ID: 1167660336

View in Genome Browser
Species Human (GRCh38)
Location 19:50792389-50792411
Sequence ACAGCTAGTGAGTAGCAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 1, 2: 4, 3: 25, 4: 202}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167660336 Original CRISPR ACAGCTAGTGAGTAGCAAGC TGG (reversed) Intronic
900535923 1:3177430-3177452 ACAGCTAGTCAGGAACGAGCTGG - Intronic
902825731 1:18972848-18972870 ACAGCTAGTCAGCAGCAAGCAGG + Intergenic
903129082 1:21266616-21266638 AGAGCTAGCGGGTAGCATGCTGG + Intronic
903517361 1:23920471-23920493 ACAGCTATTCAGTGGCAAACTGG - Intergenic
903807272 1:26014326-26014348 ACAGCCAGTGAGTAACAGGCTGG - Intergenic
905570118 1:38997064-38997086 ACAGCTAGTAAGAAGCAAAGTGG + Intronic
910532689 1:88258130-88258152 ACAGCTAGTAAGAAGGAAGCAGG + Intergenic
911600824 1:99846427-99846449 ACAGCCAGTGAGAAGCAAAAGGG - Intergenic
913109949 1:115648738-115648760 ACAGCTAGGAAGCACCAAGCTGG + Intronic
913228759 1:116723592-116723614 ACAGTTAGTGAGTAGGGACCAGG - Intergenic
915746879 1:158168027-158168049 ACAGCTAATCAGGAGTAAGCAGG + Intergenic
916890933 1:169111744-169111766 ATAGCTGGTGGGTAGCAGGCTGG - Intronic
920786452 1:209046880-209046902 ACAGCTAGTTAGCAGTAGGCTGG + Intergenic
921172230 1:212559873-212559895 ACAGCTAATGAATGGCGAGCTGG + Intergenic
922474617 1:225898663-225898685 ACAGCTGGTGAGTGGCACACTGG + Intronic
923135639 1:231116054-231116076 ACAGCCAGTGAGTGGCTACCAGG + Intergenic
1063490109 10:6456370-6456392 ACAGCTAGTGAAGAGCCAGGTGG - Intronic
1065351541 10:24800007-24800029 ACAGCTTGTGAGGAGTAAGAGGG - Intergenic
1065963100 10:30750234-30750256 ACAGCTAATGAGGAGCAGGGAGG + Intergenic
1067709050 10:48634255-48634277 ACAGCTAGTTAGTGGCAGACAGG - Intronic
1072250401 10:93577803-93577825 ACAGCTTGTAAGTGGCAATCAGG + Intronic
1073284813 10:102381279-102381301 ATAGGCACTGAGTAGCAAGCAGG + Intronic
1073564286 10:104521975-104521997 ACAGCTAGTGAGGAGCAGGCTGG + Intergenic
1073666330 10:105538492-105538514 ACAGCTAGTGAGTAGTTGGCTGG - Intergenic
1075120557 10:119661444-119661466 ACAGCTGGTGAGCATCAAGGAGG + Intronic
1075390409 10:122087141-122087163 ACAGCTGGAGAGGAGCAGGCAGG + Exonic
1075555834 10:123431210-123431232 ACAGCTAGCAAGTAGGGAGCTGG - Intergenic
1077461956 11:2715222-2715244 ACAGCTAGAAAGTGGCCAGCTGG + Intronic
1077649042 11:3952956-3952978 ACAGCTAGTCACCACCAAGCAGG - Intronic
1079370875 11:19851200-19851222 ACAGCTAGTAAGTGGCAAGCTGG + Intronic
1085025833 11:73236028-73236050 ACAGCTAGTGAGAAGGCAGGTGG - Exonic
1085395994 11:76207489-76207511 TCAGCTAGGGAGCGGCAAGCCGG + Intronic
1089299615 11:117490702-117490724 ACAGCTGGTGAGTGGCAGGAAGG + Intronic
1090740529 11:129655425-129655447 ACAGGTACAGAGTGGCAAGCCGG + Intergenic
1090766232 11:129878600-129878622 ACAGCTAGTAAAGAGAAAGCAGG - Intronic
