACCCCTGGTGTTCCTGG - Intergenic
1110933933 13:81259264-81259286 TGAACAACTCCTGGTGTTCGTGG - Intergenic
1112263863 13:97904284-97904306 GGAAGGACTCCTGGTGTTGAAGG - Intergenic
1119426836 14:74541089-74541111 AGAGGGACACCTGGTGTGGGTGG - Intronic
1126495230 15:49282768-49282790 AGAAGGAATCCAGGTGTTCTTGG - Intronic
1126692875 15:51301434-51301456 AGAAGGAGCCTTGGTCTTGGAGG - Intronic
1128187385 15:65654338-65654360 AGAAGGACCCCTGGAGCCAGAGG + Exonic
1132464457 16:71352-71374 AGAATGACCCCTGGTGGCAGGGG + Intronic
1134767979 16:16778413-16778435 AGAAGGAGTCCTGGTGCTGGGGG + Intergenic
1135458152 16:22616941-22616963 AGAATGACCCCCGGTGGTGGTGG + Intergenic
1136061483 16:27729715-27729737 AGAAGGAAGCCTGGTGTGGGTGG - Intronic
1136749003 16:32616164-32616186 TGAAGGACCCCTGGGATTGGAGG - Intergenic
1137010206 16:35313974-35313996 AGCAGGAGCCCTGGTGATAGAGG + Intergenic
1138008091 16:53355803-53355825 AGATGTACCCCTGGTCTTCTAGG - Intergenic
1139205731 16:65026665-65026687 AAAGGAACCCCTGGTGTTTGAGG - Intronic
1141000106 16:80299879-80299901 AGGAGGACCCCTGCTTTTGGAGG - Intergenic
1142000432 16:87661220-87661242 ACAAGGACCCTTGTGGTTCGGGG + Intronic
1142283356 16:89160739-89160761 AGAAGGAACCTTGGTGTTGGTGG + Intergenic
1203051136 16_KI270728v1_random:875378-875400 TGAAGGACCCCTGGGATTGGAGG - Intergenic
1143224395 17:5288221-5288243 AGCAGGACTCCTGGTTTTGGAGG + Intronic
1147568366 17:41551636-41551658 AGTAGGACCCCTGGGGCTTGGGG + Intergenic
1151961076 17:77405928-77405950 AGCTGGATCCCTGGTGCTCGGGG - Intronic
1152251636 17:79215597-79215619 ACAGGCACCCCTGGTGTGCGGGG + Intronic
1155840231 18:30633729-30633751 AGAAAGACCCCTGGAATTTGGGG - Intergenic
1158424116 18:57323639-57323661 AGAGGTACCCCTGGTATTCAAGG + Intergenic
1160901989 19:1433368-1433390 TGAATGACCCCTGGTGCTGGAGG - Intronic
1161099355 19:2413708-2413730 AGGAGGACCCCTGGTCTGCGAGG + Exonic
1161275364 19:3413316-3413338 AGAAGGAGCCCTGGAGTGAGGGG + Intronic
1165767324 19:38359623-38359645 AGAGGGGCCCCTGGGGTTTGGGG - Intronic
1167659909 19:50790498-50790520 AGAAGGACCCCTGGTGTTCGTGG + Exonic
925215941 2:2095945-2095967 AGGAGGAGCCCTGGTGAACGTGG + Intronic
925922093 2:8645067-8645089 AGGGGGCCCCCTGGTGTTCACGG - Intergenic
931424289 2:62156997-62157019 AGAAGGTCCCCTGTTGTCCTTGG + Intergenic
932897118 2:75650986-75651008 AGAAGGGCCTCTGCTGTTCTGGG + Intronic
934179168 2:89604734-89604756 AGAAGGAACCCTGGTCTCCTTGG + Intergenic
934289452 2:91679002-91679024 AGAAGGAACCCTGGTCTCCTTGG + Intergenic
937215274 2:120308721-120308743 AGAAGCCACCCTGGCGTTCGGGG - Intergenic
939993898 2:148902202-148902224 AGAAGTGCCCCTCGTGTTCCTGG + Intronic
940409144 2:153340220-153340242 AGAAAGACACCTTGTGTTCATGG - Intergenic
947169327 2:227295295-227295317 AGAGGGAACCCTGGTGCTCAAGG + Exonic