1091498033 12:989817-989839 ACTGCTAGGGAGTAACAAGATGG + Intronic
1092260237 12:6949487-6949509 CAAGCTAGTGAGTAGGAAGGTGG - Intronic
1092361833 12:7843254-7843276 ATAGCTGCTGAGTAGAAAGCCGG + Intronic
1095655368 12:44662438-44662460 ACATCTAGTGAGAAGCAAAGGGG - Intronic
1097685327 12:62685474-62685496 ACAGTTAATAAGTAGCAAGCTGG - Intronic
1098099938 12:67004270-67004292 AAAGCTAGTGAGTAACCGGCTGG - Intergenic
1098225143 12:68313698-68313720 TCAGCTTGGGAGTAGGAAGCCGG + Exonic
1099772069 12:87073636-87073658 ACAGAGAGTGAGAAGCAAGGGGG - Intergenic
1102560006 12:113755126-113755148 ACAGCTAGTGAGTGGCAGAGTGG - Intergenic
1103125737 12:118420876-118420898 ACAGCCAGTAAATGGCAAGCCGG + Intergenic
1103190383 12:118996476-118996498 ATAACTAGTGACTAGAAAGCAGG + Intronic
1103748379 12:123141752-123141774 ACAGCTAGTGAGCTGGAGGCCGG - Intronic
1104404953 12:128509504-128509526 ACAGCTGTTGAGTAACAAGAAGG + Intronic
1106085898 13:26541339-26541361 ACAGCTATTAAGTGGCAGGCTGG - Intergenic
1114448384 14:22807405-22807427 ACAGCTACTGATTATTAAGCAGG - Intronic
1115410341 14:33067074-33067096 ACAGCTAATGAGGTGCAATCTGG + Intronic
1116059630 14:39905926-39905948 AGAACTAGTGAGTAGTAAGTTGG + Intergenic
1118253864 14:64187944-64187966 ACAGCTGGTCTGCAGCAAGCAGG - Intronic
1119408971 14:74416939-74416961 ACAGCTGGTGAGTGGGGAGCTGG + Intronic
1119589493 14:75872450-75872472 AGAGGTACTGAGTAGTAAGCTGG - Intronic
1123017792 14:105383664-105383686 ACAACAAATGTGTAGCAAGCAGG - Intronic
1123118686 14:105907019-105907041 ACAGAAAATGAGAAGCAAGCTGG - Intergenic
1123403628 15:20008218-20008240 ACAGAAAATGAGAAGCAAGCTGG - Intergenic
1123512964 15:21014863-21014885 ACAGAAAATGAGAAGCAAGCTGG - Intergenic
1125326338 15:38539449-38539471 ACAGCTAGGAAGTAGCAAGAAGG + Intronic
1125405138 15:39344921-39344943 ATAGCTAGAGAGTAGCCAGAAGG + Intergenic
1127094190 15:55496441-55496463 ACAGCTAGTGACTGGCAGCCTGG - Intronic
1127607163 15:60598009-60598031 ACAGCTAGTGAGTGGGATGTAGG - Intronic
1128074371 15:64817022-64817044 ACAGTTAGTGAGTGGCAGCCTGG - Intronic
1128383388 15:67130007-67130029 ACAGCTAGTGAGGAGCCGGGTGG + Intronic
1128428825 15:67571762-67571784 ACAGCTAGTCAATAGAGAGCTGG + Intronic
1129443439 15:75599320-75599342 ACACACAGTGAGTAGGAAGCAGG + Intronic
1130774461 15:86964360-86964382 ACATCTAGTGGGTAGCAATCAGG - Intronic
1130841025 15:87701353-87701375 ACAGTGAGTGAGTAGTGAGCAGG - Intergenic
1131530245 15:93184803-93184825 ACAGCTAGTGAGTGGAAAGGTGG + Intergenic
1133359961 16:5166391-5166413 ACAGCTGGTGGGTCTCAAGCTGG - Intergenic
1133614856 16:7466607-7466629 ACAGCTAGTGAGTGCAGAGCTGG - Intronic
1134300989 16:12990684-12990706 GCATCTAGTGAGTAGAGAGCAGG + Intronic
1134391281 16:13822592-13822614 AGAGCTAGTGATGAGCAAACTGG + Intergenic
1134506224 16:14809479-14809501 ACAGCTAGTGAGTGGAGAGTTGG - Intronic
1134574328 16:15319285-15319307 ACAGCTAGTGAGTGGAGAGTTGG + Intergenic
1134667277 16:16028008-16028030 ACAGCTAGGAAATGGCAAGCTGG + Intronic
1134685040 16:16152697-16152719 ACAGCTAGTAAGTGGCAGGGCGG + Intronic
1134728089 16:16437013-16437035 ACAGCTAGTGAGTGGAGAGTTGG - Intergenic
1134808940 16:17150640-17150662 ACAGCTGGTGAGTGGCAATGAGG + Intronic
1134884745 16:17780613-17780635 ACAGCTAGTAAATGGCAAGGTGG + Intergenic
1134939347 16:18274813-18274835 ACAGCTAGTGAGTGGAGAGTTGG + Intergenic
1135345303 16:21684226-21684248 ACAGCTAGTAAGTGTCAAGGTGG + Intronic
1136079013 16:27839261-27839283 ACAGCAAGAGAGTAGCAAGTTGG - Intronic
1140782837 16:78312342-78312364 ATTGCTAGTGAGTGGCCAGCTGG + Intronic
1140896085 16:79325483-79325505 ACAGCTAGTAAGTGGAAAGCAGG + Intergenic
1141049210 16:80745440-80745462 ACAGCTAGTAAGTGTCAGGCTGG - Intronic
1141108814 16:81255292-81255314 ACAGCTAGCGAGTGGTAATCTGG - Intronic
1141665907 16:85465016-85465038 ACAGCTAGTGAGGTGCAGACGGG + Intergenic
1142983421 17:3684275-3684297 ACATCTAGTGGGTAGAAACCGGG + Intronic
1144820009 17:18065864-18065886 AAAGCTAGTGAGTAGCTGTCAGG + Exonic
1145270036 17:21400026-21400048 ACAGCTAGACGGTAGCGAGCGGG - Intronic
1147357256 17:39907789-39907811 AGAGCTAGTGAGTGGCAGGGTGG + Intronic
1150157711 17:62868272-62868294 ATTGTTAGTGAGTGGCAAGCTGG - Intergenic
1151009492 17:70477159-70477181 ACATCTAGTGAGTAGAGACCAGG + Intergenic
1151216015 17:72576747-72576769 ACAGCAAGTGAGTGACAAGTGGG + Intergenic
1152570320 17:81118819-81118841 ACAGCTAGGGAAGAGGAAGCTGG + Intronic
1155563124 18:27102009-27102031 ACAGATAGTGAGTTGCAACTGGG + Intronic
1156859401 18:41818526-41818548 ACAGCTAGAGAGTTTAAAGCAGG - Intergenic
1157148335 18:45189116-45189138 AAAGCTAGTAAGTGGCAAACTGG + Intergenic
1157605710 18:48924688-48924710 ACAGCGAGGGAGGAGCAGGCAGG - Intronic
1158174647 18:54641189-54641211 CCAGCAAGTGAGTAGCAAAATGG - Intergenic
1158424222 18:57324556-57324578 ACAACTAGTGAGTAGAAGGAAGG + Intergenic
1159385617 18:67721741-67721763 AGAGGTAGTGAGTAGAAAGGTGG - Intergenic
1163184973 19:15631403-15631425 TCAGCTAGTGAATAGCAGACTGG - Intronic
1163214100 19:15863351-15863373 CCAGCTAGTGAGTAGTAAGGAGG + Intergenic
1163258762 19:16173831-16173853 ACAGCTAGTGGGCAGAGAGCTGG - Intergenic
1163725384 19:18920482-18920504 ACTGCCAGTGAGTGGCAGGCTGG - Intronic
1166254959 19:41597209-41597231 ACAACTAGTGAGTACCAAGGGGG - Intronic
1167035378 19:46992283-46992305 ACCGCTAGGGAGTGGCAAGCCGG + Intronic
1167660336 19:50792389-50792411 ACAGCTAGTGAGTAGCAAGCTGG - Intronic
1168057075 19:53869832-53869854 ACCGCTGGTGAGTAGGCAGCGGG + Exonic
926114410 2:10203318-10203340 ACAGCTAGTGGGTGGCAGTCGGG - Intronic
927783565 2:25957254-25957276 GCAGCTATTGAGTAGCAAAGAGG + Intronic