948700567 2:239757229-239757251 GGGAGGCCTCCTGGTGTTCGTGG + Intergenic
1180218928 21:46345706-46345728 AGAAGGAAGCCCGGTGCTCGCGG + Intronic
1182099100 22:27645452-27645474 AGAAGGCTTCCTGGTGTTGGTGG - Intergenic
1182820861 22:33214947-33214969 AGGAGGACCCAGGGTGCTCGTGG - Intronic
1183316094 22:37137619-37137641 TGAAAGACACCTGGAGTTCGAGG - Exonic
1183411824 22:37659344-37659366 AGCCGGACCCCTGGTGAGCGCGG + Exonic
1184490777 22:44807537-44807559 AGAAGGGCCTGTGGTGTTGGGGG + Intronic
951258121 3:20474719-20474741 AAAAGGACCACTGGTGTTGCTGG - Intergenic
961936910 3:130594296-130594318 AGAGGGACTCCTGGTGACCGTGG + Exonic
966310368 3:178587354-178587376 AGAAGGACCCCTAGAGTCCAAGG + Intronic
966895763 3:184443852-184443874 AGATGGACCCCTGCTCTTCTGGG + Intronic
969830115 4:9788886-9788908 AGAAGGAACCCTGGTCTCCTTGG - Intronic
978351268 4:107823392-107823414 AAAAGGAACCCTTGTGTTTGTGG - Intergenic
978546484 4:109876451-109876473 AGAAGTCCCCCTAGTGTTCTGGG + Intergenic
980814416 4:137924497-137924519 AGAATAAACCCTGGTGTTTGTGG - Intergenic
985174519 4:187187256-187187278 AGCAGGAGCCCTGCTGATCGGGG - Intergenic
991988994 5:72319410-72319432 AGCTGGACCCCTGGTCTTCGTGG - Intronic
992807325 5:80350684-80350706 AGAATGAGCCCTTGTGTTCATGG - Intergenic
1002758462 6:183411-183433 AGAAGGAGGCCTCGTGTTTGAGG - Intergenic
1004014270 6:11718183-11718205 AGAAGGACCTATGGTCTTAGGGG + Intronic
1006234420 6:32616076-32616098 AGAAGGACCTCTGGTGTCCAGGG + Intergenic
1012336705 6:98068496-98068518 ACAAGGAGCCCTGGTGTTCCAGG - Intergenic
1016402843 6:143699297-143699319 AGAAGGAGCCCTGGGTGTCGGGG - Intronic
1023439151 7:40168840-40168862 AGAAGGACCCCTAGAGTATGGGG - Intronic
1024213228 7:47225090-47225112 GGAAGGACACCTTGTGTTTGTGG - Intergenic
1024711433 7:52019233-52019255 AGAAAGGACCCTGGGGTTCGGGG + Intergenic
1033820552 7:145129698-145129720 AGAAGGACCTCTGCTTTTAGTGG + Intergenic
1035365733 7:158348608-158348630 GGAAGGACCTCAGGTGTTGGGGG - Intronic
1040658095 8:49535677-49535699 AAAAGGACCCCTGGGGTTTGTGG - Intergenic
1048414378 8:134209974-134209996 AGAAGGATCCGTGGTTATCGGGG - Intergenic
1049690110 8:143954558-143954580 CGAAGGGTCCCTGGTGGTCGTGG - Intronic
1053798923 9:41751250-41751272 AGCTGGAGCCCAGGTGTTCGAGG - Intergenic
1054187338 9:61963309-61963331 AGCTGGAGCCCAGGTGTTCGAGG - Intergenic
1054651175 9:67625221-67625243 AGCTGGAGCCCAGGTGTTCGAGG + Intergenic
1060174333 9:121486387-121486409 AGGAGGTCCCCTGGTGATTGGGG + Intergenic
1061971079 9:134045830-134045852 AGCAGGCCCCCTGTTGTTGGTGG - Intronic
1187079823 X:15974492-15974514 AAATGGAATCCTGGTGTTCGTGG - Intergenic
1188901358 X:35736458-35736480 TGAAGAACCCCTGCTGTTCCAGG + Intergenic
1200242977 X:154507431-154507453 CGAAGGCACCCTGGTGTTCGTGG - Exonic