930445128 2:51461093-51461115 ACAGCTAGTAAGCAGCAGGTGGG + Intergenic
930736174 2:54781211-54781233 ACAGCTAGTGAGTGGCAGGCTGG + Intronic
932431054 2:71673703-71673725 ATAGCTAGGAAGTGGCAAGCTGG - Intronic
933588973 2:84210632-84210654 TCAGCTAATGAGTGGCAAGCTGG - Intergenic
935434054 2:103008964-103008986 ACAGTTAGTCAGCAGCAGGCGGG - Intergenic
936620157 2:114087667-114087689 ACAGCTTTTGAGTATCAGGCTGG - Intergenic
938903300 2:135816721-135816743 ATTGCTAGTGAGTAGCCAGGTGG - Intronic
940287612 2:152048169-152048191 ACATCTAGTGAGTAGAGACCAGG - Intronic
940470822 2:154097977-154097999 ACAGCTAGTCAGTGGCAGACTGG + Intronic
942518273 2:176775983-176776005 ATAGCTAGTAGGTGGCAAGCAGG + Intergenic
944026231 2:195171724-195171746 GCAGCTTGTAAGTGGCAAGCTGG + Intergenic
944861655 2:203821021-203821043 TCACCTACAGAGTAGCAAGCAGG - Intergenic
946458085 2:219845397-219845419 ACAGCCAGTCAGTGGCAAACTGG - Intergenic
947583276 2:231335195-231335217 ACAGCTGGTCAGTGGCCAGCAGG + Intronic
948303566 2:236928962-236928984 ACTGAAAGTGAGTATCAAGCAGG - Intergenic
948345210 2:237290554-237290576 AAAGCTGGCGAGTAGCACGCGGG - Intergenic
1170196527 20:13694585-13694607 ACAGCTATTGTGTGGCAAGAAGG - Intergenic
1170974713 20:21151162-21151184 ACAGCTAGTAAGTGGCATACTGG + Intronic
1172971361 20:38875285-38875307 ACAGCTAGAGAGTAGCTGGCTGG - Intronic
1173136608 20:40444272-40444294 CCTGCTAGTGAGAAGCCAGCTGG + Intergenic
1174504310 20:51006967-51006989 ACAGCTAGAGAGGAGAAAGCAGG + Intronic
1175177927 20:57124633-57124655 GCGGCTATTGAGTAGCAAGCTGG - Intergenic
1177712251 21:24793112-24793134 ACAGCTAGAGTAGAGCAAGCAGG - Intergenic
1178057683 21:28817818-28817840 ACAGCTAGTGAATGGGAAGCTGG - Intergenic
1178735273 21:35143552-35143574 ACTACTGGTGAGAAGCAAGCTGG + Intronic
1181895223 22:26101256-26101278 ACAGCTAGTAGGCAGCATGCAGG + Intergenic
1181979481 22:26755935-26755957 ACAGGTAGTGAATATAAAGCCGG - Intergenic
1182047322 22:27285478-27285500 ACAGCTAGATAGAAGGAAGCAGG + Intergenic
1182048271 22:27293459-27293481 AAAGCTAGTGAGCTGCAAACTGG + Intergenic
950381726 3:12621223-12621245 ACAGCTTGTAAGTGGCAAACTGG + Intronic
951197242 3:19838078-19838100 ACAGGCATAGAGTAGCAAGCCGG + Intergenic
951466574 3:23006410-23006432 TCATCTAGTGAGTAGAAACCAGG + Intergenic
953419771 3:42745409-42745431 ACAGCTGGTGAGTGGAGAGCTGG + Intronic
957253406 3:77804761-77804783 GCATCTAGTGAGTAGAAACCAGG - Intergenic
957848677 3:85776563-85776585 ACAGCTAGAGAATGGCAAGATGG - Intronic
958464859 3:94444761-94444783 AAAGATACAGAGTAGCAAGCTGG + Intergenic
961511192 3:127404808-127404830 ACAGCTAGTGAGTATGGAGCAGG - Intergenic
961945266 3:130680283-130680305 ACAGCTAGTAAACAGAAAGCTGG - Intronic
962340284 3:134576568-134576590 ACAGCTGCTAAGTGGCAAGCTGG - Intergenic
964416561 3:156454174-156454196 TAAGCTAGAGAGTAGCATGCAGG + Intronic
965745983 3:171926434-171926456 ACAGATAGAGAGTAGAAAGATGG + Intronic
966625015 3:182006320-182006342 GCAGATAGTGAGTAGTCAGCGGG + Intergenic
967711829 3:192717253-192717275 ACAGCTAGTAAGTTGCAGACTGG - Intronic
968120432 3:196122026-196122048 TAGGCTGGTGAGTAGCAAGCTGG + Intergenic
968249433 3:197193426-197193448 ACAGCTACTGAGAAACAAGCTGG + Intronic
969188782 4:5500204-5500226 CCAGTTAGTTAGTAGCCAGCAGG - Exonic
975777412 4:77802793-77802815 ACAGCTAGTAAGTGGCTAGACGG + Intronic
975912870 4:79289622-79289644 ACAGCTAGTTGGTGGGAAGCTGG + Intronic
976113098 4:81698209-81698231 ACAGCTAGCAAGTGGCAAGCAGG + Intronic
976873608 4:89827161-89827183 ACAGCTGGTAAGGAGTAAGCAGG + Intronic
976908860 4:90275224-90275246 ACATCTTTTGACTAGCAAGCTGG + Intronic
983004108 4:162461315-162461337 AAATCTAGTGAGTAGAAAGATGG + Intergenic
983967769 4:173834005-173834027 CCAGCAAGTGAGTAGCAATGTGG + Intergenic
985534348 5:455205-455227 ACGGCCAGTGAGTGGGAAGCTGG + Intronic
985645241 5:1081855-1081877 ACAGCTTGTGCGCCGCAAGCAGG + Intronic
985654207 5:1121616-1121638 ACAGCCAGTGAGTGGCAGGCAGG + Intergenic
985717676 5:1471788-1471810 ACAGCAAGTGAGAAGCACTCAGG + Intronic
985971613 5:3382658-3382680 ACAACGAGTGATTAGCAAGCTGG - Intergenic
986268387 5:6210268-6210290 ACAGCAGGTGACTAGGAAGCCGG + Intergenic
987227871 5:15862590-15862612 ACAGCTAGCGAGCAGGGAGCTGG + Intronic
987329520 5:16843493-16843515 ACAGTTAGTAAGCAGCAGGCAGG + Intronic
989177235 5:38539993-38540015 ACAGCTAGTAAGGAGCAAAGTGG + Intronic
993733910 5:91453092-91453114 ACAGGTAGTGAGCAGAAAGTGGG - Intergenic
996452332 5:123639709-123639731 ACAGCTAGTTAGTGGCATGAGGG - Intergenic
998390069 5:141781640-141781662 CCAGCAAGTGAGTGGCAGGCAGG + Intergenic
999270170 5:150292119-150292141 ACAGCCAGTGGGCAGCAGGCAGG + Intergenic
999517168 5:152313278-152313300 ACAGTAAGTAAATAGCAAGCTGG - Intergenic
999575823 5:152975338-152975360 ACAGCTAGTGAGTGGCAAATTGG - Intergenic
999923642 5:156350907-156350929 ACAGCTAGTAAGTAAAACGCTGG + Intronic
1001865038 5:175096576-175096598 AGAGCTCGTGAGTGGCCAGCTGG + Intergenic
1003729821 6:8809042-8809064 TCAGATAGTGAGTCACAAGCTGG + Intergenic
1006196724 6:32247530-32247552 ACAGCTACGGTGCAGCAAGCAGG + Intergenic
1007446268 6:41908762-41908784 ACAGCTGGCAAGTAGGAAGCGGG - Intronic
1007812819 6:44498283-44498305 ACAGCTAGGAAGTAGGGAGCTGG + Intergenic
1008034112 6:46728326-46728348 GCATCTAGTGAGTAGCAGTCAGG + Intronic
1010090723 6:71977788-71977810 AAAGCAAGTGAGTAGAAAGAGGG + Intronic
1012026321 6:93997084-93997106 GCAGCTTGTGAGTAGGAAGACGG + Intergenic
1013489332 6:110629894-110629916 CAAGCAAGTGAGTTGCAAGCTGG + Intronic
1013948500 6:115751432-115751454 ACAGCTATTTAGTTGGAAGCTGG + Intergenic
1017541717 6:155409363-155409385 ACAGCTAGTGAGTGGGAGTCAGG + Intronic
1017960451 6:159216758-159216780 ACAGTAAGTAAGAAGCAAGCTGG - Intronic
1017973328 6:159332168-159332190 CCACCTAGGGAGTAGAAAGCTGG + Intergenic
1018361906 6:163079020-163079042 ACAGCTAGTTAGTAGCAAGCTGG - Intronic
1022851588 7:34268427-34268449 ACATCTAGTGAGTAGAGACCAGG + Intergenic
1023118364 7:36884533-36884555 CCAGCTAGTGAGTAGGAACAGGG + Intronic
1029017485 7:97329324-97329346 ACAGCTAGTGAGGAACAGCCAGG - Intergenic
1031207257 7:118776374-118776396 ACAACTAGTAAGTTGCCAGCTGG + Intergenic
1031488026 7:122353200-122353222 ACAGCTAGATAGGAGCAAGGTGG + Intronic
1033100432 7:138465423-138465445 TCAGCTAATGAGTAGCAAACTGG + Intronic
1033168233 7:139059976-139059998 ACAGCTAATGGGTGGCAAGGTGG + Intronic
1037159790 8:15755164-15755186 ACAGCTAGTAACGAGCAGGCTGG - Intronic
1039353476 8:36789005-36789027 ACAGCTGGTGATTAGCTAGTTGG + Intronic
1039850519 8:41360937-41360959 GCAGCAAGTGAGAAGGAAGCTGG + Intergenic
1041028410 8:53710078-53710100 ACAGAAAATGAGTAGCAAGGAGG - Intergenic
1042829104 8:73007649-73007671 ACAGCTAGTGAGTAACTGGTAGG + Intergenic
1043555542 8:81426815-81426837 ACAGCTAGTAAGTAGCATATTGG + Intergenic
1043711701 8:83427018-83427040 ACTGCAAGAGAATAGCAAGCCGG - Intergenic
1044900918 8:96943580-96943602 ACAGCAAGAAAGTAGCAGGCTGG + Intronic
1046822109 8:118645174-118645196 TCAGCAAATGAGGAGCAAGCGGG + Intergenic
1046857390 8:119048788-119048810 AAAGCTATAGAGTGGCAAGCTGG - Intronic
1046981013 8:120336481-120336503 AGTCCTTGTGAGTAGCAAGCAGG - Intronic
1048095424 8:131287025-131287047 ACAGCTAGTCAGTCAGAAGCAGG - Intergenic
1050771910 9:9212581-9212603 ACAGCCAGTCAATAGAAAGCTGG + Intronic
1056876464 9:90338203-90338225 ACCACAAGTGAGTAGCAAGTTGG - Intergenic
1057596603 9:96419427-96419449 ACATCTAGCGGGTAGGAAGCCGG - Intergenic
1058898338 9:109419390-109419412 ACAGCTGAGGATTAGCAAGCAGG - Intronic
1059816304 9:117919649-117919671 ACAGCTTGTGAGTGGAAAGTCGG - Intergenic
1059935589 9:119307126-119307148 GCATCTCGTGGGTAGCAAGCAGG - Intronic
1060728002 9:126018578-126018600 GCATCTAGTGAGTAGAGAGCAGG - Intergenic
1060928700 9:127474123-127474145 ACAGCTTGTGCTTGGCAAGCTGG - Intronic
1187456246 X:19443737-19443759 GCAGCTAGAGAGGAGCAAACCGG + Intronic
1187474731 X:19600941-19600963 ACAGCTAGTTGGTAGCCAGAGGG + Intronic
1189185414 X:39050715-39050737 AGAACTAGTGAGTTGCAAGAGGG - Intergenic
1190095778 X:47479249-47479271 ATAGCTAGTAAGTGCCAAGCAGG + Intronic
1192552049 X:72062439-72062461 ACAGCTGGTGGGAAGCAAACTGG + Intergenic
1194556297 X:95364440-95364462 ACAGATTGTGAGTAGCAATACGG - Intergenic
1194996250 X:100594554-100594576 ACAGCTAGTGAGTAGCAGATTGG + Intronic
1200811503 Y:7490271-7490293 ACAGGAAGTGATAAGCAAGCGGG - Intergenic
1200937827 Y:8753708-8753730 ATAGATTGTGAGTAGCAATCAGG - Intergenic